Morpholino

MO4-tp53

ID
ZDB-MRPHLNO-070126-7
Name
MO4-tp53
Previous Names
  • MO2-tp53
  • p53MO (1)
  • p53-MO ATG (1)
Target
Sequence
5' - GCGCCATTGCTTTGCAAGAATTG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-tp53
Expressed Gene Anatomy Figures
alcama Fig. 4 with image from Smith et al., 2011
aldh1a2 Fig. 7 with image from Derrick et al., 2021
Fig. 7 with image from Feng et al., 2010
arxa Fig. 4 with image from Sanek et al., 2008
axin2 Fig. 9 with image from Mahmoudi et al., 2010
baxa Fig. S3 with image from Chakraborty et al., 2009
bbc3 Fig. 3 from Danilova et al., 2011
Fig. 6 from Rodríguez-Aznar et al., 2011
brf1a Fig. 5 from Danilova et al., 2011
casp8 Fig. 4 with image from Lin et al., 2021
Fig. 4 with image from Espín et al., 2013
casp9 Fig. 4 with image from Lin et al., 2021
cdkn1a FIGURE 7 with image from Zhang et al., 2021
Figure 5 with image from Chen et al., 2019
Fig. 4 with image from Pei et al., 2019
Fig. 3 with image from Provost et al., 2012
Fig. 3 from Danilova et al., 2011
Fig. S3 with image from Chakraborty et al., 2009
col2a1a Fig. 4 with image from Moreno-Ayala et al., 2015
Fig. 6 from van Boxtel et al., 2011
crestin Fig. 8 with image from Xia et al., 2013
cyp26a1 Fig. 7 with image from Feng et al., 2010
cyp26b1 Fig. 5 with image from Addison et al., 2018
cyp26c1 Fig. 5 with image from Addison et al., 2018
dlx2a Fig. 6 from van Boxtel et al., 2011
Fig. 4 with image from Viktorin et al., 2009
Fig. 4 with image from Sanek et al., 2008
dmbx1a Fig. 2 from Liu et al., 2008
dnm1a Fig. 3 with image from Bragato et al., 2023
egr2b Fig. 6 with image from Addison et al., 2018
Fig. 7 with image from Feng et al., 2010
elavl3 Fig. 4 with image from Viktorin et al., 2009
elavl4 Fig. 4 with image from Viktorin et al., 2009
emx1 Fig. 4 with image from Viktorin et al., 2009
emx3 Fig. 5 with image from Viktorin et al., 2009
en2a Fig. 12 with image from Murphy et al., 2017
eomesa Fig. 3 with image,  Fig. 4 with image from Viktorin et al., 2009
fabp2 Fig. 8 with image from Mahmoudi et al., 2010
fezf2 Fig. 4 with image from Viktorin et al., 2009
fgf8a Fig. 4 with image from Viktorin et al., 2009
fosab Fig. 5 from Danilova et al., 2011
foxg1a Fig. 4 with image,  Fig. 5 with image from Viktorin et al., 2009
fzd8a Fig. 4 with image from Viktorin et al., 2009
gadd45aa Fig. 6 from Liu et al., 2007
gadd45bb Fig. 4 from Zhai et al., 2019
gata1a Fig. 3 from Li et al., 2009
gnb3b Fig. 4 with image from Lin et al., 2021
grk7a Fig. 4 with image from Lin et al., 2021
gsc Fig. 6 from van Boxtel et al., 2011
hand2 Fig. 6 from van Boxtel et al., 2011
has2 Fig. 4 with image from Smith et al., 2011
irf7 Fig. 8 with image from Lu et al., 2015
isl1a Fig. 6 with image from Calarco et al., 2009
junba Fig. 5 from Danilova et al., 2011
klf2a Fig. 5 with image from Derrick et al., 2021
lamb1b Fig. 5 with image from Derrick et al., 2021
lhx5 Fig. 4 with image from Viktorin et al., 2009
mbpa Fig. 4 with image from Lin et al., 2021
Fig. 4 from Mathews et al., 2016
mdm2 Figure 5 with image from Chen et al., 2019
Fig. 4 with image from Pei et al., 2019
Fig. S3 with image from Chakraborty et al., 2009
mpx Fig. 3 with image from Provost et al., 2012
myb Fig. 4 with image from Zhao et al., 2021
Fig. 4 from Cai et al., 2018
myca Fig. 5 from Danilova et al., 2011
myl7 Fig. 6 with image from Derrick et al., 2021
myod1 Fig. 5 with image from Bragato et al., 2023
Fig. 2 with image from Große et al., 2019
Fig. 2 from Lim et al., 2009
neurod1 Fig. 5,  Fig. 6 from Itoh et al., 2021
Fig. 4 with image from Lin et al., 2021
Fig. 4 with image from Viktorin et al., 2009
neurod6b Fig. 4 with image from Viktorin et al., 2009
notch1b Fig. 4 from Espanola et al., 2020
otx2b Fig. S3 with image from Schaffer et al., 2014
pax2a Fig. 2 with image from Große et al., 2019
pax6a Fig. 4 with image from Viktorin et al., 2009
Fig. 2 from Liu et al., 2008
pfkma Fig. 4 from Danilova et al., 2011
pklr Fig. 4 from Danilova et al., 2011
plp1a Fig. 4 from Mathews et al., 2016
prl Fig. 8 from Graf et al., 2015
prss1 Fig. 8 with image from Qin et al., 2014
ptch1 Fig. S5 with image from Corallo et al., 2013
rag1 Fig. 4 with image from Zhao et al., 2021
Fig. 4 from Cai et al., 2018
reln Fig. 4 with image from Viktorin et al., 2009
runx1 Fig. 3 from Espanola et al., 2020
Fig. 7 with image from Lu et al., 2015
Fig. 3 from Danilova et al., 2011
scrt2 Fig. 4 from Rodríguez-Aznar et al., 2011
shha Fig. 4 with image from Moreno-Ayala et al., 2015
six3b Fig. 2 with image from Große et al., 2019
slc4a1a Fig. 6 from Liu et al., 2007
slc12a3 Fig. 4 with image from Naylor et al., 2017
slc17a6a Fig. 4 with image from Viktorin et al., 2009
slc17a6b Fig. 4 with image from Viktorin et al., 2009
sox9a Fig. 6 from van Boxtel et al., 2011
sox10 Fig. 6 from van Boxtel et al., 2011
stat3 Fig. 5 from Danilova et al., 2011
tbx20 Fig. 6 with image from Mouillesseaux et al., 2011
tbxta Fig. 4 with image from Moreno-Ayala et al., 2015
tcf4 Fig. 4 with image from Viktorin et al., 2009
thbs1b Fig. 6 with image from Mouillesseaux et al., 2011
tp53 Fig. 9 with image from Quelle-Regaldie et al., 2022
FIGURE 7 with image from Zhang et al., 2021
Figure 5 with image from Chen et al., 2019
Fig. 4 with image from Pei et al., 2019
Fig. 3 with image from DeRossi et al., 2017
Fig. 1 from Tao et al., 2013
Fig. 3 with image from Provost et al., 2012
Fig. S3 with image from Chakraborty et al., 2009
Fig. 3,  Fig. 4 from Lee et al., 2008
tp53bp1 Figure 6 with image from Yang et al., 2019
tp53i11a Figure 6 with image from Yang et al., 2019
tp53i11b Figure 6 with image from Yang et al., 2019
tp63 Fig 5 with image,  Fig. S6 from Chen et al., 2019
tpcn2 Fig. 3 from Kelu et al., 2015
ttn.2 Fig. 2 from Lim et al., 2009
wnt7ba Fig. 4 with image from Viktorin et al., 2009
wnt7bb Fig. 4 with image from Viktorin et al., 2009
Phenotype
Phenotype resulting from MO4-tp53
Phenotype Fish Figures
apoptotic process decreased occurrence, abnormal WT + MO4-tp53 Fig. 4 with image from Naylor et al., 2017
Fig. S3 with image from Chakraborty et al., 2009
Fig. S4 from Zeng et al., 2007
CaP motoneuron release of sequestered calcium ion into cytosol occurrence, abnormal nksaigff213aGt; zf415Tg + MO4-tp53 Fig. 5 with image from Kelu et al., 2018
double-strand break repair via homologous recombination increased frequency, abnormal WT + MO4-tp53 Fig. 1 from Gong et al., 2015
double-strand break repair via nonhomologous end joining increased frequency, abnormal WT + MO4-tp53 Fig. 1 from Gong et al., 2015
double-strand break repair via single-strand annealing increased frequency, abnormal WT + MO4-tp53 Fig. 1 from Gong et al., 2015
intestine well differentiated, abnormal WT + MO4-tp53 Fig. 8 with image from Mahmoudi et al., 2010
nucleate erythrocyte immature, abnormal WT + MO4-tp53 Fig. 5 with image from Imamura et al., 2008
peripheral nervous system development process quality, abnormal sb2Tg + MO4-tp53 Fig. 4 with image from Boer et al., 2016
smooth muscle cell endolysosome irregular spatial pattern, abnormal AB + MO4-tp53 Fig. 5 from Rice et al., 2022
trunk slow muscle cell ab-f59 labeling spatial pattern, abnormal AB + MO4-tp53 Fig. 2 from Rice et al., 2022
vertical myoseptum endolysosome irregular spatial pattern, abnormal AB + MO4-tp53 Fig. 5 from Rice et al., 2022
whole organism notch1b expression decreased amount, abnormal WT + MO4-tp53 Fig. 4 from Espanola et al., 2020
whole organism gadd45bb expression decreased amount, abnormal WT + MO4-tp53 Fig. 4 from Zhai et al., 2019
whole organism mdm2 expression increased amount, abnormal WT + MO4-tp53 Fig. 4 with image from Pei et al., 2019
whole organism tp53 expression increased amount, abnormal WT + MO4-tp53 Fig. 4 with image from Pei et al., 2019
whole organism cdkn1a expression increased amount, abnormal WT + MO4-tp53 Fig. 4 with image from Pei et al., 2019
whole organism posterior region ab1-casp3 labeling decreased amount, abnormal TU + MO4-tp53 Fig. 4 with image from Naylor et al., 2017
Phenotype of all Fish created by or utilizing MO4-tp53
Phenotype Fish Conditions Figures
rhombomere 4 Citrine expression increased distribution, abnormal fci3Tg/fci3Tg + MO1-epha4a + MO4-tp53 standard conditions Fig. 2 with image,  Fig. 6 with image from Addison et al., 2018
rhombomere 6 Citrine expression increased distribution, abnormal fci3Tg/fci3Tg + MO1-epha4a + MO4-tp53 standard conditions Fig. 2 with image from Addison et al., 2018
rhombomere 2 Citrine expression increased distribution, abnormal fci3Tg/fci3Tg + MO1-epha4a + MO4-tp53 standard conditions Fig. 2 with image from Addison et al., 2018
trunk musculature calcium-mediated signaling decreased process quality, abnormal hkz100Tg/hkz100Tg + MO1-tpcn1 + MO4-tp53 standard conditions Fig. 7 from Rice et al., 2022
trunk musculature calcium-mediated signaling decreased process quality, abnormal hkz100Tg/hkz100Tg + MO2-tpcn1 + MO4-tp53 standard conditions Fig. 7 from Rice et al., 2022
retinal inner plexiform layer decreased thickness, abnormal ptf1asa126/sa126 + MO1-ptf1a + MO4-ptf1a + MO4-tp53 standard conditions Fig. 2 with image from Randlett et al., 2013
amacrine cell absent, abnormal ptf1asa126/sa126 + MO1-ptf1a + MO4-ptf1a + MO4-tp53 standard conditions Fig. 2 with image from Randlett et al., 2013
mid cerebral vein branching involved in blood vessel morphogenesis decreased process quality, abnormal s843Tg/s843Tg + MO4-tp53 chemical treatment by environment: N-methyl-N-nitrosourea Fig. 2 with image from Fu et al., 2022
intersegmental vessel branching involved in blood vessel morphogenesis decreased process quality, abnormal s843Tg/s843Tg + MO4-tp53 chemical treatment by environment: N-methyl-N-nitrosourea Fig. 2 with image from Fu et al., 2022
intrinsic apoptotic signaling pathway in response to DNA damage disrupted, abnormal tp53zdf1/zdf1 + MO4-tp53 radiation Fig. 2 with image from Sidi et al., 2008
whole organism decreased sensitivity to irradiation, abnormal tp53zdf1/zdf1 + MO4-tp53 radiation Fig. 2 with image from Sidi et al., 2008
skeletal muscle sarcomere disorganized, abnormal ttn.2sfc11/sfc11 + MO4-tp53 + MO5-ttn.2 (EKW) standard conditions Fig. 3 with image from Zou et al., 2015
otic vesicle neurog1 expression increased amount, abnormal x21Tg/x21Tg + MO1-pax2a + MO4-tp53 (AB) heat shock Fig. 8 with image from Gou et al., 2018
otic vesicle atoh1a expression increased amount, abnormal x21Tg/x21Tg + MO1-pax2a + MO4-tp53 (AB) heat shock Fig. 8 with image from Gou et al., 2018
otic vesicle neurog1 expression increased distribution, abnormal x21Tg/x21Tg + MO1-pax2a + MO4-tp53 (AB) heat shock Fig. 8 with image from Gou et al., 2018
otic vesicle atoh1a expression increased distribution, abnormal x21Tg/x21Tg + MO1-pax2a + MO4-tp53 (AB) heat shock Fig. 8 with image from Gou et al., 2018
whole organism dorsalized, abnormal AB + MO1-adpgk + MO4-tp53 standard conditions Fig. S2 from Imle et al., 2019
whole organism decreased length, abnormal AB + MO1-adpgk + MO4-tp53 standard conditions Fig. S2 from Imle et al., 2019
eye edematous, abnormal AB + MO1-arhgdia + MO4-tp53 standard conditions Fig. 5,  Fig. S8 from Gee et al., 2013
whole organism edematous, abnormal AB + MO1-arhgdia + MO4-tp53 standard conditions Fig. 5,  Fig. S8 from Gee et al., 2013
neural crest cell migration involved in autonomic nervous system development disrupted, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 7 with image from Tu et al., 2012
mandibular arch skeleton decreased size, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 1 with image from Tu et al., 2012
enteric neuron decreased amount, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 3 with image from Tu et al., 2012
Kupffer's vesicle cilium decreased amount, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. S6 with image from Tu et al., 2012
apoptotic process decreased occurrence, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 8 with image from Tu et al., 2012
enteric nervous system development disrupted, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 7 with image from Tu et al., 2012
iridophore decreased amount, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 1 with image from Tu et al., 2012
trunk neural crest cell migration delayed, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 6 with image from Tu et al., 2012
epibranchial ganglion neuron decreased amount, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 3 with image from Tu et al., 2012
