Morpholino

MO4-tp53

ID
ZDB-MRPHLNO-070126-7
Name
MO4-tp53
Previous Names
  • MO2-tp53
  • p53MO (1)
  • p53-MO ATG (1)
Target
Sequence
5' - GCGCCATTGCTTTGCAAGAATTG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-tp53
No data available
Phenotype
Phenotype resulting from MO4-tp53
Phenotype Fish Figures
apoptotic process decreased occurrence, abnormal TU + MO4-tp53 Fig. 4 with image from Naylor et al., 2017
Fig. S3 with image from Chakraborty et al., 2009
Fig. S4 from Zeng et al., 2007
CaP motoneuron release of sequestered calcium ion into cytosol occurrence, abnormal nksaigff213aGt; zf415Tg + MO4-tp53 Fig. 5 with image from Kelu et al., 2018
double-strand break repair via homologous recombination increased frequency, abnormal WT + MO4-tp53 Fig. 1 from Gong et al., 2015
double-strand break repair via nonhomologous end joining increased frequency, abnormal WT + MO4-tp53 Fig. 1 from Gong et al., 2015
double-strand break repair via single-strand annealing increased frequency, abnormal WT + MO4-tp53 Fig. 1 from Gong et al., 2015
intestine well differentiated, abnormal WT + MO4-tp53 Fig. 8 with image from Mahmoudi et al., 2010
nucleate erythrocyte immature, abnormal WT + MO4-tp53 Fig. 5 with image from Imamura et al., 2008
peripheral nervous system development process quality, abnormal sb2Tg + MO4-tp53 Fig. 4 with image from Boer et al., 2016
smooth muscle cell endolysosome irregular spatial pattern, abnormal AB + MO4-tp53 Fig. 5 from Rice et al., 2022
trunk slow muscle cell ab-f59 labeling spatial pattern, abnormal AB + MO4-tp53 Fig. 2 from Rice et al., 2022
vertical myoseptum endolysosome irregular spatial pattern, abnormal AB + MO4-tp53 Fig. 5 from Rice et al., 2022
whole organism notch1b expression decreased amount, abnormal WT + MO4-tp53 Fig. 4 from Espanola et al., 2020
whole organism gadd45bb expression decreased amount, abnormal WT + MO4-tp53 Fig. 4 from Zhai et al., 2019
whole organism mdm2 expression increased amount, abnormal WT + MO4-tp53 Fig. 4 with image from Pei et al., 2019
whole organism tp53 expression increased amount, abnormal WT + MO4-tp53 Fig. 4 with image from Pei et al., 2019
whole organism cdkn1a expression increased amount, abnormal WT + MO4-tp53 Fig. 4 with image from Pei et al., 2019
whole organism posterior region ab1-casp3 labeling decreased amount, abnormal TU + MO4-tp53 Fig. 4 with image from Naylor et al., 2017
Phenotype of all Fish created by or utilizing MO4-tp53
Phenotype Fish Conditions Figures
rhombomere 4 Citrine expression increased distribution, abnormal fci3Tg/fci3Tg + MO1-epha4a + MO4-tp53 standard conditions Fig. 2 with imageFig. 6 with image from Addison et al., 2018
rhombomere 6 Citrine expression increased distribution, abnormal fci3Tg/fci3Tg + MO1-epha4a + MO4-tp53 standard conditions Fig. 2 with image from Addison et al., 2018
rhombomere 2 Citrine expression increased distribution, abnormal fci3Tg/fci3Tg + MO1-epha4a + MO4-tp53 standard conditions Fig. 2 with image from Addison et al., 2018
trunk musculature calcium-mediated signaling decreased process quality, abnormal hkz100Tg/hkz100Tg + MO1-tpcn1 + MO4-tp53 standard conditions Fig. 7 from Rice et al., 2022
trunk musculature calcium-mediated signaling decreased process quality, abnormal hkz100Tg/hkz100Tg + MO2-tpcn1 + MO4-tp53 standard conditions Fig. 7 from Rice et al., 2022
retinal inner plexiform layer decreased thickness, abnormal ptf1asa126/sa126 + MO1-ptf1a + MO4-ptf1a + MO4-tp53 standard conditions Fig. 2 with image from Randlett et al., 2013