enteric neuron mislocalised, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 7 with image from Tu et al., 2012
pharyngeal arch cartilage absent, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 2 with image from Tu et al., 2012
melanocyte migration disrupted, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 1 with image from Tu et al., 2012
neurocranial trabecula decreased size, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 2 with image from Tu et al., 2012
cranial neural crest cell mislocalised, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 6 with image from Tu et al., 2012
trunk neural crest cell mislocalised, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 6 with image from Tu et al., 2012
pectoral fin absent, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 2 with image from Tu et al., 2012
vagal neural crest decreased size, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 7 with image from Tu et al., 2012
neural crest cell migration process quality, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 6 with image from Tu et al., 2012
melanocyte decreased amount, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 1 with image from Tu et al., 2012
regulation of smoothened signaling pathway disrupted, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. S5 with image from Tu et al., 2012
cranial neural crest decreased size, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 5 with image,  Fig. 6 with image from Tu et al., 2012
head decreased size, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 1 with image from Tu et al., 2012
ethmoid cartilage absent, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 2 with image from Tu et al., 2012
dorsal root ganglion neuron decreased amount, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 3 with image from Tu et al., 2012
determination of left/right symmetry disrupted, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. S6 with image from Tu et al., 2012
Kupffer's vesicle cilium decreased length, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. S6 with image from Tu et al., 2012
cilium assembly disrupted, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. S6 with image from Tu et al., 2012
enteric neuron decreased length, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 7 with image from Tu et al., 2012
embryo development disrupted, abnormal AB + MO1-atp13a2 + MO4-tp53 standard conditions text only from Lopes da Fonseca et al., 2013
whole organism increased curvature, abnormal AB + MO1-atp13a2 + MO4-tp53 standard conditions Fig. 5 from Lopes da Fonseca et al., 2013
whole organism dead, abnormal AB + MO1-atp13a2 + MO4-tp53 standard conditions text only from Lopes da Fonseca et al., 2013
trunk morphology, abnormal AB + MO1-bcl11ab + MO4-tp53 standard conditions Fig. 6 from Bagheri et al., 2016
eye decreased size, abnormal AB + MO1-bcl11ab + MO4-tp53 standard conditions Fig. 7 from Bagheri et al., 2016
brain decreased volume, abnormal AB + MO1-bcl11ab + MO4-tp53 standard conditions Fig. 8 from Bagheri et al., 2016
head decreased size, abnormal AB + MO1-bcl11ab + MO4-tp53 standard conditions Fig. 7 from Bagheri et al., 2016
head morphology, abnormal AB + MO1-bcl11ab + MO4-tp53 standard conditions Fig. 6 from Bagheri et al., 2016
brain development disrupted, abnormal AB + MO1-bcl11ab + MO4-tp53 standard conditions Fig. 8 from Bagheri et al., 2016
fin decreased size, abnormal AB + MO1-bcl11ab + MO4-tp53 standard conditions Fig. 7 from Bagheri et al., 2016
otic vesicle decreased size, abnormal AB + MO1-bcl11ab + MO4-tp53 standard conditions Fig. 7 from Bagheri et al., 2016
neuron apoptotic, abnormal AB + MO1-ca8 + MO4-tp53 standard conditions Fig. 6 from Aspatwar et al., 2013
whole organism dead, abnormal AB + MO1-ca8 + MO4-tp53 standard conditions Fig. 5 from Aspatwar et al., 2013
determination of heart left/right asymmetry disrupted, abnormal AB + MO1-ccsapb + MO4-tp53 standard conditions Fig. 6 from Backer et al., 2012
brain development disrupted, abnormal AB + MO1-ccsapb + MO4-tp53 standard conditions Fig. 4 from Backer et al., 2012
ventricular zone cell apoptotic, abnormal AB + MO1-ccsapb + MO4-tp53 standard conditions Fig. 4 from Backer et al., 2012
Mauthner neuron decreased amount, abnormal AB + MO1-ccsapb + MO4-tp53 standard conditions Fig. 5 from Backer et al., 2012
axonal fasciculation disrupted, abnormal AB + MO1-ccsapb + MO4-tp53 standard conditions Fig. 5 from Backer et al., 2012
central nervous system projection neuron axonogenesis disrupted, abnormal AB + MO1-ccsapb + MO4-tp53 standard conditions Fig. 5 from Backer et al., 2012
thigmotaxis disrupted, abnormal AB + MO1-ccsapb + MO4-tp53 standard conditions Fig. 4 from Backer et al., 2012
induction of programmed cell death increased occurrence, abnormal AB + MO1-ccsapb + MO4-tp53 standard conditions Fig. 5 from Backer et al., 2012
heart displaced to whole organism right side, abnormal AB + MO1-ccsapb + MO4-tp53 standard conditions Fig. 6 from Backer et al., 2012
somite border disorganized, abnormal AB + MO1-ccsapb + MO4-tp53 standard conditions Fig. 4 from Backer et al., 2012
heart displaced to whole organism medial side, abnormal AB + MO1-ccsapb + MO4-tp53 standard conditions Fig. 6 from Backer et al., 2012
hindbrain neuroepithelial cell decreased amount, abnormal AB + MO1-ccsapb + MO4-tp53 standard conditions Fig. 5 from Backer et al., 2012
brain decreased object quality, abnormal AB + MO1-ccsapb + MO4-tp53 standard conditions Fig. 4 from Backer et al., 2012
eye decreased size, abnormal AB + MO1-ccsapb + MO4-tp53 standard conditions Fig. 4 from Backer et al., 2012
heart edematous, abnormal AB + MO1-ccsapb + MO4-tp53 standard conditions Fig. 4 from Backer et al., 2012
myotome decreased width, abnormal AB + MO1-cd38 + MO4-tp53 standard conditions Fig. 5 with image from Kelu et al., 2018
muscle cell sarcomere morphology, abnormal AB + MO1-cd38 + MO4-tp53 standard conditions Fig. 5 with image from Kelu et al., 2018
muscle cell decreased width, abnormal AB + MO1-cd38 + MO4-tp53 standard conditions Fig. 5 with image from Kelu et al., 2018
muscle cell morphology, abnormal AB + MO1-cd38 + MO4-tp53 standard conditions Fig. 5 with image from Kelu et al., 2018
whole organism anterior-posterior axis morphology, abnormal AB + MO1-cep162 + MO4-tp53 standard conditions Fig. 2 from Wang et al., 2013
heart looping disrupted, abnormal AB + MO1-cep162 + MO4-tp53 standard conditions Fig. 2 from Wang et al., 2013
lateral plate mesoderm right side spaw expression mislocalised, abnormal AB + MO1-cep162 + MO4-tp53 standard conditions Fig. 2 from Wang et al., 2013
brain hydrocephalic, abnormal AB + MO1-cep162 + MO4-tp53 standard conditions Fig. 2 from Wang et al., 2013
muscle cell apoptotic, abnormal AB + MO1-col6a1 + MO4-tp53 chemical treatment: cyclosporin A Fig. 7 from Telfer et al., 2010
musculoskeletal movement disrupted, abnormal AB + MO1-col6a1 + MO4-tp53 standard conditions Fig. 8 from Telfer et al., 2010
muscle cell apoptotic, abnormal AB + MO1-col6a1 + MO4-tp53 standard conditions Fig. 7 from Telfer et al., 2010
whole organism edematous, abnormal AB + MO1-coq8b + MO4-tp53 standard conditions Fig. 2 from Ashraf et al., 2013
orbit edematous, abnormal AB + MO1-coq8b + MO4-tp53 standard conditions Fig. 2 from Ashraf et al., 2013
podocyte cell projection disorganized, abnormal AB + MO1-coq8b + MO4-tp53 standard conditions Fig. 2 from Ashraf et al., 2013
glomerular basement membrane disorganized, abnormal AB + MO1-coq8b + MO4-tp53 standard conditions Fig. 2 from Ashraf et al., 2013
podocyte development disrupted, abnormal AB + MO1-coq8b + MO4-tp53 standard conditions Fig. 2 from Ashraf et al., 2013
islet cell decreased amount, abnormal AB + MO1-dachb + MO4-tp53 standard conditions Fig. 5 with image from Yang et al., 2021
islet shape, abnormal AB + MO1-dachb + MO4-tp53 standard conditions Fig. 5 with image from Yang et al., 2021
CaP motoneuron axon ab1-tuba labeling spatial pattern, abnormal AB + MO1-dnm1a + MO4-tp53 control Fig. 4 with image from Bragato et al., 2023
CaP motoneuron neuron projection decreased branchiness, abnormal AB + MO1-dnm1a + MO4-tp53 control Fig. 4 with image from Bragato et al., 2023
muscle cell vacuole increased amount, abnormal AB + MO1-dnm1a + MO4-tp53 control Fig. 5 with image from Bragato et al., 2023
muscle cell increased distance muscle cell, abnormal AB + MO1-dnm1a + MO4-tp53 control Fig. 5 with image from Bragato et al., 2023
CaP motoneuron neuron projection decreased distribution, abnormal AB + MO1-dnm1a + MO4-tp53 control Fig. 4 with image from Bragato et al., 2023
muscle cell disorganized, abnormal AB + MO1-dnm1a + MO4-tp53 control Fig. 5 with image from Bragato et al., 2023
slow muscle cell spatial pattern, abnormal AB + MO1-dnm1a + MO4-tp53 control Fig. 5 with image from Bragato et al., 2023
muscle cell decreased amount, abnormal AB + MO1-dnm1a + MO4-tp53 control Fig. 5 with image from Bragato et al., 2023
muscle cell atrophied, abnormal AB + MO1-dnm1a + MO4-tp53 control Fig. 5 with image from Bragato et al., 2023
somite C-shaped, abnormal AB + MO1-dnm1a + MO4-tp53 control Fig. 3 with image from Bragato et al., 2023
post-vent region curved, abnormal AB + MO1-dnm1a + MO4-tp53 control Fig. 3 with image from Bragato et al., 2023
thigmotaxis process quality, abnormal AB + MO1-dnm1a + MO4-tp53 control Table 2 from Bragato et al., 2023
myotome skeletal muscle myoblast increased amount, abnormal AB + MO1-dnm1a + MO4-tp53 control Fig. 5 with image from Bragato et al., 2023
whole organism Ab-dnm1 labeling decreased amount, abnormal AB + MO1-dnm1a + MO4-tp53 control Fig. 3 with image from Bragato et al., 2023
hydrogen peroxide biosynthetic process disrupted, abnormal AB + MO1-duox + MO4-tp53 physical alteration: caudal fin Fig. 3 from Niethammer et al., 2009
leukocyte migration disrupted, abnormal AB + MO1-duox + MO4-tp53 physical alteration: caudal fin Fig. 3 from Niethammer et al., 2009
response to wounding disrupted, abnormal AB + MO1-duox + MO4-tp53 physical alteration: caudal fin Fig. 3 from Niethammer et al., 2009
whole organism Ab1-ehd1 labeling decreased amount, abnormal AB + MO1-ehd1b + MO4-tp53 control Fig. S4 from Issler et al., 2022
retina apoptotic process process quality, ameliorated AB + MO1-ehmt2 + MO4-tp53 standard conditions Fig. 5 with image from Olsen et al., 2016
brain vasculature hemorrhagic, abnormal AB + MO1-fcsk + MO4-tp53 control Fig. 2 with image from Fowler et al., 2021
lens protruding, abnormal AB + MO1-gdf6a + MO4-tp53 standard conditions Fig. 4,  Fig. 5 from Asai-Coakwell et al., 2007
post-vent region kinked, abnormal AB + MO1-gdf6a + MO4-tp53 standard conditions Fig. 3 from Asai-Coakwell et al., 2009
retina malformed, abnormal AB + MO1-gdf6a + MO4-tp53 standard conditions Fig. 5 from Asai-Coakwell et al., 2007
retina disorganized, abnormal AB + MO1-gdf6a + MO4-tp53 standard conditions Fig. 4 from Asai-Coakwell et al., 2007
cranial nerve II hypoplastic, abnormal AB + MO1-gdf6a + MO4-tp53 standard conditions Fig. 4 from Asai-Coakwell et al., 2007
optic fissure closure incomplete, abnormal AB + MO1-gdf6a + MO4-tp53 standard conditions Fig. 3 from Asai-Coakwell et al., 2009
Fig. 4,  Fig. 5 from Asai-Coakwell et al., 2007
lens vacuolated, abnormal AB + MO1-gdf6a + MO4-tp53 standard conditions Fig. 4 from Asai-Coakwell et al., 2007
eye decreased size, abnormal AB + MO1-gdf6a + MO4-tp53 standard conditions Fig. 3 from Asai-Coakwell et al., 2009
Fig. 4,  Fig. 5 from Asai-Coakwell et al., 2007
post-vent region decreased length, abnormal AB + MO1-hecw2a + MO4-tp53 control Fig. 2 from Lu et al., 2020
brain opaque, abnormal AB + MO1-hecw2a + MO4-tp53 control Fig. 2 from Lu et al., 2020
spinal cord opaque, abnormal AB + MO1-hecw2a + MO4-tp53 control Fig. 2 from Lu et al., 2020
eye opaque, abnormal AB + MO1-hecw2a + MO4-tp53 control Fig. 2 from Lu et al., 2020
whole organism deformed, abnormal AB + MO1-hecw2a + MO4-tp53 control Fig. 2 from Lu et al., 2020
post-vent region curved, abnormal AB + MO1-hecw2a + MO4-tp53 control Fig. 2 from Lu et al., 2020
otic vesicle decreased size, abnormal AB + MO1-hmx4 + MO2-hmx4 + MO4-tp53 standard conditions Fig. 2 with image from Gongal et al., 2011
eye adjacent to eye, abnormal AB + MO1-hmx4 + MO2-hmx4 + MO4-tp53 standard conditions Fig. 2 with image,  Fig. 5 with image from Gongal et al., 2011