amacrine cell absent, abnormal ptf1asa126/sa126 + MO1-ptf1a + MO4-ptf1a + MO4-tp53 standard conditions Fig. 2 with image from Randlett et al., 2013
mid cerebral vein branching involved in blood vessel morphogenesis decreased process quality, abnormal s843Tg/s843Tg + MO4-tp53 chemical treatment by environment: N-methyl-N-nitrosourea Fig. 2 with image from Fu et al., 2022
intersegmental vessel branching involved in blood vessel morphogenesis decreased process quality, abnormal s843Tg/s843Tg + MO4-tp53 chemical treatment by environment: N-methyl-N-nitrosourea Fig. 2 with image from Fu et al., 2022
intrinsic apoptotic signaling pathway in response to DNA damage disrupted, abnormal tp53zdf1/zdf1 + MO4-tp53 radiation Fig. 2 with image from Sidi et al., 2008
whole organism decreased sensitivity to irradiation, abnormal tp53zdf1/zdf1 + MO4-tp53 radiation Fig. 2 with image from Sidi et al., 2008
skeletal muscle sarcomere disorganized, abnormal ttn.2sfc11/sfc11 + MO4-tp53 + MO5-ttn.2 (EKW) standard conditions Fig. 3 with image from Zou et al., 2015
otic vesicle neurog1 expression increased amount, abnormal x21Tg/x21Tg + MO1-pax2a + MO4-tp53 (AB) heat shock Fig. 8 with image from Gou et al., 2018
otic vesicle atoh1a expression increased amount, abnormal x21Tg/x21Tg + MO1-pax2a + MO4-tp53 (AB) heat shock Fig. 8 with image from Gou et al., 2018
otic vesicle neurog1 expression increased distribution, abnormal x21Tg/x21Tg + MO1-pax2a + MO4-tp53 (AB) heat shock Fig. 8 with image from Gou et al., 2018
otic vesicle atoh1a expression increased distribution, abnormal x21Tg/x21Tg + MO1-pax2a + MO4-tp53 (AB) heat shock Fig. 8 with image from Gou et al., 2018
whole organism dorsalized, abnormal AB + MO1-adpgk + MO4-tp53 standard conditions Fig. S2 from Imle et al., 2019
whole organism decreased length, abnormal AB + MO1-adpgk + MO4-tp53 standard conditions Fig. S2 from Imle et al., 2019
eye edematous, abnormal AB + MO1-arhgdia + MO4-tp53 standard conditions Fig. 5Fig. S8 from Gee et al., 2013
whole organism edematous, abnormal AB + MO1-arhgdia + MO4-tp53 standard conditions Fig. 5Fig. S8 from Gee et al., 2013
neural crest cell migration involved in autonomic nervous system development disrupted, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 7 with image from Tu et al., 2012
mandibular arch skeleton decreased size, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 1 with image from Tu et al., 2012
enteric neuron decreased amount, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 3 with image from Tu et al., 2012
Kupffer's vesicle cilium decreased amount, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. S6 with image from Tu et al., 2012
apoptotic process decreased occurrence, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 8 with image from Tu et al., 2012
enteric nervous system development disrupted, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 7 with image from Tu et al., 2012
iridophore decreased amount, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 1 with image from Tu et al., 2012
trunk neural crest cell migration delayed, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 6 with image from Tu et al., 2012
epibranchial ganglion neuron decreased amount, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 3 with image from Tu et al., 2012
enteric neuron mislocalised, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 7 with image from Tu et al., 2012
pharyngeal arch cartilage absent, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 2 with image from Tu et al., 2012