pectoral fin absent, abnormal AB + MO1-hmx4 + MO2-hmx4 + MO4-tp53 standard conditions Fig. 2 with image from Gongal et al., 2011
neural tube closure incomplete, abnormal AB + MO1-hmx4 + MO2-hmx4 + MO4-tp53 standard conditions Fig. 2 with image,  Fig. 5 with image from Gongal et al., 2011
swim bladder bud hypoplastic, abnormal AB + MO1-ihha + MO4-tp53 standard conditions Fig. S3 with image from Winata et al., 2009
swim bladder morphogenesis disrupted, abnormal AB + MO1-ihha + MO4-tp53 standard conditions Fig. S3 with image from Winata et al., 2009
swim bladder hypoplastic, abnormal AB + MO1-ihha + MO4-tp53 standard conditions Fig. S3 with image from Winata et al., 2009
posterior lateral line neuromast decreased amount, abnormal AB + MO1-ildr1b + MO4-tp53 control Fig. S6 from Sang et al., 2014
Kupffer's vesicle tight junction structure, abnormal AB + MO1-jupa + MO4-tp53 standard conditions Fig. 5 with image from Dasgupta et al., 2018
Kupffer's vesicle anatomical space decreased volume, abnormal AB + MO1-jupa + MO4-tp53 standard conditions Fig. 5 with image from Dasgupta et al., 2018
whole organism edematous, abnormal AB + MO1-kank2 + MO4-tp53 standard conditions Fig. 4 from Gee et al., 2015
eye edematous, abnormal AB + MO1-kank2 + MO4-tp53 standard conditions Fig. 4 from Gee et al., 2015
podocyte cell projection absent, abnormal AB + MO1-kank2 + MO4-tp53 standard conditions Fig. 4 from Gee et al., 2015
glomerular basement membrane disorganized, abnormal AB + MO1-kank2 + MO4-tp53 standard conditions Fig. 4 from Gee et al., 2015
podocyte disorganized, abnormal AB + MO1-kank2 + MO4-tp53 standard conditions Fig. 4 from Gee et al., 2015
heart tube symmetry, abnormal AB + MO1-kif7 + MO4-tp53 standard conditions Fig. 3 from Wilson et al., 2009
determination of left/right symmetry disrupted, abnormal AB + MO1-kif7 + MO4-tp53 standard conditions Fig. 3 from Wilson et al., 2009
heart looping disrupted, abnormal AB + MO1-kif7 + MO4-tp53 standard conditions Fig. 3 from Wilson et al., 2009
heart tube inverted, abnormal AB + MO1-kif7 + MO4-tp53 standard conditions Fig. 3 from Wilson et al., 2009
trunk Ab1-ntn1 labeling increased distribution, abnormal AB + MO1-lamc3 + MO4-tp53 standard conditions Fig. 4 with image from Eve et al., 2017
muscle pioneer ntn1a expression increased distribution, abnormal AB + MO1-lamc3 + MO4-tp53 standard conditions Fig. 4 with image from Eve et al., 2017
trunk Ab1-ntn1 labeling spatial pattern, abnormal AB + MO1-lamc3 + MO4-tp53 standard conditions Fig. 4 with image from Eve et al., 2017
post-vent region curved, abnormal AB + MO1-lasp1 + MO2-lasp1 + MO4-tp53 standard conditions Figure 3 with image from Grossi et al., 2022
trunk decreased size, abnormal AB + MO1-lasp1 + MO2-lasp1 + MO4-tp53 standard conditions Figure 3 with image from Grossi et al., 2022
head decreased size, abnormal AB + MO1-lasp1 + MO2-lasp1 + MO4-tp53 standard conditions Figure 3 with image from Grossi et al., 2022
eye aplastic, abnormal AB + MO1-lasp1 + MO2-lasp1 + MO4-tp53 standard conditions Figure 3 with image from Grossi et al., 2022
embryo development disrupted, abnormal AB + MO1-lasp1 + MO2-lasp1 + MO4-tp53 standard conditions Figure 3 with image from Grossi et al., 2022
swimming decreased occurrence, abnormal AB + MO1-mfge8a + MO4-tp53 standard conditions Fig. 3 from Luo et al., 2023
somite actin filament disorganized, abnormal AB + MO1-mkxa + MO4-tp53 standard conditions Fig. 1 from Chuang et al., 2014
whole organism curved, abnormal AB + MO1-mkxa + MO4-tp53 standard conditions Fig. 1 from Chuang et al., 2014
somite focal adhesion decreased amount, abnormal AB + MO1-mkxa + MO4-tp53 standard conditions Fig. 1 from Chuang et al., 2014
skeletal muscle cell irregular spatial pattern, abnormal AB + MO1-mkxa + MO4-tp53 standard conditions Fig. 1 from Chuang et al., 2014
whole organism anterior-posterior axis decreased length, abnormal AB + MO1-mkxa + MO4-tp53 standard conditions Fig. 1 from Chuang et al., 2014
thigmotaxis disrupted, abnormal AB + MO1-mkxa + MO4-tp53 standard conditions Fig. 1 from Chuang et al., 2014
somite actin filament decondensed, abnormal AB + MO1-mkxa + MO4-tp53 standard conditions Fig. 1 from Chuang et al., 2014
eye size, ameliorated AB + MO1-mpi + MO4-tp53 standard conditions Fig. 3 with image from DeRossi et al., 2017
pericardium edematous, ameliorated AB + MO1-mpi + MO4-tp53 standard conditions Fig. 3 with image from DeRossi et al., 2017
head size, ameliorated AB + MO1-mpi + MO4-tp53 standard conditions Fig. 3 with image from DeRossi et al., 2017
liver size, ameliorated AB + MO1-mpi + MO4-tp53 standard conditions Fig. 3 with image from DeRossi et al., 2017
mandibular arch skeleton morphology, ameliorated AB + MO1-mpi + MO4-tp53 standard conditions Fig. 3 with image from DeRossi et al., 2017
whole organism life span, ameliorated AB + MO1-mpi + MO4-tp53 standard conditions Fig. 3 with image from DeRossi et al., 2017
whole organism tp53 expression amount, ameliorated AB + MO1-mpi + MO4-tp53 standard conditions Fig. 3 with image from DeRossi et al., 2017
apoptotic process process quality, ameliorated AB + MO1-mpi + MO4-tp53 standard conditions Fig. 3 with image from DeRossi et al., 2017
apoptotic process increased process quality, abnormal AB + MO1-msrb3 + MO4-tp53 control Fig. 5 with image from Shen et al., 2015
embryo development delayed, abnormal AB + MO1-nefla + MO4-tp53 standard conditions Fig. 4 from Wang et al., 2018
trunk bent, abnormal AB + MO1-neflb + MO4-tp53 standard conditions Fig. 5 from Wang et al., 2018
whole organism malformed, abnormal AB + MO1-neflb + MO4-tp53 standard conditions Fig. 5 from Wang et al., 2018
eye decreased size, abnormal AB + MO1-neflb + MO4-tp53 standard conditions Fig. 5 from Wang et al., 2018
thigmotaxis delayed, abnormal AB + MO1-neflb + MO4-tp53 standard conditions Fig. 5 from Wang et al., 2018
brain structure, abnormal AB + MO1-neflb + MO4-tp53 standard conditions Fig. 5 from Wang et al., 2018
brain development disrupted, abnormal AB + MO1-pcsk7 + MO4-tp53 standard conditions Fig. 4 from Turpeinen et al., 2013
otolith decreased amount, abnormal AB + MO1-pcsk7 + MO4-tp53 standard conditions Fig. 8 from Turpeinen et al., 2013
whole organism dead, abnormal AB + MO1-pcsk7 + MO4-tp53 standard conditions Fig. 4 from Turpeinen et al., 2013
heart development disrupted, abnormal AB + MO1-pcsk7 + MO4-tp53 standard conditions Fig. 4 from Turpeinen et al., 2013
otolith development disrupted, abnormal AB + MO1-pcsk7 + MO4-tp53 standard conditions Fig. 4 from Turpeinen et al., 2013
eye development disrupted, abnormal AB + MO1-pcsk7 + MO4-tp53 standard conditions Fig. 4 from Turpeinen et al., 2013
central nervous system myelination disrupted, abnormal AB + MO1-pgap3 + MO4-tp53 standard conditions Fig. 5 from Da'as et al., 2020
midbrain decreased size, abnormal AB + MO1-pgap3 + MO4-tp53 standard conditions Fig. 4 from Da'as et al., 2020
larval locomotory behavior process quality, abnormal AB + MO1-pgap3 + MO4-tp53 standard conditions Fig. 3 from Da'as et al., 2020
ventricular system dilated, abnormal AB + MO1-pgap3 + MO4-tp53 standard conditions Fig. 6 from Da'as et al., 2020
inner ear mislocalised, abnormal AB + MO1-pgap3 + MO4-tp53 standard conditions Fig. 4 from Da'as et al., 2020
brainstem malformed, abnormal AB + MO1-pgap3 + MO4-tp53 standard conditions Fig. 5 from Da'as et al., 2020
tectal ventricle separated from tectal ventricle, abnormal AB + MO1-pgap3 + MO4-tp53 standard conditions Fig. 5 from Da'as et al., 2020
swimming behavior process quality, abnormal AB + MO1-pgap3 + MO4-tp53 standard conditions Fig. 7 from Da'as et al., 2020
granular layer corpus cerebelli degeneration, abnormal AB + MO1-pgap3 + MO4-tp53 standard conditions Fig. 6 from Da'as et al., 2020
thigmotaxis disrupted, abnormal AB + MO1-pgap3 + MO4-tp53 standard conditions Fig. S Video 2 from Da'as et al., 2020
brain decreased size, abnormal AB + MO1-pgap3 + MO4-tp53 standard conditions Fig. 6 from Da'as et al., 2020
head decreased size, abnormal AB + MO1-pgap3 + MO4-tp53 standard conditions Fig. 4 from Da'as et al., 2020
ventricular system development disrupted, abnormal AB + MO1-pgap3 + MO4-tp53 standard conditions Fig. 3 from Da'as et al., 2020
midbrain hindbrain boundary morphology, abnormal AB + MO1-pgap3 + MO4-tp53 standard conditions Fig. 4,  Fig. 5 from Da'as et al., 2020
brain morphogenesis disrupted, abnormal AB + MO1-pgap3 + MO4-tp53 standard conditions Fig. 3 from Da'as et al., 2020
neural tube malformed, abnormal AB + MO1-pgap3 + MO4-tp53 standard conditions Fig. 3 from Da'as et al., 2020
brain development delayed, abnormal AB + MO1-pgap3 + MO4-tp53 standard conditions Fig. 4 from Da'as et al., 2020
brain degeneration, abnormal AB + MO1-pgap3 + MO4-tp53 standard conditions Fig. 6 from Da'as et al., 2020
optic tectum decreased size, abnormal AB + MO1-pgap3 + MO4-tp53 standard conditions Fig. 5 from Da'as et al., 2020
pronephros cystic, abnormal AB + MO1-pik3r4 + MO4-tp53 standard conditions Fig. 3 with image from Stoetzel et al., 2016
whole organism anterior-posterior axis curved, abnormal AB + MO1-pik3r4 + MO4-tp53 standard conditions Fig. 3 with image from Stoetzel et al., 2016
brain hydrocephalic, abnormal AB + MO1-pik3r4 + MO4-tp53 standard conditions Fig. 3 with image from Stoetzel et al., 2016
epiboly process quality, abnormal AB + MO1-prmt6 + MO4-tp53 standard conditions Fig. 2 from Zhao et al., 2016
whole organism gadd45aa expression increased amount, abnormal AB + MO1-prmt6 + MO4-tp53 standard conditions Fig. 4 from Zhao et al., 2016
apoptotic process process quality, abnormal AB + MO1-prmt6 + MO4-tp53 standard conditions Fig. 4 from Zhao et al., 2016
whole organism jun expression increased amount, abnormal AB + MO1-prmt6 + MO4-tp53 standard conditions Fig. 4 from Zhao et al., 2016
whole organism tp53 expression increased amount, abnormal AB + MO1-prmt6 + MO4-tp53 standard conditions Fig. 4 from Zhao et al., 2016
whole organism cdkn1a expression increased amount, abnormal AB + MO1-prmt6 + MO4-tp53 standard conditions Fig. 4 from Zhao et al., 2016
whole organism ab12-tp53 labeling amount, ameliorated AB + MO1-prmt6 + MO4-tp53 standard conditions Fig. 2 from Zhao et al., 2016
brain development disrupted, abnormal AB + MO1-qdprb.1 + MO4-tp53 standard conditions Fig. S3 with image from Breuer et al., 2019
midbrain morphology, abnormal AB + MO1-qdprb.1 + MO4-tp53 standard conditions Fig. S3 with image from Breuer et al., 2019
hindbrain morphology, abnormal AB + MO1-qdprb.1 + MO4-tp53 standard conditions Fig. S3 with image from Breuer et al., 2019
whole organism glutamine increased amount, abnormal AB + MO1-qdprb.1 + MO4-tp53 standard conditions Fig. S4 from Breuer et al., 2019
head decreased size, abnormal AB + MO1-qdprb.1 + MO4-tp53 standard conditions Fig. S3 with image from Breuer et al., 2019
brain decreased volume, abnormal AB + MO1-rel + MO4-tp53 standard conditions Fig. 8 from Bagheri et al., 2016
fourth ventricle morphology, abnormal AB + MO1-rel + MO4-tp53 standard conditions Fig. 8 from Bagheri et al., 2016
common myeloid progenitor spi1b expression amount, ameliorated AB + MO1-rpl5a + MO4-tp53 standard conditions Fig. 2 with image from Wan et al., 2016
angioblastic mesenchymal cell tal1 expression amount, ameliorated AB + MO1-rpl5a + MO4-tp53 standard conditions Fig. 2 with image from Wan et al., 2016
hematopoietic stem cell myb expression amount, ameliorated AB + MO1-rpl5a + MO4-tp53 standard conditions Fig. 2 with image from Wan et al., 2016
hematopoietic stem cell runx1 expression amount, ameliorated AB + MO1-rpl5a + MO4-tp53 standard conditions Fig. 2 with image from Wan et al., 2016
heart nucleate erythrocyte amount, ameliorated AB + MO1-rpl5a + MO4-tp53 standard conditions Fig. 1 with image from Wan et al., 2016
erythroid progenitor cell gata1a expression amount, ameliorated AB + MO1-rpl5a + MO4-tp53 standard conditions Fig. 2 with image from Wan et al., 2016
heart morphology, abnormal AB + MO1-sap30l + MO4-tp53 standard conditions text only from Teittinen et al., 2012
heart contraction decreased efficiency, abnormal AB + MO1-sap30l + MO4-tp53 standard conditions text only from Teittinen et al., 2012
heart contraction decreased rate, abnormal AB + MO1-sap30l + MO4-tp53 standard conditions text only from Teittinen et al., 2012
heart looping disrupted, abnormal AB + MO1-sap30l + MO4-tp53 standard conditions text only from Teittinen et al., 2012
blood circulation decreased process quality, abnormal AB + MO1-sel1l + MO4-tp53 standard conditions Table 2 from Barbieri et al., 2017
pericardium edematous, abnormal AB + MO1-sel1l + MO4-tp53 standard conditions Table 2 from Barbieri et al., 2017
blood accumulation post-vent region, abnormal AB + MO1-sel1l + MO4-tp53 standard conditions Table 2 from Barbieri et al., 2017
anterior lateral line neuromast hair cell apoptotic, abnormal AB + MO1-slc26a2 + MO4-tp53 standard conditions Fig. 6 with image from Liu et al., 2015
posterior lateral line neuromast hair cell apoptotic, abnormal AB + MO1-slc26a2 + MO4-tp53 standard conditions Fig. 6 with image from Liu et al., 2015
neural tube apoptotic process increased occurrence, abnormal AB + MO1-smc1a + MO4-tp53 standard conditions Fig. 4 from Fazio et al., 2016
eye edematous, abnormal AB + MO1-srgap2 + MO4-tp53 standard conditions Fig. 6 from Pan et al., 2017
trunk edematous, abnormal AB + MO1-srgap2 + MO4-tp53 standard conditions Fig. 6 from Pan et al., 2017
pronephric glomerulus podocyte foot morphology, abnormal AB + MO1-srgap2 + MO4-tp53 standard conditions Fig. 6 from Pan et al., 2017
pericardium edematous, abnormal AB + MO1-srgap2 + MO4-tp53 standard conditions Fig. 6 from Pan et al., 2017
pronephric glomerulus slit diaphragm disorganized, abnormal AB + MO1-srgap2 + MO4-tp53 standard conditions Fig. 6 from Pan et al., 2017
pronephric glomerular basement membrane disorganized, abnormal AB + MO1-srgap2 + MO4-tp53 standard conditions Fig. 6 from Pan et al., 2017
determination of left/right symmetry disrupted, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. 3,  Fig. S11 from Wilson et al., 2009
lateral floor plate aplastic, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. 2,  Fig. S5 from Wilson et al., 2009
Kupffer's vesicle altered number of ciliated cell axonemal microtubule, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. 3 from Wilson et al., 2009
heart tube symmetry, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. 3 from Wilson et al., 2009
liver inverted, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. S11 from Wilson et al., 2009
floor plate formation disrupted, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. 2,  Fig. S5 from Wilson et al., 2009
medial floor plate morphology, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. S5 from Wilson et al., 2009
smoothened signaling pathway disrupted, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. 2 from Wilson et al., 2009
Kupffer's vesicle axoneme disorganized, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. 3 from Wilson et al., 2009
heart tube inverted, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. 3 from Wilson et al., 2009
atrium inverted, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. S11 from Wilson et al., 2009
liver position, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. S11 from Wilson et al., 2009
somite muscle pioneer absent, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. 2 from Wilson et al., 2009
axoneme assembly disrupted, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. 3 from Wilson et al., 2009
heart tube straight, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. S11 from Wilson et al., 2009
eye fused with eye, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions text only from Wilson et al., 2009
heart looping disrupted, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. 3,  Fig. S11 from Wilson et al., 2009
somite U-shaped, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. 2 from Wilson et al., 2009
cilium or flagellum-dependent cell motility disrupted, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. 3 from Wilson et al., 2009
gut position, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. S11 from Wilson et al., 2009
pancreas inverted, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. S11 from Wilson et al., 2009
pancreas position, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. S11 from Wilson et al., 2009
midbrain hindbrain boundary malformed, abnormal AB + MO1-tfpi2 + MO4-tp53 standard conditions Fig. 4 with image from Zhang et al., 2013
third ventricle decreased size, abnormal AB + MO1-tfpi2 + MO4-tp53 standard conditions Fig. 4 with image from Zhang et al., 2013
fourth ventricle decreased size, abnormal AB + MO1-tfpi2 + MO4-tp53 standard conditions Fig. 4 with image from Zhang et al., 2013
trunk slow muscle cell ab-f59 labeling spatial pattern, ameliorated AB + MO1-tpcn1 + MO2-tpcn1 + MO4-tp53 standard conditions Fig. 1 from Rice et al., 2022
trunk slow muscle cell ab-f59 labeling spatial pattern, abnormal AB + MO1-tpcn1 + MO2-tpcn1 + MO4-tp53 standard conditions Fig. 2 from Rice et al., 2022
trunk fast muscle cell ab-f59 labeling spatial pattern, ameliorated AB + MO1-tpcn1 + MO2-tpcn1 + MO4-tp53 standard conditions Fig. 1 from Rice et al., 2022
vertical myoseptum ab-f59 labeling spatial pattern, ameliorated AB + MO1-tpcn1 + MO2-tpcn1 + MO4-tp53 standard conditions Fig. 1 from Rice et al., 2022
vertical myoseptum endolysosome irregular spatial pattern, abnormal AB + MO1-tpcn1 + MO4-tp53 standard conditions Fig. 5 from Rice et al., 2022
smooth muscle cell endolysosome irregular spatial pattern, abnormal AB + MO1-tpcn1 + MO4-tp53 standard conditions Fig. 5 from Rice et al., 2022
vertical myoseptum ab-f59 labeling spatial pattern, abnormal AB + MO1-tpcn1 + MO4-tp53 standard conditions Fig. 1,  Fig. 2 from Rice et al., 2022
trunk fast muscle cell ab-f59 labeling spatial pattern, abnormal AB + MO1-tpcn1 + MO4-tp53 standard conditions Fig. 1 from Rice et al., 2022
trunk slow muscle cell ab-f59 labeling spatial pattern, abnormal AB + MO1-tpcn1 + MO4-tp53 standard conditions Fig. 1,  Fig. 2 from Rice et al., 2022
somite 8 vertical myoseptum ab3-dag1 labeling spatial pattern, abnormal AB + MO1-tpcn1 + MO4-tp53 standard conditions Fig. 6 from Rice et al., 2022
somite 9 vertical myoseptum ab3-dag1 labeling spatial pattern, abnormal AB + MO1-tpcn1 + MO4-tp53 standard conditions Fig. 6 from Rice et al., 2022
slow muscle cell tpcn2 expression decreased amount, abnormal AB + MO1-tpcn2 + MO4-tp53 standard conditions Fig. 3 from Kelu et al., 2015
slow muscle cell ab-f59 labeling decreased amount, abnormal AB + MO1-tpcn2 + MO4-tp53 standard conditions Fig. 3 from Kelu et al., 2015
forebrain apoptotic process increased occurrence, abnormal AB + MO1-tulp3 + MO4-tp53 standard conditions Figure 6 with image from Kerek et al., 2020
hindbrain apoptotic process increased occurrence, abnormal AB + MO1-tulp3 + MO4-tp53 standard conditions Figure 6 with image from Kerek et al., 2020
embryo development delayed, abnormal AB + MO1-tulp3 + MO4-tp53 standard conditions Figure 6 with image from Kerek et al., 2020
eye decreased circumference, abnormal AB + MO1-uhrf1 + MO4-tp53 standard conditions Fig. S5 from Chu et al., 2012
eye decreased size, abnormal AB + MO1-uhrf1 + MO4-tp53 standard conditions Fig. S5 from Chu et al., 2012
midbrain hindbrain boundary morphology, abnormal AB + MO1-uhrf1 + MO4-tp53 standard conditions Fig. S5 from Chu et al., 2012
whole organism dead, abnormal AB + MO1-uhrf1 + MO4-tp53 standard conditions Fig. S5 from Chu et al., 2012
whole organism decreased life span, abnormal AB + MO1-uhrf1 + MO4-tp53 standard conditions Fig. S5 from Chu et al., 2012
embryo development disrupted, abnormal AB + MO1-uhrf1 + MO4-tp53 standard conditions Fig. S5 from Chu et al., 2012
eye decreased size, abnormal AB + MO1-xpo1a + MO4-tp53 standard conditions Fig. 7 from Bagheri et al., 2016
brain decreased volume, abnormal AB + MO1-xpo1a + MO4-tp53 standard conditions Fig. 8 from Bagheri et al., 2016
trunk morphology, abnormal AB + MO1-xpo1a + MO4-tp53 standard conditions Fig. 6,  Fig. 7 from Bagheri et al., 2016
head decreased size, abnormal AB + MO1-xpo1a + MO4-tp53 standard conditions Fig. 7 from Bagheri et al., 2016
head morphology, abnormal AB + MO1-xpo1a + MO4-tp53 standard conditions Fig. 6 from Bagheri et al., 2016
fin decreased size, abnormal AB + MO1-xpo1a + MO4-tp53 standard conditions Fig. 7 from Bagheri et al., 2016
fourth ventricle morphology, abnormal AB + MO1-xpo1a + MO4-tp53 standard conditions Fig. 8 from Bagheri et al., 2016
trunk curved, abnormal AB + MO1-xpo1a + MO4-tp53 standard conditions Fig. 7 from Bagheri et al., 2016
otic vesicle decreased size, abnormal AB + MO1-xpo1a + MO4-tp53 standard conditions Fig. 7 from Bagheri et al., 2016
eye decreased diameter, abnormal AB + MO1-zgc:112052 + MO4-tp53 standard conditions FIGURE 3 with image from Mignani et al., 2020
brain decreased size, abnormal AB + MO1-zgc:112052 + MO4-tp53 standard conditions FIGURE 3 with image from Mignani et al., 2020
brain morphology, abnormal AB + MO1-zgc:112052 + MO4-tp53 standard conditions FIGURE 3 with image from Mignani et al., 2020
eye decreased size, abnormal AB + MO1-zgc:112052 + MO4-tp53 standard conditions FIGURE 3 with image from Mignani et al., 2020
retina apoptotic process process quality, ameliorated AB + MO1-znf644b + MO4-tp53 standard conditions Fig. 5 with image from Olsen et al., 2016
whole organism dorsalized, abnormal AB + MO2-adpgk + MO4-tp53 standard conditions Fig. S2 from Imle et al., 2019
whole organism decreased length, abnormal AB + MO2-adpgk + MO4-tp53 standard conditions Fig. S2 from Imle et al., 2019
post-vent region decreased size, abnormal AB + MO2-bcl11aa + MO4-tp53 standard conditions Fig. 7 from Bagheri et al., 2016
trunk morphology, abnormal AB + MO2-bcl11aa + MO4-tp53 standard conditions Fig. 6 from Bagheri et al., 2016
eye decreased size, abnormal AB + MO2-bcl11aa + MO4-tp53 standard conditions Fig. 7 from Bagheri et al., 2016
brain decreased volume, abnormal AB + MO2-bcl11aa + MO4-tp53 standard conditions Fig. 8 from Bagheri et al., 2016
head morphology, abnormal AB + MO2-bcl11aa + MO4-tp53 standard conditions Fig. 6 from Bagheri et al., 2016
brain development disrupted, abnormal AB + MO2-bcl11aa + MO4-tp53 standard conditions Fig. 8 from Bagheri et al., 2016
fin decreased size, abnormal AB + MO2-bcl11aa + MO4-tp53 standard conditions Fig. 7 from Bagheri et al., 2016
otic vesicle decreased size, abnormal AB + MO2-bcl11aa + MO4-tp53 standard conditions Fig. 7 from Bagheri et al., 2016
ventricular system lumenized, abnormal AB + MO2-cldn5a + MO4-tp53 standard conditions Fig. 3 with image from Zhang et al., 2010
fourth ventricle decreased volume, abnormal AB + MO2-cldn5a + MO4-tp53 standard conditions Fig. 3 with image from Zhang et al., 2010
ventricular system development disrupted, abnormal AB + MO2-cldn5a + MO4-tp53 standard conditions Fig. 3 with image from Zhang et al., 2010
tectal ventricle decreased volume, abnormal AB + MO2-cldn5a + MO4-tp53 standard conditions Fig. 3 with image from Zhang et al., 2010
orbit edematous, abnormal AB + MO2-coq8b + MO4-tp53 standard conditions Fig. S1 from Ashraf et al., 2013
whole organism edematous, abnormal AB + MO2-coq8b + MO4-tp53 standard conditions Fig. S1 from Ashraf et al., 2013
endocrine pancreas development disrupted, abnormal AB + MO2-dachb + MO4-tp53 standard conditions Fig. 4 with image from Yang et al., 2021
whole organism ins expression decreased amount, abnormal AB + MO2-dachb + MO4-tp53 standard conditions Fig. 8 with image from Yang et al., 2021
whole organism nkx6.1 expression decreased amount, abnormal AB + MO2-dachb + MO4-tp53 standard conditions Fig. 8 with image from Yang et al., 2021
islet ab2-isl labeling decreased amount, abnormal AB + MO2-dachb + MO4-tp53 standard conditions Fig. 4 with image from Yang et al., 2021
whole organism neurod1 expression decreased amount, abnormal AB + MO2-dachb + MO4-tp53 standard conditions Fig. 8 with image from Yang et al., 2021
whole organism ptf1a expression decreased amount, abnormal AB + MO2-dachb + MO4-tp53 standard conditions Fig. 8 with image from Yang et al., 2021
type B pancreatic cell development disrupted, abnormal AB + MO2-dachb + MO4-tp53 standard conditions Fig. 4 with image from Yang et al., 2021
islet cell decreased amount, abnormal AB + MO2-dachb + MO4-tp53 standard conditions Fig. 4 with image,  Fig. 5 with image from Yang et al., 2021
whole organism insm1a expression decreased amount, abnormal AB + MO2-dachb + MO4-tp53 standard conditions Fig. 8 with image from Yang et al., 2021