melanocyte migration disrupted, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 1 with image from Tu et al., 2012
neurocranial trabecula decreased size, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 2 with image from Tu et al., 2012
cranial neural crest cell mislocalised, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 6 with image from Tu et al., 2012
trunk neural crest cell mislocalised, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 6 with image from Tu et al., 2012
pectoral fin absent, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 2 with image from Tu et al., 2012
vagal neural crest decreased size, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 7 with image from Tu et al., 2012
neural crest cell migration process quality, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 6 with image from Tu et al., 2012
melanocyte decreased amount, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 1 with image from Tu et al., 2012
regulation of smoothened signaling pathway disrupted, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. S5 with image from Tu et al., 2012
cranial neural crest decreased size, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 5 with imageFig. 6 with image from Tu et al., 2012
head decreased size, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 1 with image from Tu et al., 2012
ethmoid cartilage absent, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 2 with image from Tu et al., 2012
dorsal root ganglion neuron decreased amount, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 3 with image from Tu et al., 2012
determination of left/right symmetry disrupted, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. S6 with image from Tu et al., 2012
Kupffer's vesicle cilium decreased length, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. S6 with image from Tu et al., 2012
cilium assembly disrupted, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. S6 with image from Tu et al., 2012
enteric neuron decreased length, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 7 with image from Tu et al., 2012
embryo development disrupted, abnormal AB + MO1-atp13a2 + MO4-tp53 standard conditions text only from Lopes da Fonseca et al., 2013
whole organism increased curvature, abnormal AB + MO1-atp13a2 + MO4-tp53 standard conditions Fig. 5 from Lopes da Fonseca et al., 2013
whole organism dead, abnormal AB + MO1-atp13a2 + MO4-tp53 standard conditions text only from Lopes da Fonseca et al., 2013
trunk morphology, abnormal AB + MO1-bcl11ab + MO4-tp53 standard conditions Fig. 6 from Bagheri et al., 2016
eye decreased size, abnormal AB + MO1-bcl11ab + MO4-tp53 standard conditions Fig. 7 from Bagheri et al., 2016
brain decreased volume, abnormal AB + MO1-bcl11ab + MO4-tp53 standard conditions Fig. 8 from Bagheri et al., 2016
head decreased size, abnormal AB + MO1-bcl11ab + MO4-tp53 standard conditions Fig. 7 from Bagheri et al., 2016
head morphology, abnormal AB + MO1-bcl11ab + MO4-tp53 standard conditions Fig. 6 from Bagheri et al., 2016
brain development disrupted, abnormal AB + MO1-bcl11ab + MO4-tp53 standard conditions Fig. 8 from Bagheri et al., 2016
fin decreased size, abnormal AB + MO1-bcl11ab + MO4-tp53 standard conditions Fig. 7 from Bagheri et al., 2016
otic vesicle decreased size, abnormal AB + MO1-bcl11ab + MO4-tp53 standard conditions Fig. 7 from Bagheri et al., 2016
neuron apoptotic, abnormal AB + MO1-ca8 + MO4-tp53 standard conditions Fig. 6 from Aspatwar et al., 2013
whole organism dead, abnormal AB + MO1-ca8 + MO4-tp53 standard conditions Fig. 5 from Aspatwar et al., 2013
determination of heart left/right asymmetry disrupted, abnormal AB + MO1-ccsapb + MO4-tp53 standard conditions Fig. 6 from Backer et al., 2012
brain development disrupted, abnormal AB + MO1-ccsapb + MO4-tp53 standard conditions Fig. 4 from Backer et al., 2012
ventricular zone cell apoptotic, abnormal AB + MO1-ccsapb + MO4-tp53 standard conditions Fig. 4 from Backer et al., 2012
Mauthner neuron decreased amount, abnormal AB + MO1-ccsapb + MO4-tp53 standard conditions Fig. 5 from Backer et al., 2012
axonal fasciculation disrupted, abnormal AB + MO1-ccsapb + MO4-tp53 standard conditions Fig. 5 from Backer et al., 2012
central nervous system projection neuron axonogenesis disrupted, abnormal AB + MO1-ccsapb + MO4-tp53 standard conditions Fig. 5 from Backer et al., 2012
thigmotaxis disrupted, abnormal AB + MO1-ccsapb + MO4-tp53 standard conditions Fig. 4 from Backer et al., 2012
induction of programmed cell death increased occurrence, abnormal AB + MO1-ccsapb + MO4-tp53 standard conditions Fig. 5 from Backer et al., 2012
heart displaced to whole organism right side, abnormal AB + MO1-ccsapb + MO4-tp53 standard conditions Fig. 6 from Backer et al., 2012
somite border disorganized, abnormal AB + MO1-ccsapb + MO4-tp53 standard conditions Fig. 4 from Backer et al., 2012
heart displaced to whole organism medial side, abnormal AB + MO1-ccsapb + MO4-tp53 standard conditions Fig. 6 from Backer et al., 2012
hindbrain neuroepithelial cell decreased amount, abnormal AB + MO1-ccsapb + MO4-tp53 standard conditions Fig. 5 from Backer et al., 2012
brain decreased object quality, abnormal AB + MO1-ccsapb + MO4-tp53 standard conditions Fig. 4 from Backer et al., 2012
eye decreased size, abnormal AB + MO1-ccsapb + MO4-tp53 standard conditions Fig. 4 from Backer et al., 2012
heart edematous, abnormal AB + MO1-ccsapb + MO4-tp53 standard conditions Fig. 4 from Backer et al., 2012
myotome decreased width, abnormal AB + MO1-cd38 + MO4-tp53 standard conditions Fig. 5 with image from Kelu et al., 2018
muscle cell sarcomere morphology, abnormal AB + MO1-cd38 + MO4-tp53 standard conditions Fig. 5 with image from Kelu et al., 2018
muscle cell decreased width, abnormal AB + MO1-cd38 + MO4-tp53 standard conditions Fig. 5 with image from Kelu et al., 2018
muscle cell morphology, abnormal AB + MO1-cd38 + MO4-tp53 standard conditions Fig. 5 with image from Kelu et al., 2018
whole organism anterior-posterior axis morphology, abnormal AB + MO1-cep162 + MO4-tp53 standard conditions Fig. 2 from Wang et al., 2013
heart looping disrupted, abnormal AB + MO1-cep162 + MO4-tp53 standard conditions Fig. 2 from Wang et al., 2013
lateral plate mesoderm right side spaw expression mislocalised, abnormal AB + MO1-cep162 + MO4-tp53 standard conditions Fig. 2 from Wang et al., 2013
brain hydrocephalic, abnormal AB + MO1-cep162 + MO4-tp53 standard conditions Fig. 2 from Wang et al., 2013
muscle cell apoptotic, abnormal AB + MO1-col6a1 + MO4-tp53 chemical treatment: cyclosporin A Fig. 7 from Telfer et al., 2010
musculoskeletal movement disrupted, abnormal AB + MO1-col6a1 + MO4-tp53 standard conditions Fig. 8 from Telfer et al., 2010
muscle cell apoptotic, abnormal AB + MO1-col6a1 + MO4-tp53 standard conditions Fig. 7 from Telfer et al., 2010
whole organism edematous, abnormal AB + MO1-coq8b + MO4-tp53 standard conditions Fig. 2 from Ashraf et al., 2013
orbit edematous, abnormal AB + MO1-coq8b + MO4-tp53 standard conditions Fig. 2 from Ashraf et al., 2013