whole organism dachb expression decreased amount, abnormal AB + MO2-dachb + MO4-tp53 standard conditions Fig. 3 with image,  Fig. 7 with image from Yang et al., 2021
whole organism dacha expression decreased amount, abnormal AB + MO2-dachb + MO4-tp53 standard conditions Fig. 7 with image from Yang et al., 2021
pancreatic B cell decreased amount, abnormal AB + MO2-dachb + MO4-tp53 standard conditions Fig. 4 with image,  Fig. 5 with image from Yang et al., 2021
islet shape, abnormal AB + MO2-dachb + MO4-tp53 standard conditions Fig. 4 with image from Yang et al., 2021
whole organism pax6a expression decreased amount, abnormal AB + MO2-dachb + MO4-tp53 standard conditions Fig. 8 with image from Yang et al., 2021
islet cell decreased volume, abnormal AB + MO2-dachb + MO4-tp53 standard conditions Fig. 4 with image,  Fig. 5 with image from Yang et al., 2021
whole organism sst2 expression decreased amount, abnormal AB + MO2-dachb + MO4-tp53 standard conditions Fig. 8 with image from Yang et al., 2021
pancreatic B cell ins expression decreased amount, abnormal AB + MO2-dachb + MO4-tp53 standard conditions Fig. 4 with image from Yang et al., 2021
CaP motoneuron axon ab1-tuba labeling spatial pattern, abnormal AB + MO2-dnm1a + MO4-tp53 control Fig. 4 with image from Bragato et al., 2023
CaP motoneuron neuron projection decreased branchiness, abnormal AB + MO2-dnm1a + MO4-tp53 control Fig. 4 with image from Bragato et al., 2023
muscle cell vacuole increased amount, abnormal AB + MO2-dnm1a + MO4-tp53 control Fig. 5 with image from Bragato et al., 2023
whole organism dnm1a expression absent, abnormal AB + MO2-dnm1a + MO4-tp53 control Fig. 3 with image from Bragato et al., 2023
muscle cell increased distance muscle cell, abnormal AB + MO2-dnm1a + MO4-tp53 control Fig. 5 with image from Bragato et al., 2023
CaP motoneuron neuron projection decreased distribution, abnormal AB + MO2-dnm1a + MO4-tp53 control Fig. 4 with image from Bragato et al., 2023
muscle cell disorganized, abnormal AB + MO2-dnm1a + MO4-tp53 control Fig. 5 with image from Bragato et al., 2023
slow muscle cell spatial pattern, abnormal AB + MO2-dnm1a + MO4-tp53 control Fig. 5 with image from Bragato et al., 2023
muscle cell decreased amount, abnormal AB + MO2-dnm1a + MO4-tp53 control Fig. 5 with image from Bragato et al., 2023
muscle cell atrophied, abnormal AB + MO2-dnm1a + MO4-tp53 control Fig. 5 with image from Bragato et al., 2023
somite C-shaped, abnormal AB + MO2-dnm1a + MO4-tp53 control Fig. 3 with image from Bragato et al., 2023
post-vent region curved, abnormal AB + MO2-dnm1a + MO4-tp53 control Fig. 3 with image from Bragato et al., 2023
thigmotaxis process quality, abnormal AB + MO2-dnm1a + MO4-tp53 control Table 2 from Bragato et al., 2023
myotome skeletal muscle myoblast increased amount, abnormal AB + MO2-dnm1a + MO4-tp53 control Fig. 5 with image from Bragato et al., 2023
dorsal telencephalon morphology, abnormal AB + MO2-emx3 + MO3-emx3 + MO4-tp53 heat shock Fig. 6 with image from Viktorin et al., 2009
epibranchial ganglion decreased amount, abnormal AB + MO2-fgf24 + MO4-tp53 standard conditions Fig. 7 with image from Padanad et al., 2011
Kupffer's vesicle tight junction structure, abnormal AB + MO2-jupa + MO4-tp53 standard conditions Fig. 5 with image from Dasgupta et al., 2018
Kupffer's vesicle anatomical space decreased volume, abnormal AB + MO2-jupa + MO4-tp53 chemical treatment by environment: CFTR potentiator Fig. 5 with image from Dasgupta et al., 2018
Kupffer's vesicle anatomical space decreased volume, abnormal AB + MO2-jupa + MO4-tp53 control Fig. 5 with image from Dasgupta et al., 2018
podocyte cell projection absent, abnormal AB + MO2-kank2 + MO4-tp53 standard conditions Fig. S5 from Gee et al., 2015
whole organism edematous, abnormal AB + MO2-kank2 + MO4-tp53 standard conditions Fig. 4 from Gee et al., 2015
glomerular basement membrane disorganized, abnormal AB + MO2-kank2 + MO4-tp53 standard conditions Fig. S5 from Gee et al., 2015
podocyte disorganized, abnormal AB + MO2-kank2 + MO4-tp53 standard conditions Fig. S5 from Gee et al., 2015
eye edematous, abnormal AB + MO2-kank2 + MO4-tp53 standard conditions Fig. 4 from Gee et al., 2015
apoptotic process increased process quality, abnormal AB + MO2-msrb3 + MO4-tp53 control Fig. 5 with image from Shen et al., 2015
epiboly process quality, abnormal AB + MO2-prmt6 + MO4-tp53 standard conditions Fig. 2 from Zhao et al., 2016
whole organism gadd45aa expression increased amount, abnormal AB + MO2-prmt6 + MO4-tp53 standard conditions Fig. 4 from Zhao et al., 2016
apoptotic process process quality, abnormal AB + MO2-prmt6 + MO4-tp53 standard conditions Fig. 4 from Zhao et al., 2016
whole organism jun expression increased amount, abnormal AB + MO2-prmt6 + MO4-tp53 standard conditions Fig. 4 from Zhao et al., 2016
whole organism tp53 expression increased amount, abnormal AB + MO2-prmt6 + MO4-tp53 standard conditions Fig. 4 from Zhao et al., 2016
whole organism cdkn1a expression increased amount, abnormal AB + MO2-prmt6 + MO4-tp53 standard conditions Fig. 4 from Zhao et al., 2016
whole organism ab12-tp53 labeling amount, ameliorated AB + MO2-prmt6 + MO4-tp53 standard conditions Fig. 2 from Zhao et al., 2016
heart morphology, abnormal AB + MO2-sap30l + MO4-tp53 standard conditions text only from Teittinen et al., 2012
heart contraction decreased efficiency, abnormal AB + MO2-sap30l + MO4-tp53 standard conditions text only from Teittinen et al., 2012
heart contraction decreased rate, abnormal AB + MO2-sap30l + MO4-tp53 standard conditions text only from Teittinen et al., 2012
heart looping disrupted, abnormal AB + MO2-sap30l + MO4-tp53 standard conditions text only from Teittinen et al., 2012
midbrain decreased size, abnormal AB + MO2-scgn + MO4-tp53 standard conditions Fig. S11 from Qin et al., 2020
intermediate cell mass of mesoderm gata1a expression decreased amount, abnormal AB + MO2-sparc + MO4-tp53 control Fig. 6 from Ceinos et al., 2013
otolith decreased amount, abnormal AB + MO2-tgfb1a + MO4-tp53 standard conditions Fig. 10 from Turpeinen et al., 2013
vertical myoseptum endolysosome irregular spatial pattern, abnormal AB + MO2-tpcn1 + MO4-tp53 standard conditions Fig. 5 from Rice et al., 2022
smooth muscle cell endolysosome irregular spatial pattern, abnormal AB + MO2-tpcn1 + MO4-tp53 standard conditions Fig. 5 from Rice et al., 2022
vertical myoseptum ab-f59 labeling spatial pattern, abnormal AB + MO2-tpcn1 + MO4-tp53 standard conditions Fig. 1,  Fig. 2 from Rice et al., 2022
trunk fast muscle cell ab-f59 labeling spatial pattern, abnormal AB + MO2-tpcn1 + MO4-tp53 standard conditions Fig. 1 from Rice et al., 2022
trunk slow muscle cell ab-f59 labeling spatial pattern, abnormal AB + MO2-tpcn1 + MO4-tp53 standard conditions Fig. 1,  Fig. 2 from Rice et al., 2022
somite 8 vertical myoseptum ab3-dag1 labeling spatial pattern, abnormal AB + MO2-tpcn1 + MO4-tp53 standard conditions Fig. 6 from Rice et al., 2022
somite 9 vertical myoseptum ab3-dag1 labeling spatial pattern, abnormal AB + MO2-tpcn1 + MO4-tp53 standard conditions Fig. 6 from Rice et al., 2022
Meckel's cartilage absent, abnormal AB + MO2-vdrb + MO4-tp53 standard conditions Fig. 1 with image from Kwon, 2019
palatoquadrate cartilage absent, abnormal AB + MO2-vdrb + MO4-tp53 standard conditions Fig. 1 with image from Kwon, 2019
spinal cord fsta expression increased amount, abnormal AB + MO2-vdrb + MO4-tp53 standard conditions Fig. 2 with image from Kwon, 2019
pharyngeal arch fsta expression increased amount, abnormal AB + MO2-vdrb + MO4-tp53 standard conditions Fig. 2 with image from Kwon, 2019
heart decreased functionality, abnormal AB + MO2-vdrb + MO4-tp53 standard conditions Fig. 2 from Kwon, 2016
brain fsta expression increased amount, abnormal AB + MO2-vdrb + MO4-tp53 standard conditions Fig. 2 with image from Kwon, 2019
cranial cartilage morphology, abnormal AB + MO2-vdrb + MO4-tp53 standard conditions Fig. 1 with image from Kwon, 2019
eye fsta expression increased amount, abnormal AB + MO2-vdrb + MO4-tp53 standard conditions Fig. 2 with image from Kwon, 2019
pericardium edematous, abnormal AB + MO2-vdrb + MO4-tp53 standard conditions Fig. 1 from Kwon, 2016
cranial cartilage hypoplastic, abnormal AB + MO2-vdrb + MO4-tp53 standard conditions Fig. 1 with image from Kwon, 2019
ceratobranchial cartilage decreased size, abnormal AB + MO2-vdrb + MO4-tp53 standard conditions Fig. 1 with image from Kwon, 2019
midbrain hindbrain boundary constriction midbrain-hindbrain boundary morphogenesis process quality, abnormal AB + MO2-wnt5b + MO4-tp53 control Fig. 2 with image from Gutzman et al., 2018
midbrain hindbrain boundary constriction basal region structure, abnormal AB + MO2-wnt5b + MO4-tp53 control Fig. 2 with image from Gutzman et al., 2018
midbrain hindbrain boundary constriction basal region increased width, abnormal AB + MO2-wnt5b + MO4-tp53 control Fig. 2 with image from Gutzman et al., 2018
midbrain hindbrain boundary constriction epithelial cell morphogenesis process quality, abnormal AB + MO2-wnt5b + MO4-tp53 control Fig. 2 with image from Gutzman et al., 2018
brain apoptotic process increased occurrence, abnormal AB + MO3-brd2a + MO4-tp53 standard conditions Fig. 12 with image from Murphy et al., 2017
brain cell death increased occurrence, abnormal AB + MO3-brd2a + MO4-tp53 standard conditions Fig. 6 with image from Murphy et al., 2017
brain structure, abnormal AB + MO3-brd2a + MO4-tp53 standard conditions Fig. 6 with image from Murphy et al., 2017
midbrain hindbrain boundary posterior region en2a expression decreased distribution, abnormal AB + MO3-brd2a + MO4-tp53 standard conditions Fig. 12 with image from Murphy et al., 2017
central nervous system cell death increased occurrence, abnormal AB + MO3-brd2a + MO4-tp53 standard conditions Fig. 6 with image from Murphy et al., 2017
whole organism decreased mobility, abnormal AB + MO3-ca8 + MO4-tp53 standard conditions Fig. 9 from Huang et al., 2014
thigmotaxis disrupted, abnormal AB + MO3-ca8 + MO4-tp53 standard conditions Fig. 9 from Huang et al., 2014
whole organism edematous, abnormal AB + MO3-coq8b + MO4-tp53 standard conditions Fig. 2 from Ashraf et al., 2013
orbit edematous, abnormal AB + MO3-coq8b + MO4-tp53 standard conditions Fig. 2 from Ashraf et al., 2013
heart tube extracellular matrix symmetrical, abnormal AB + MO3-hapln1a + MO4-tp53 standard conditions Figure 4 with image from Derrick et al., 2021
eye edematous, abnormal AB + MO3-lrrk2 + MO4-tp53 standard conditions Fig. 3 with image from Prabhudesai et al., 2016
post-vent region bent, abnormal AB + MO3-lrrk2 + MO4-tp53 standard conditions Fig. 3 with image from Prabhudesai et al., 2016
presumptive cephalic mesoderm gene expression disrupted, abnormal AB + MO3-myf5 + MO4-tp53 standard conditions Fig. 4 from Lin et al., 2013
pharyngeal arch 3-7 skeleton absent, abnormal AB + MO3-myf5 + MO4-tp53 standard conditions Fig. 5 from Lin et al., 2013
pharyngeal arch 5 has fewer parts of type chondroblast, abnormal AB + MO3-myf5 + MO4-tp53 standard conditions Fig. 5 from Lin et al., 2013
Meckel's cartilage malformed, abnormal AB + MO3-myf5 + MO4-tp53 standard conditions Fig. 5 from Lin et al., 2013
pharyngeal arch 6 absent, abnormal AB + MO3-myf5 + MO4-tp53 standard conditions Fig. 2 from Lin et al., 2013
pharyngeal arch 6 has fewer parts of type chondroblast, abnormal AB + MO3-myf5 + MO4-tp53 standard conditions Fig. 5 from Lin et al., 2013
palatoquadrate cartilage malformed, abnormal AB + MO3-myf5 + MO4-tp53 standard conditions Fig. 5 from Lin et al., 2013
ceratobranchial cartilage absent, abnormal AB + MO3-myf5 + MO4-tp53 standard conditions Fig. 5 from Lin et al., 2013
neuroectoderm neural crest cell decreased amount, abnormal AB + MO3-myf5 + MO4-tp53 standard conditions Fig. 4 from Lin et al., 2013
pharyngeal arch 6 has fewer parts of type cranial neural crest, abnormal AB + MO3-myf5 + MO4-tp53 standard conditions Fig. 5 from Lin et al., 2013
pharyngeal arch 3 has fewer parts of type chondroblast, abnormal AB + MO3-myf5 + MO4-tp53 standard conditions Fig. 2 from Lin et al., 2013
pharyngeal arch 5 has fewer parts of type cranial neural crest, abnormal AB + MO3-myf5 + MO4-tp53 standard conditions Fig. 5 from Lin et al., 2013
ceratohyal cartilage malformed, abnormal AB + MO3-myf5 + MO4-tp53 standard conditions Fig. 5 from Lin et al., 2013
pharyngeal arch 5 absent, abnormal AB + MO3-myf5 + MO4-tp53 standard conditions Fig. 2 from Lin et al., 2013