podocyte cell projection disorganized, abnormal AB + MO1-coq8b + MO4-tp53 standard conditions Fig. 2 from Ashraf et al., 2013
glomerular basement membrane disorganized, abnormal AB + MO1-coq8b + MO4-tp53 standard conditions Fig. 2 from Ashraf et al., 2013
podocyte development disrupted, abnormal AB + MO1-coq8b + MO4-tp53 standard conditions Fig. 2 from Ashraf et al., 2013
islet cell decreased amount, abnormal AB + MO1-dachb + MO4-tp53 standard conditions Fig. 5 with image from Yang et al., 2021
islet shape, abnormal AB + MO1-dachb + MO4-tp53 standard conditions Fig. 5 with image from Yang et al., 2021
CaP motoneuron axon ab1-tuba labeling spatial pattern, abnormal AB + MO1-dnm1a + MO4-tp53 control Fig. 4 with image from Bragato et al., 2023
CaP motoneuron neuron projection decreased branchiness, abnormal AB + MO1-dnm1a + MO4-tp53 control Fig. 4 with image from Bragato et al., 2023
muscle cell vacuole increased amount, abnormal AB + MO1-dnm1a + MO4-tp53 control Fig. 5 with image from Bragato et al., 2023
muscle cell increased distance muscle cell, abnormal AB + MO1-dnm1a + MO4-tp53 control Fig. 5 with image from Bragato et al., 2023
CaP motoneuron neuron projection decreased distribution, abnormal AB + MO1-dnm1a + MO4-tp53 control Fig. 4 with image from Bragato et al., 2023
muscle cell disorganized, abnormal AB + MO1-dnm1a + MO4-tp53 control Fig. 5 with image from Bragato et al., 2023
slow muscle cell spatial pattern, abnormal AB + MO1-dnm1a + MO4-tp53 control Fig. 5 with image from Bragato et al., 2023
muscle cell decreased amount, abnormal AB + MO1-dnm1a + MO4-tp53 control Fig. 5 with image from Bragato et al., 2023
muscle cell atrophied, abnormal AB + MO1-dnm1a + MO4-tp53 control Fig. 5 with image from Bragato et al., 2023
somite C-shaped, abnormal AB + MO1-dnm1a + MO4-tp53 control Fig. 3 with image from Bragato et al., 2023
post-vent region curved, abnormal AB + MO1-dnm1a + MO4-tp53 control Fig. 3 with image from Bragato et al., 2023
thigmotaxis process quality, abnormal AB + MO1-dnm1a + MO4-tp53 control Table 2 from Bragato et al., 2023
myotome skeletal muscle myoblast increased amount, abnormal AB + MO1-dnm1a + MO4-tp53 control Fig. 5 with image from Bragato et al., 2023
whole organism Ab-dnm1 labeling decreased amount, abnormal AB + MO1-dnm1a + MO4-tp53 control Fig. 3 with image from Bragato et al., 2023
hydrogen peroxide biosynthetic process disrupted, abnormal AB + MO1-duox + MO4-tp53 physical alteration: caudal fin Fig. 3 from Niethammer et al., 2009
leukocyte migration disrupted, abnormal AB + MO1-duox + MO4-tp53 physical alteration: caudal fin Fig. 3 from Niethammer et al., 2009
response to wounding disrupted, abnormal AB + MO1-duox + MO4-tp53 physical alteration: caudal fin Fig. 3 from Niethammer et al., 2009
whole organism Ab1-ehd1 labeling decreased amount, abnormal AB + MO1-ehd1b + MO4-tp53 control Fig. S4 from Issler et al., 2022
retina apoptotic process process quality, ameliorated AB + MO1-ehmt2 + MO4-tp53 standard conditions Fig. 5 with image from Olsen et al., 2016
brain vasculature hemorrhagic, abnormal AB + MO1-fcsk + MO4-tp53 control Fig. 2 with image from Fowler et al., 2021
lens protruding, abnormal AB + MO1-gdf6a + MO4-tp53 standard conditions Fig. 4Fig. 5 from Asai-Coakwell et al., 2007
post-vent region kinked, abnormal AB + MO1-gdf6a + MO4-tp53 standard conditions Fig. 3 from Asai-Coakwell et al., 2009
retina malformed, abnormal AB + MO1-gdf6a + MO4-tp53 standard conditions Fig. 5 from Asai-Coakwell et al., 2007