blood vessel endothelial cell adherens junction immature, abnormal AB + MO3-ptprb + MO4-tp53 standard conditions Fig. S5 with image from Carra et al., 2012
blood vessel endothelial cell has fewer parts of type blood vessel endothelial cell cell-cell junction, abnormal AB + MO3-ptprb + MO4-tp53 standard conditions Fig. S5 with image from Carra et al., 2012
adherens junction assembly disrupted, abnormal AB + MO3-ptprb + MO4-tp53 standard conditions Fig. S5 with image from Carra et al., 2012
eye decreased size, abnormal AB + MO3-rel + MO4-tp53 standard conditions Fig. 7 from Bagheri et al., 2016
trunk morphology, abnormal AB + MO3-rel + MO4-tp53 standard conditions Fig. 6,  Fig. 7 from Bagheri et al., 2016
fin decreased size, abnormal AB + MO3-rel + MO4-tp53 standard conditions Fig. 7 from Bagheri et al., 2016
trunk curved, abnormal AB + MO3-rel + MO4-tp53 standard conditions Fig. 7 from Bagheri et al., 2016
head decreased size, abnormal AB + MO3-rel + MO4-tp53 standard conditions Fig. 7 from Bagheri et al., 2016
head morphology, abnormal AB + MO3-rel + MO4-tp53 standard conditions Fig. 6 from Bagheri et al., 2016
otic placode pax2a expression decreased amount, abnormal AB + MO3-sox3 + MO4-tp53 standard conditions Fig. 7 with image from Gou et al., 2018
otic placode pax2a expression decreased distribution, abnormal AB + MO3-sox3 + MO4-tp53 standard conditions Fig. 7 with image from Gou et al., 2018
hatching process quality, abnormal AB + MO4-masp1 + MO4-tp53 standard conditions Fig. 2 from Mortensen et al., 2017
whole organism increased curvature, abnormal AB + MO4-masp1 + MO4-tp53 standard conditions Fig. 2 from Mortensen et al., 2017
pectoral fin development disrupted, abnormal AB + MO4-masp1 + MO4-tp53 standard conditions Fig. 2 from Mortensen et al., 2017
pigmentation process quality, abnormal AB + MO4-masp1 + MO4-tp53 standard conditions Fig. 2 from Mortensen et al., 2017
pericardium edematous, abnormal AB + MO4-masp1 + MO4-tp53 standard conditions Fig. 2 from Mortensen et al., 2017
brain edematous, abnormal AB + MO4-masp1 + MO4-tp53 standard conditions Fig. 2 from Mortensen et al., 2017
trunk slow muscle cell ab-f59 labeling spatial pattern, abnormal AB + MO4-tp53 standard conditions Fig. 2 from Rice et al., 2022
vertical myoseptum endolysosome irregular spatial pattern, abnormal AB + MO4-tp53 standard conditions Fig. 5 from Rice et al., 2022
smooth muscle cell endolysosome irregular spatial pattern, abnormal AB + MO4-tp53 standard conditions Fig. 5 from Rice et al., 2022
post-vent region decreased length, abnormal AB + MO4-tp53 + MO5-cav1 standard conditions Fig. 2 with image from Mo et al., 2010
notochord deformed, abnormal AB + MO4-tp53 + MO5-cav1 standard conditions Fig. 2 with image from Mo et al., 2010
trunk curved, abnormal AB + MO4-tp53 + MO5-cav1 standard conditions Fig. 2 with image from Mo et al., 2010
somite deformed, abnormal AB + MO4-tp53 + MO5-cav1 standard conditions Fig. 2 with image from Mo et al., 2010
eye decreased diameter, abnormal AB + MO4-tp53 + MO5-cpsf1 standard conditions Figure 5 with image from Ouyang et al., 2019
eye decreased size, abnormal AB + MO4-tp53 + MO5-cpsf1 standard conditions Figure 5 with image from Ouyang et al., 2019
optic fissure closure incomplete, abnormal AB + MO4-tp53 + MO5-gdf6a standard conditions Fig. 3 from Asai-Coakwell et al., 2009
eye decreased size, abnormal AB + MO4-tp53 + MO5-gdf6a standard conditions Fig. 3 from Asai-Coakwell et al., 2009
post-vent region kinked, abnormal AB + MO4-tp53 + MO5-gdf6a standard conditions Fig. 3 from Asai-Coakwell et al., 2009
trigeminal ganglion axon arborization disrupted, abnormal AB + MO4-tp53 + MO5-mecp2 standard conditions Fig. 2 with image from Leong et al., 2015
trigeminal ganglion axon branchiness, abnormal AB + MO4-tp53 + MO5-mecp2 standard conditions Fig. 2 with image from Leong et al., 2015
midbrain hindbrain boundary constriction midbrain-hindbrain boundary morphogenesis process quality, abnormal AB + MO4-tp53 + MO5-ptk2ab control Fig. 3 with image from Gutzman et al., 2018
midbrain hindbrain boundary constriction basal region structure, abnormal AB + MO4-tp53 + MO5-ptk2ab control Fig. 3 with image from Gutzman et al., 2018
midbrain hindbrain boundary constriction basal region increased width, abnormal AB + MO4-tp53 + MO5-ptk2ab control Fig. 3 with image from Gutzman et al., 2018
midbrain hindbrain boundary constriction epithelial cell morphogenesis process quality, abnormal AB + MO4-tp53 + MO5-ptk2ab control Fig. 3 with image from Gutzman et al., 2018
trunk curved lateral, abnormal AB + MO4-tp53 + MO5-slc16a2 standard conditions Fig. 3 from Campinho et al., 2014
brain development disrupted, abnormal AB + MO4-tp53 + MO5-slc16a2 standard conditions Fig. 3 from Campinho et al., 2014
apoptotic process increased occurrence, abnormal AB + MO4-tp53 + MO5-slc16a2 standard conditions Fig. 3 from Campinho et al., 2014
notochord deformed, abnormal AB + MO4-tp53 + MO6-cav1 standard conditions Fig. 2 with image from Mo et al., 2010
somite deformed, abnormal AB + MO4-tp53 + MO6-cav1 standard conditions Fig. 2 with image from Mo et al., 2010
trunk curved, abnormal AB + MO4-tp53 + MO6-cav1 standard conditions Fig. 2 with image from Mo et al., 2010
post-vent region decreased length, abnormal AB + MO4-tp53 + MO6-cav1 standard conditions Fig. 2 with image from Mo et al., 2010
eye edematous, abnormal AB + MO4-tp53 + MO7-lrrk2 standard conditions Fig. 3 with image from Prabhudesai et al., 2016
post-vent region bent, abnormal AB + MO4-tp53 + MO7-lrrk2 standard conditions Fig. 3 with image from Prabhudesai et al., 2016
cranial cartilage decreased size, abnormal AB/TL + MO1-fto + MO4-tp53 standard conditions Fig. 1 with image from Osborn et al., 2014
pronephric glomerulus podocyte differentiation decreased process quality, abnormal AB/TL + MO1-kif21a + MO4-tp53 standard conditions Figure 3 with image from Riedmann et al., 2023
heart edematous, abnormal AB/TL + MO1-kif21a + MO4-tp53 standard conditions Figure 2 with image from Riedmann et al., 2023
whole organism kif21a expression decreased amount, abnormal AB/TL + MO1-kif21a + MO4-tp53 standard conditions Figure 2 with image from Riedmann et al., 2023
pronephric podocyte podocyte foot mislocalised, abnormal AB/TL + MO1-kif21a + MO4-tp53 standard conditions Figure 3 with image from Riedmann et al., 2023
pronephros glomerular filtration decreased process quality, abnormal AB/TL + MO1-kif21a + MO4-tp53 standard conditions Figure 3 with image from Riedmann et al., 2023
whole organism curved ventral, abnormal AB/TL + MO1-srrm4 + MO4-tp53 standard conditions Fig. 6 with image from Calarco et al., 2009
ventricular system increased volume, abnormal AB/TL + MO1-srrm4 + MO4-tp53 standard conditions Fig. 6 with image from Calarco et al., 2009
head decreased width, abnormal AB/TL + MO1-tubgcp2 + MO4-tp53 control Fig. 1 with image,  Fig. 2 with image from Bartoszewski et al., 2022
head decreased size, abnormal AB/TL + MO1-tubgcp2 + MO4-tp53 control Fig. 1 with image,  Fig. 2 with image from Bartoszewski et al., 2022
whole organism decreased length, abnormal AB/TL + MO1-tubgcp2 + MO4-tp53 control Fig. 2 with image from Bartoszewski et al., 2022
pronephric glomerulus podocyte differentiation decreased process quality, abnormal AB/TL + MO2-kif21a + MO4-tp53 standard conditions Figure 3 with image from Riedmann et al., 2023
heart edematous, abnormal AB/TL + MO2-kif21a + MO4-tp53 standard conditions Figure 2 with image from Riedmann et al., 2023
whole organism kif21a expression decreased amount, abnormal AB/TL + MO2-kif21a + MO4-tp53 standard conditions Figure 2 with image from Riedmann et al., 2023
pronephric podocyte podocyte foot mislocalised, abnormal AB/TL + MO2-kif21a + MO4-tp53 standard conditions Figure 3 with image from Riedmann et al., 2023
pronephros glomerular filtration decreased process quality, abnormal AB/TL + MO2-kif21a + MO4-tp53 standard conditions Figure 3 with image from Riedmann et al., 2023
head decreased width, abnormal AB/TL + MO2-tubgcp2 + MO4-tp53 control Fig. 1 with image,  Fig. 2 with image from Bartoszewski et al., 2022
head decreased size, abnormal AB/TL + MO2-tubgcp2 + MO4-tp53 control Fig. 1 with image,  Fig. 2 with image from Bartoszewski et al., 2022
whole organism decreased length, abnormal AB/TL + MO2-tubgcp2 + MO4-tp53 control Fig. 2 with image from Bartoszewski et al., 2022
brain apoptotic, abnormal AB/TU + MO1-cables1 + MO4-tp53 standard conditions Fig. 3 from Groeneweg et al., 2011
locomotory behavior process quality, abnormal AB/TU + MO1-cables1 + MO4-tp53 standard conditions Fig. 4 from Groeneweg et al., 2011
skeletal muscle cell sparse, abnormal AB/TU + MO1-gmppb + MO4-tp53 standard conditions Fig. 7 from Zheng et al., 2021
whole organism sox2 expression decreased amount, abnormal AB/TU + MO1-gmppb + MO4-tp53 standard conditions Fig. Extended Data Fig. 9 from Zheng et al., 2021
skeletal muscle cell disorganized, abnormal AB/TU + MO1-gmppb + MO4-tp53 standard conditions Fig. 7 from Zheng et al., 2021
whole organism sox2 expression amount, ameliorated AB/TU + MO1-gmppb + MO4-tp53 chemical treatment by injection: GDP-mannose Fig. Extended Data Fig. 9 from Zheng et al., 2021
whole organism Ab1-gmppb labeling decreased amount, abnormal AB/TU + MO1-gmppb + MO4-tp53 standard conditions Fig. Extended Data Fig. 9 from Zheng et al., 2021
protein glycosylation decreased occurrence, abnormal AB/TU + MO1-gmppb + MO4-tp53 standard conditions Fig. Extended Data Fig. 9 from Zheng et al., 2021
whole organism GDP-mannose decreased amount, abnormal AB/TU + MO1-gmppb + MO4-tp53 standard conditions Fig. Extended Data Fig. 9 from Zheng et al., 2021
skeletal muscle cell morphology, ameliorated AB/TU + MO1-gmppb + MO4-tp53 chemical treatment by injection: GDP-mannose Fig. 7 from Zheng et al., 2021
notochord development delayed, abnormal AB/TU + MO1-igf2a + MO2-igf2a + MO4-tp53 standard conditions Fig. 4 from White et al., 2009
somite specification disrupted, abnormal AB/TU + MO1-igf2a + MO2-igf2a + MO4-tp53 standard conditions Fig. 4 from White et al., 2009
notochord undulate, abnormal AB/TU + MO1-igf2a + MO2-igf2a + MO4-tp53 standard conditions Fig. 4 from White et al., 2009
trunk has fewer parts of type somite, abnormal AB/TU + MO1-igf2a + MO2-igf2a + MO4-tp53 standard conditions Fig. 4 from White et al., 2009
post-vent region kinked, abnormal AB/TU + MO1-inpp5e + MO4-tp53 standard conditions Fig. 2 with image from Luo et al., 2012
whole organism anatomical axis asymmetrical, abnormal AB/TU + MO1-inpp5e + MO4-tp53 standard conditions Fig. 2 with image from Luo et al., 2012
pronephros cystic, abnormal AB/TU + MO1-inpp5e + MO4-tp53 standard conditions Fig. 2 with image from Luo et al., 2012
whole organism decreased pigmentation, abnormal AB/TU + MO1-inpp5e + MO4-tp53 standard conditions Fig. 2 with image from Luo et al., 2012
retina development in camera-type eye disrupted, abnormal AB/TU + MO1-inpp5e + MO4-tp53 standard conditions Fig. 2 with image from Luo et al., 2012
pericardium edematous, abnormal AB/TU + MO1-inpp5e + MO4-tp53 standard conditions Fig. 2 with image from Luo et al., 2012
retina disorganized, abnormal AB/TU + MO1-inpp5e + MO4-tp53 standard conditions Fig. 2 with image from Luo et al., 2012
eye decreased size, abnormal AB/TU + MO1-inpp5e + MO4-tp53 standard conditions Fig. 2 with image from Luo et al., 2012
atrium cardiac conduction decreased velocity, abnormal AB/TU + MO1-rnf207b + MO4-tp53 standard conditions Fig. 3 from Roder et al., 2014
cardiac ventricle cardiac conduction decreased velocity, abnormal AB/TU + MO1-rnf207b + MO4-tp53 standard conditions Fig. 3 from Roder et al., 2014
heart contraction process quality, abnormal AB/TU + MO1-rnf207b + MO4-tp53 standard conditions text only from Roder et al., 2014
atrial myocardium action potential increased duration, abnormal AB/TU + MO1-rnf207b + MO4-tp53 standard conditions Fig. 2 from Roder et al., 2014
heart looping disrupted, abnormal AB/TU + MO1-rnf207b + MO4-tp53 standard conditions text only from Roder et al., 2014
ventricular myocardium action potential increased duration, abnormal AB/TU + MO1-rnf207b + MO4-tp53 standard conditions Fig. 2 from Roder et al., 2014
fourth ventricle increased size, abnormal AB/TU + MO1-tcf4 + MO2-tcf4 + MO4-tp53 standard conditions Fig. 4 from Brockschmidt et al., 2011
post-vent region curved, abnormal AB/TU + MO1-tcf4 + MO2-tcf4 + MO4-tp53 standard conditions Fig. 4,  Fig. 5 from Brockschmidt et al., 2011
embryo development delayed, abnormal AB/TU + MO1-tcf4 + MO2-tcf4 + MO4-tp53 standard conditions Fig. 4 from Brockschmidt et al., 2011
lens morphogenesis in camera-type eye delayed, abnormal AB/TU + MO1-tcf4 + MO2-tcf4 + MO4-tp53 standard conditions Fig. 5 from Brockschmidt et al., 2011
somite shape, abnormal AB/TU + MO2-igf2a + MO4-tp53 standard conditions text only from White et al., 2009
notochord undulate, abnormal AB/TU + MO2-igf2a + MO4-tp53 standard conditions text only from White et al., 2009
convergent extension involved in axis elongation delayed, abnormal AB/TU + MO2-igf2a + MO4-tp53 standard conditions text only from White et al., 2009
atrium cardiac conduction decreased velocity, abnormal AB/TU + MO2-rnf207b + MO4-tp53 standard conditions Fig. 3 from Roder et al., 2014
cardiac ventricle cardiac conduction decreased velocity, abnormal AB/TU + MO2-rnf207b + MO4-tp53 standard conditions Fig. 3 from Roder et al., 2014
heart contraction process quality, abnormal AB/TU + MO2-rnf207b + MO4-tp53 standard conditions text only from Roder et al., 2014
atrial myocardium action potential increased duration, abnormal AB/TU + MO2-rnf207b + MO4-tp53 standard conditions Fig. 2 from Roder et al., 2014
heart looping disrupted, abnormal AB/TU + MO2-rnf207b + MO4-tp53 standard conditions text only from Roder et al., 2014
ventricular myocardium action potential increased duration, abnormal AB/TU + MO2-rnf207b + MO4-tp53 standard conditions Fig. 2 from Roder et al., 2014
canonical Wnt signaling pathway decreased occurrence, abnormal AB/TU + MO4-tp53 + MO5-lbx2 + MO8-lbx2 control Fig. 2 from Lu et al., 2014
ventral mesoderm chrd expression mislocalised, abnormal AB/TU + MO4-tp53 + MO5-lbx2 + MO8-lbx2 standard conditions Fig. 1,  Fig. 5 from Lu et al., 2014
margin ventral region eve1 expression decreased amount, abnormal AB/TU + MO4-tp53 + MO5-lbx2 + MO8-lbx2 standard conditions Fig. 1 from Lu et al., 2014
caudal fin ventral region absent, abnormal AB/TU + MO4-tp53 + MO5-lbx2 + MO8-lbx2 standard conditions Fig. 1 from Lu et al., 2014
trunk posterior region absent, abnormal AB/TU + MO4-tp53 + MO5-lbx2 + MO8-lbx2 standard conditions Fig. 1 from Lu et al., 2014
axial mesoderm chrd expression increased amount, abnormal AB/TU + MO4-tp53 + MO5-lbx2 + MO8-lbx2 standard conditions Fig. 1 from Lu et al., 2014
whole organism wholly dorsalized, abnormal AB/TU + MO4-tp53 + MO5-lbx2 + MO8-lbx2 standard conditions Fig. 1 from Lu et al., 2014
whole organism elongated, abnormal AB/TU + MO4-tp53 + MO5-lbx2 + MO8-lbx2 standard conditions Fig. 1 from Lu et al., 2014
trunk ventral region absent, abnormal AB/TU + MO4-tp53 + MO5-lbx2 + MO8-lbx2 standard conditions Fig. 1 from Lu et al., 2014
margin ventral region eve1 expression decreased distribution, abnormal AB/TU + MO4-tp53 + MO5-lbx2 + MO8-lbx2 standard conditions Fig. 1 from Lu et al., 2014
presumptive ectoderm foxi1 expression decreased amount, abnormal AB/TU + MO4-tp53 + MO5-lbx2 + MO8-lbx2 standard conditions Fig. 1 from Lu et al., 2014
caudal fin posterior region absent, abnormal AB/TU + MO4-tp53 + MO5-lbx2 + MO8-lbx2 standard conditions Fig. 1 from Lu et al., 2014
presumptive ectoderm foxi1 expression decreased distribution, abnormal AB/TU + MO4-tp53 + MO5-lbx2 + MO8-lbx2 standard conditions Fig. 1 from Lu et al., 2014
axial mesoderm chrd expression increased distribution, abnormal AB/TU + MO4-tp53 + MO5-lbx2 + MO8-lbx2 standard conditions Fig. 1,  Fig. 5 from Lu et al., 2014
canonical Wnt signaling pathway decreased occurrence, abnormal AB/TU + MO4-tp53 + MO6-lbx2 + MO7-lbx2 control Fig. 2 from Lu et al., 2014
ventral mesoderm chrd expression mislocalised, abnormal AB/TU + MO4-tp53 + MO6-lbx2 + MO7-lbx2 standard conditions Fig. 1,  Fig. 5 from Lu et al., 2014
margin ventral region eve1 expression decreased amount, abnormal AB/TU + MO4-tp53 + MO6-lbx2 + MO7-lbx2 standard conditions Fig. 1 from Lu et al., 2014
caudal fin ventral region absent, abnormal AB/TU + MO4-tp53 + MO6-lbx2 + MO7-lbx2 standard conditions Fig. 1 from Lu et al., 2014
trunk posterior region absent, abnormal AB/TU + MO4-tp53 + MO6-lbx2 + MO7-lbx2 standard conditions Fig. 1 from Lu et al., 2014
axial mesoderm chrd expression increased amount, abnormal AB/TU + MO4-tp53 + MO6-lbx2 + MO7-lbx2 standard conditions Fig. 1 from Lu et al., 2014
whole organism wholly dorsalized, abnormal AB/TU + MO4-tp53 + MO6-lbx2 + MO7-lbx2 standard conditions Fig. 1 from Lu et al., 2014
whole organism elongated, abnormal AB/TU + MO4-tp53 + MO6-lbx2 + MO7-lbx2 standard conditions Fig. 1 from Lu et al., 2014
trunk ventral region absent, abnormal AB/TU + MO4-tp53 + MO6-lbx2 + MO7-lbx2 standard conditions Fig. 1 from Lu et al., 2014
margin ventral region eve1 expression decreased distribution, abnormal AB/TU + MO4-tp53 + MO6-lbx2 + MO7-lbx2 standard conditions Fig. 1 from Lu et al., 2014
presumptive ectoderm foxi1 expression decreased amount, abnormal AB/TU + MO4-tp53 + MO6-lbx2 + MO7-lbx2 standard conditions Fig. 1 from Lu et al., 2014
caudal fin posterior region absent, abnormal AB/TU + MO4-tp53 + MO6-lbx2 + MO7-lbx2 standard conditions Fig. 1 from Lu et al., 2014
presumptive ectoderm foxi1 expression decreased distribution, abnormal AB/TU + MO4-tp53 + MO6-lbx2 + MO7-lbx2 standard conditions Fig. 1 from Lu et al., 2014
axial mesoderm chrd expression increased distribution, abnormal AB/TU + MO4-tp53 + MO6-lbx2 + MO7-lbx2 standard conditions Fig. 1,  Fig. 5 from Lu et al., 2014
forebrain neuronal stem cell mislocalised, abnormal NHGRI-1 + MO1-snf8 + MO4-tp53 control Figure 6 with image from Brugger et al., 2024
optic chiasm morphology, abnormal NHGRI-1 + MO1-snf8 + MO4-tp53 control Figure 6 with image,  Figure 7 with image from Brugger et al., 2024
brain decreased size, abnormal NHGRI-1 + MO1-snf8 + MO4-tp53 control Figure 6 with image from Brugger et al., 2024
eye decreased size, abnormal NHGRI-1 + MO1-snf8 + MO4-tp53 control Fig. S18,  Figure 6 with image from Brugger et al., 2024
cranial nerve II morphology, abnormal NHGRI-1 + MO1-snf8 + MO4-tp53 control Figure 6 with image,  Figure 7 with image from Brugger et al., 2024
head decreased size, abnormal NHGRI-1 + MO1-snf8 + MO4-tp53 control Fig. S18,  Figure 6 with image from Brugger et al., 2024
post-vent region curved, abnormal NHGRI-1 + MO1-snf8 + MO4-tp53 control Fig. S18,  Figure 6 with image from Brugger et al., 2024
integument decreased pigmentation, abnormal NHGRI-1 + MO1-snf8 + MO4-tp53 control Fig. S18,  Figure 6 with image from Brugger et al., 2024
whole organism dead, abnormal TL + MO1-asrgl1 + MO4-tp53 standard conditions Table 4 from Biswas et al., 2016
whole organism decreased length, abnormal TL + MO1-asrgl1 + MO4-tp53 standard conditions Table 4 from Biswas et al., 2016
whole organism decreased life span, abnormal TL + MO1-asrgl1 + MO4-tp53 standard conditions Table 4 from Biswas et al., 2016
whole organism deformed, abnormal TL + MO1-asrgl1 + MO4-tp53 standard conditions Table 4 from Biswas et al., 2016
optic tectum regulation of neuronal action potential disrupted, abnormal TL + MO1-cln3 + MO4-tp53 standard conditions Fig. 4 from Wager et al., 2016
eye decreased diameter, abnormal TL + MO1-hars + MO4-tp53 control FIGURE 2 with image from Waldron et al., 2019
cellular respiration process quality, ameliorated TL + MO1-kcna1a + MO4-tp53 chemical treatment by environment: MC1568 Fig. 7 from Ibhazehiebo et al., 2018
optic tectum transmission of nerve impulse increased occurrence, abnormal TL + MO1-kcna1a + MO4-tp53 constant dark Fig. 6 with image from Ibhazehiebo et al., 2018
cellular respiration process quality, ameliorated TL + MO1-kcna1a + MO4-tp53 constant dark, chemical treatment by environment: valproic acid Fig. 3 from Ibhazehiebo et al., 2018
cellular respiration process quality, ameliorated TL + MO1-kcna1a + MO4-tp53 constant dark, chemical treatment by environment: primidone Fig. 2 from Ibhazehiebo et al., 2018
locomotory behavior increased occurrence, abnormal TL + MO1-kcna1a + MO4-tp53 constant dark Fig. 4 from Ibhazehiebo et al., 2018
cellular respiration process quality, ameliorated TL + MO1-kcna1a + MO4-tp53 constant dark, chemical treatment by environment: rufinamide Fig. 2 from Ibhazehiebo et al., 2018
cellular respiration process quality, ameliorated TL + MO1-kcna1a + MO4-tp53 constant dark, chemical treatment by environment: belinostat Fig. 7 from Ibhazehiebo et al., 2018
optic tectum transmission of nerve impulse occurrence, ameliorated TL + MO1-kcna1a + MO4-tp53 constant dark, chemical treatment by environment: vorinostat Fig. 6 with image from Ibhazehiebo et al., 2018
locomotory behavior increased occurrence, abnormal TL + MO1-kcna1a + MO4-tp53 constant dark, chemical treatment by environment: lamotrigine Fig. 4 from Ibhazehiebo et al., 2018
cellular respiration process quality, ameliorated TL + MO1-kcna1a + MO4-tp53 constant dark, chemical treatment by environment: topiramate Fig. 4 from Ibhazehiebo et al., 2018
locomotory behavior increased occurrence, abnormal TL + MO1-kcna1a + MO4-tp53 constant dark, chemical treatment by environment: levetiracetam Fig. 4 from Ibhazehiebo et al., 2018
oxidative phosphorylation process quality, ameliorated TL + MO1-kcna1a + MO4-tp53 constant dark, chemical treatment by environment: rufinamide Fig. 2 from Ibhazehiebo et al., 2018
cellular respiration process quality, ameliorated TL + MO1-kcna1a + MO4-tp53 constant dark, chemical treatment by environment: levetiracetam Fig. 4 from Ibhazehiebo et al., 2018
oxidative phosphorylation process quality, ameliorated TL + MO1-kcna1a + MO4-tp53 constant dark, chemical treatment by environment: eslicarbazepine acetate Fig. 2 from Ibhazehiebo et al., 2018
locomotory behavior increased occurrence, abnormal TL + MO1-kcna1a + MO4-tp53 constant dark, chemical treatment by environment: oxcarbazepine Fig. 4 from Ibhazehiebo et al., 2018
oxidative phosphorylation increased process quality, abnormal TL + MO1-kcna1a + MO4-tp53 constant dark Fig. 1,  Fig. 2 from Ibhazehiebo et al., 2018
cellular respiration process quality, ameliorated TL + MO1-kcna1a + MO4-tp53 constant dark, chemical treatment by environment: oxcarbazepine Fig. 4 from Ibhazehiebo et al., 2018
cellular respiration increased process quality, abnormal TL + MO1-kcna1a + MO4-tp53 constant dark Fig. 1,  Fig. 2,  Fig. 4 from Ibhazehiebo et al., 2018
locomotory behavior increased occurrence, abnormal TL + MO1-kcna1a + MO4-tp53 constant dark, chemical treatment by environment: topiramate Fig. 4 from Ibhazehiebo et al., 2018
cellular respiration process quality, ameliorated TL + MO1-kcna1a + MO4-tp53 constant dark, chemical treatment by environment: EC 3.5.1.98 (histone deacetylase) inhibitor Fig. 7 from Ibhazehiebo et al., 2018
cellular respiration process quality, ameliorated TL + MO1-kcna1a + MO4-tp53 constant dark, chemical treatment by environment: lamotrigine Fig. 4 from Ibhazehiebo et al., 2018
cellular respiration process quality, ameliorated TL + MO1-kcna1a + MO4-tp53 constant dark, chemical treatment by environment: eslicarbazepine acetate Fig. 2 from Ibhazehiebo et al., 2018
cellular respiration process quality, ameliorated TL + MO1-kcna1a + MO4-tp53 constant dark, chemical treatment by environment: vorinostat Fig. 3,  Fig. 5 from Ibhazehiebo et al., 2018
oxidative phosphorylation process quality, ameliorated TL + MO1-kcna1a + MO4-tp53 constant dark, chemical treatment by environment: primidone Fig. 2 from Ibhazehiebo et al., 2018
whole organism pla2g6 expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 1 from Sánchez et al., 2018
trigeminal ganglion increased length, abnormal TL + MO1-pla2g6 + MO4-tp53 control Fig. 4 from Sánchez et al., 2018
whole organism hsp90aa1.2 expression increased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 7 from Sánchez et al., 2018
whole organism huwe1 expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 7 from Sánchez et al., 2018
post-vent region curled, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 1 from Sánchez et al., 2018
forebrain sncb expression increased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 2 from Sánchez et al., 2018
whole organism npc1 expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 7 from Sánchez et al., 2018