retina disorganized, abnormal AB + MO1-gdf6a + MO4-tp53 standard conditions Fig. 4 from Asai-Coakwell et al., 2007
cranial nerve II hypoplastic, abnormal AB + MO1-gdf6a + MO4-tp53 standard conditions Fig. 4 from Asai-Coakwell et al., 2007
optic fissure closure incomplete, abnormal AB + MO1-gdf6a + MO4-tp53 standard conditions Fig. 3 from Asai-Coakwell et al., 2009
Fig. 4Fig. 5 from Asai-Coakwell et al., 2007
lens vacuolated, abnormal AB + MO1-gdf6a + MO4-tp53 standard conditions Fig. 4 from Asai-Coakwell et al., 2007
eye decreased size, abnormal AB + MO1-gdf6a + MO4-tp53 standard conditions Fig. 3 from Asai-Coakwell et al., 2009
Fig. 4Fig. 5 from Asai-Coakwell et al., 2007
post-vent region decreased length, abnormal AB + MO1-hecw2a + MO4-tp53 control Fig. 2 from Lu et al., 2020
brain opaque, abnormal AB + MO1-hecw2a + MO4-tp53 control Fig. 2 from Lu et al., 2020
spinal cord opaque, abnormal AB + MO1-hecw2a + MO4-tp53 control Fig. 2 from Lu et al., 2020
eye opaque, abnormal AB + MO1-hecw2a + MO4-tp53 control Fig. 2 from Lu et al., 2020
whole organism deformed, abnormal AB + MO1-hecw2a + MO4-tp53 control Fig. 2 from Lu et al., 2020
post-vent region curved, abnormal AB + MO1-hecw2a + MO4-tp53 control Fig. 2 from Lu et al., 2020
otic vesicle decreased size, abnormal AB + MO1-hmx4 + MO2-hmx4 + MO4-tp53 standard conditions Fig. 2 with image from Gongal et al., 2011
eye adjacent to eye, abnormal AB + MO1-hmx4 + MO2-hmx4 + MO4-tp53 standard conditions Fig. 2 with imageFig. 5 with image from Gongal et al., 2011
pectoral fin absent, abnormal AB + MO1-hmx4 + MO2-hmx4 + MO4-tp53 standard conditions Fig. 2 with image from Gongal et al., 2011
neural tube closure incomplete, abnormal AB + MO1-hmx4 + MO2-hmx4 + MO4-tp53 standard conditions Fig. 2 with imageFig. 5 with image from Gongal et al., 2011
swim bladder bud hypoplastic, abnormal AB + MO1-ihha + MO4-tp53 standard conditions Fig. S3 with image from Winata et al., 2009
swim bladder morphogenesis disrupted, abnormal AB + MO1-ihha + MO4-tp53 standard conditions Fig. S3 with image from Winata et al., 2009
swim bladder hypoplastic, abnormal AB + MO1-ihha + MO4-tp53 standard conditions Fig. S3 with image from Winata et al., 2009
posterior lateral line neuromast decreased amount, abnormal AB + MO1-ildr1b + MO4-tp53 control Fig. S6 from Sang et al., 2014
Kupffer's vesicle tight junction structure, abnormal AB + MO1-jupa + MO4-tp53 standard conditions Fig. 5 with image from Dasgupta et al., 2018
Kupffer's vesicle anatomical space decreased volume, abnormal AB + MO1-jupa + MO4-tp53 standard conditions Fig. 5 with image from Dasgupta et al., 2018
whole organism edematous, abnormal AB + MO1-kank2 + MO4-tp53 standard conditions Fig. 4 from Gee et al., 2015
eye edematous, abnormal AB + MO1-kank2 + MO4-tp53 standard conditions Fig. 4 from Gee et al., 2015
podocyte cell projection absent, abnormal AB + MO1-kank2 + MO4-tp53 standard conditions Fig. 4 from Gee et al., 2015
glomerular basement membrane disorganized, abnormal AB + MO1-kank2 + MO4-tp53 standard conditions Fig. 4 from Gee et al., 2015
podocyte disorganized, abnormal AB + MO1-kank2 + MO4-tp53 standard conditions Fig. 4 from Gee et al., 2015
heart tube symmetry, abnormal AB + MO1-kif7 + MO4-tp53 standard conditions Fig. 3 from Wilson et al., 2009
determination of left/right symmetry disrupted, abnormal AB + MO1-kif7 + MO4-tp53 standard conditions Fig. 3 from Wilson et al., 2009
heart looping disrupted, abnormal AB + MO1-kif7 + MO4-tp53 standard conditions Fig. 3 from Wilson et al., 2009