whole organism ccng1 expression increased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 7 from Sánchez et al., 2018
medulla oblongata th expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 2 from Sánchez et al., 2018
trigeminal ganglion increased width, abnormal TL + MO1-pla2g6 + MO4-tp53 control Fig. 4 from Sánchez et al., 2018
pretectum th expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 2 from Sánchez et al., 2018
whole organism sncb expression increased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 2 from Sánchez et al., 2018
whole organism th expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 2 from Sánchez et al., 2018
whole organism mfn2 expression increased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 7 from Sánchez et al., 2018
diencephalon th expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 2 from Sánchez et al., 2018
whole organism th2 expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 2 from Sánchez et al., 2018
midbrain axonal fasciculation decreased occurrence, abnormal TL + MO1-pla2g6 + MO4-tp53 control Fig. 4,  Fig. 5 from Sánchez et al., 2018
whole organism cacna2d4b expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 7 from Sánchez et al., 2018
spinal cord malformed, abnormal TL + MO1-pla2g6 + MO4-tp53 control Fig. 4 from Sánchez et al., 2018
whole organism decreased size, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 1 from Sánchez et al., 2018
forebrain axon defasciculated, abnormal TL + MO1-pla2g6 + MO4-tp53 control Fig. 4,  Fig. 5 from Sánchez et al., 2018
brain malformed, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 1 from Sánchez et al., 2018
whole organism slc2a1a expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 7 from Sánchez et al., 2018
whole organism uchl1 expression increased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 7 from Sánchez et al., 2018
whole organism grin1b expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 7 from Sánchez et al., 2018
habenula sncb expression increased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 2 from Sánchez et al., 2018
whole organism xpr1a expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 7 from Sánchez et al., 2018
locus coeruleus th expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 2 from Sánchez et al., 2018
whole organism agrn expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 7 from Sánchez et al., 2018
endohypothalamic tract th expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 2 from Sánchez et al., 2018
whole organism mfn2 expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 7 from Sánchez et al., 2018
diencephalon has fewer parts of type dopaminergic neuron, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 2 from Sánchez et al., 2018
peripheral nervous system has fewer parts of type peripheral neuron, abnormal TL + MO1-pla2g6 + MO4-tp53 control Fig. 4 from Sánchez et al., 2018
midbrain axon defasciculated, abnormal TL + MO1-pla2g6 + MO4-tp53 control Fig. 4,  Fig. 5 from Sánchez et al., 2018
whole organism casp8 expression increased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 7 from Sánchez et al., 2018
whole organism hsp70l expression increased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 7 from Sánchez et al., 2018
hindbrain sncb expression increased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 2 from Sánchez et al., 2018
midbrain has fewer parts of type dopaminergic neuron, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 2 from Sánchez et al., 2018
whole organism kif5c expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 7 from Sánchez et al., 2018
hypothalamus posterior region th expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 2 from Sánchez et al., 2018
trigeminal ganglion decondensed, abnormal TL + MO1-pla2g6 + MO4-tp53 control Fig. 4 from Sánchez et al., 2018
telencephalon has fewer parts of type dopaminergic neuron, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 2 from Sánchez et al., 2018
trigeminal ganglion disorganized, abnormal TL + MO1-pla2g6 + MO4-tp53 control Fig. 5 from Sánchez et al., 2018
whole organism hspb1 expression increased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 7 from Sánchez et al., 2018
statoacoustic (VIII) ganglion sncb expression increased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 2 from Sánchez et al., 2018
brain pla2g6 expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 1 from Sánchez et al., 2018
forebrain axonal fasciculation decreased occurrence, abnormal TL + MO1-pla2g6 + MO4-tp53 control Fig. 4,  Fig. 5 from Sánchez et al., 2018
whole organism slc6a3 expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 2 from Sánchez et al., 2018
posterior lateral line ganglion sncb expression increased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 2 from Sánchez et al., 2018
whole organism lmna expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 7 from Sánchez et al., 2018
whole organism sptbn2 expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 7 from Sánchez et al., 2018
midbrain sncb expression increased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 2 from Sánchez et al., 2018
whole organism unc13a expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 7 from Sánchez et al., 2018
olfactory bulb th expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 2 from Sánchez et al., 2018
hindbrain has fewer parts of type dopaminergic neuron, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 2 from Sánchez et al., 2018
whole organism adar expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 7 from Sánchez et al., 2018
whole organism atp1a3a expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 7 from Sánchez et al., 2018
whole organism dead, abnormal TL + MO2-asrgl1 + MO4-tp53 standard conditions Table 4 from Biswas et al., 2016
whole organism decreased length, abnormal TL + MO2-asrgl1 + MO4-tp53 standard conditions Table 4 from Biswas et al., 2016
whole organism decreased life span, abnormal TL + MO2-asrgl1 + MO4-tp53 standard conditions Table 4 from Biswas et al., 2016
whole organism deformed, abnormal TL + MO2-asrgl1 + MO4-tp53 standard conditions Table 4 from Biswas et al., 2016
pectoral fin decreased size, abnormal TL + MO3-fgf16 + MO4-tp53 standard conditions text only from Laurell et al., 2014
pericardium edematous, abnormal TL + MO3-fgf16 + MO4-tp53 standard conditions text only from Laurell et al., 2014
pectoral fin development disrupted, abnormal TL + MO3-fgf16 + MO4-tp53 standard conditions text only from Laurell et al., 2014
whole organism morphology, abnormal TL + MO3-fgf16 + MO4-tp53 standard conditions text only from Laurell et al., 2014
pectoral fin decreased size, abnormal TL + MO4-fgf16 + MO4-tp53 standard conditions text only from Laurell et al., 2014
whole organism morphology, abnormal TL + MO4-fgf16 + MO4-tp53 standard conditions text only from Laurell et al., 2014
pectoral fin development disrupted, abnormal TL + MO4-fgf16 + MO4-tp53 standard conditions text only from Laurell et al., 2014
pericardium edematous, abnormal TL + MO4-fgf16 + MO4-tp53 standard conditions text only from Laurell et al., 2014
post-vent region curved dorsal, abnormal TU + MO1-atp1a2a + MO4-tp53 standard conditions Fig. 2 with image from Doganli et al., 2012
pericardium edematous, abnormal TU + MO1-atp1a2a + MO4-tp53 standard conditions Fig. 2 with image from Doganli et al., 2012
somite morphology, abnormal TU + MO1-atp1a2a + MO4-tp53 standard conditions Fig. 2 with image from Doganli et al., 2012
ventricular system dilated, abnormal TU + MO1-atp1a3a + MO4-tp53 standard conditions Fig. 2 from Doganli et al., 2013
cell division disrupted, abnormal TU + MO1-dync1li1 + MO4-tp53 standard conditions Fig. 6 with image from Mahale et al., 2016
blastodisc furrowed, abnormal TU + MO1-dync1li1 + MO4-tp53 standard conditions Fig. 6 with image from Mahale et al., 2016
hatching decreased process quality, abnormal TU + MO1-dync1li1 + MO4-tp53 standard conditions Fig. 6 with image from Mahale et al., 2016
mitotic cell cycle disrupted, abnormal TU + MO1-dync1li1 + MO4-tp53 standard conditions Fig. 6 with image from Mahale et al., 2016
cell division disrupted, abnormal TU + MO1-dync1li2 + MO4-tp53 standard conditions Fig. 6 with image from Mahale et al., 2016
blastodisc furrowed, abnormal TU + MO1-dync1li2 + MO4-tp53 standard conditions Fig. 6 with image from Mahale et al., 2016
hatching decreased process quality, abnormal TU + MO1-dync1li2 + MO4-tp53 standard conditions Fig. 6 with image from Mahale et al., 2016
mitotic cell cycle disrupted, abnormal TU + MO1-dync1li2 + MO4-tp53 standard conditions Fig. 6 with image from Mahale et al., 2016
post-vent region curved, abnormal TU + MO1-slc8a4a + MO4-tp53 standard conditions Fig. 2 with image from Doganli et al., 2012
pericardium edematous, abnormal TU + MO1-slc8a4a + MO4-tp53 standard conditions Fig. 2 with image from Doganli et al., 2012
heart contraction decreased rate, abnormal TU + MO1-slc8a4a + MO4-tp53 standard conditions Fig. 2 with image from Doganli et al., 2012
trunk decreased length, abnormal TU + MO1-stk36 + MO4-tp53 standard conditions Fig. 7 with image from Xia et al., 2010
whole organism wholly dorsalized, abnormal TU + MO1-stk36 + MO4-tp53 standard conditions Fig. 7 with image from Xia et al., 2010
eye development process quality, abnormal TU + MO1-upf1 + MO4-tp53 standard conditions Fig. S3 from Wittkopp et al., 2009
somitogenesis process quality, abnormal TU + MO1-upf1 + MO4-tp53 standard conditions Fig. S3 from Wittkopp et al., 2009
extension disorganized, abnormal TU + MO1-upf1 + MO4-tp53 standard conditions Fig. S3 from Wittkopp et al., 2009
central nervous system necrotic, abnormal TU + MO1-upf1 + MO4-tp53 standard conditions Fig. S3 from Wittkopp et al., 2009
whole organism posterior region ab1-casp3 labeling decreased amount, abnormal TU + MO1-wnt8a + MO2-wnt8a + MO4-tp53 standard conditions Fig. 4 with image from Naylor et al., 2017
apoptotic process decreased occurrence, abnormal TU + MO1-wnt8a + MO2-wnt8a + MO4-tp53 standard conditions Fig. 4 with image from Naylor et al., 2017
pronephric tubule slc12a3 expression decreased amount, abnormal TU + MO1-wnt8a + MO2-wnt8a + MO4-tp53 standard conditions Fig. 4 with image from Naylor et al., 2017
ventricular system dilated, abnormal TU + MO2-atp1a3a + MO4-tp53 standard conditions Fig. 2 from Doganli et al., 2013
ventricular system dilated, abnormal TU + MO2-atp1a3b + MO4-tp53 standard conditions Fig. 3 from Doganli et al., 2013
neural crest dlx2a expression decreased amount, abnormal TU + MO2-bmp5 + MO4-tp53 standard conditions Fig. 2 from Shih et al., 2017
neural crest cell population proliferation decreased occurrence, abnormal TU + MO2-bmp5 + MO4-tp53 standard conditions Fig. 2 from Shih et al., 2017
whole organism dlx2a expression decreased amount, abnormal TU + MO2-bmp5 + MO4-tp53 standard conditions Fig. 2 from Shih et al., 2017
whole organism sox10 expression decreased amount, abnormal TU + MO2-bmp5 + MO4-tp53 standard conditions Fig. 2 from Shih et al., 2017
neural crest sox10 expression decreased amount, abnormal TU + MO2-bmp5 + MO4-tp53 standard conditions Fig. 2 from Shih et al., 2017
neural crest apoptotic process increased occurrence, abnormal TU + MO2-bmp5 + MO4-tp53 standard conditions Fig. 2 from Shih et al., 2017
neural crest cell development decreased occurrence, abnormal TU + MO2-bmp5 + MO4-tp53 standard conditions Fig. 2 from Shih et al., 2017
post-vent region curved ventral, abnormal TU + MO3-adrb1 + MO4-tp53 standard conditions Fig. 1 from Wang et al., 2020
cerebrospinal fluid contacting neuron urp1 expression decreased distribution, abnormal TU + MO3-adrb1 + MO4-tp53 standard conditions Fig. S5 from Wang et al., 2020
trunk curved ventral, abnormal TU + MO3-adrb1 + MO4-tp53 standard conditions Fig. 1 from Wang et al., 2020
post-vent region curved ventral, abnormal TU + MO3-adrb2b + MO4-tp53 control Fig. 1 from Wang et al., 2020
trunk curved dorsal, abnormal TU + MO3-adrb2b + MO4-tp53 chemical treatment by environment: forskolin Fig. 1 from Wang et al., 2020
cerebrospinal fluid contacting neuron urp1 expression decreased distribution, abnormal TU + MO3-adrb2b + MO4-tp53 standard conditions Fig. S5 from Wang et al., 2020
trunk curved ventral, abnormal TU + MO3-adrb2b + MO4-tp53 standard conditions