heart tube inverted, abnormal AB + MO1-kif7 + MO4-tp53 standard conditions Fig. 3 from Wilson et al., 2009
trunk Ab1-ntn1 labeling increased distribution, abnormal AB + MO1-lamc3 + MO4-tp53 standard conditions Fig. 4 with image from Eve et al., 2017
muscle pioneer ntn1a expression increased distribution, abnormal AB + MO1-lamc3 + MO4-tp53 standard conditions Fig. 4 with image from Eve et al., 2017
trunk Ab1-ntn1 labeling spatial pattern, abnormal AB + MO1-lamc3 + MO4-tp53 standard conditions Fig. 4 with image from Eve et al., 2017
post-vent region curved, abnormal AB + MO1-lasp1 + MO2-lasp1 + MO4-tp53 standard conditions Figure 3 with image from Grossi et al., 2022
trunk decreased size, abnormal AB + MO1-lasp1 + MO2-lasp1 + MO4-tp53 standard conditions Figure 3 with image from Grossi et al., 2022
head decreased size, abnormal AB + MO1-lasp1 + MO2-lasp1 + MO4-tp53 standard conditions Figure 3 with image from Grossi et al., 2022
eye aplastic, abnormal AB + MO1-lasp1 + MO2-lasp1 + MO4-tp53 standard conditions Figure 3 with image from Grossi et al., 2022
embryo development disrupted, abnormal AB + MO1-lasp1 + MO2-lasp1 + MO4-tp53 standard conditions Figure 3 with image from Grossi et al., 2022
swimming decreased occurrence, abnormal AB + MO1-mfge8a + MO4-tp53 standard conditions Fig. 3 from Luo et al., 2023
somite actin filament disorganized, abnormal AB + MO1-mkxa + MO4-tp53 standard conditions Fig. 1 from Chuang et al., 2014
whole organism curved, abnormal AB + MO1-mkxa + MO4-tp53 standard conditions Fig. 1 from Chuang et al., 2014
somite focal adhesion decreased amount, abnormal AB + MO1-mkxa + MO4-tp53 standard conditions Fig. 1 from Chuang et al., 2014
skeletal muscle cell irregular spatial pattern, abnormal AB + MO1-mkxa + MO4-tp53 standard conditions Fig. 1 from Chuang et al., 2014
whole organism anterior-posterior axis decreased length, abnormal AB + MO1-mkxa + MO4-tp53 standard conditions Fig. 1 from Chuang et al., 2014
thigmotaxis disrupted, abnormal AB + MO1-mkxa + MO4-tp53 standard conditions Fig. 1 from Chuang et al., 2014
somite actin filament decondensed, abnormal AB + MO1-mkxa + MO4-tp53 standard conditions Fig. 1 from Chuang et al., 2014
eye size, ameliorated AB + MO1-mpi + MO4-tp53 standard conditions Fig. 3 with image from DeRossi et al., 2017
pericardium edematous, ameliorated AB + MO1-mpi + MO4-tp53 standard conditions Fig. 3 with image from DeRossi et al., 2017
head size, ameliorated AB + MO1-mpi + MO4-tp53 standard conditions Fig. 3 with image from DeRossi et al., 2017
liver size, ameliorated AB + MO1-mpi + MO4-tp53 standard conditions Fig. 3 with image from DeRossi et al., 2017
mandibular arch skeleton morphology, ameliorated AB + MO1-mpi + MO4-tp53 standard conditions Fig. 3 with image from DeRossi et al., 2017
whole organism life span, ameliorated AB + MO1-mpi + MO4-tp53 standard conditions Fig. 3 with image from DeRossi et al., 2017
whole organism tp53 expression amount, ameliorated AB + MO1-mpi + MO4-tp53 standard conditions Fig. 3 with image from DeRossi et al., 2017
apoptotic process process quality, ameliorated AB + MO1-mpi + MO4-tp53 standard conditions Fig. 3 with image from DeRossi et al., 2017
apoptotic process increased process quality, abnormal AB + MO1-msrb3 + MO4-tp53 control Fig. 5 with image from Shen et al., 2015
embryo development delayed, abnormal AB + MO1-nefla + MO4-tp53 standard conditions Fig. 4 from Wang et al., 2018
trunk bent, abnormal AB + MO1-neflb + MO4-tp53 standard conditions Fig. 5 from Wang et al., 2018
whole organism malformed, abnormal AB + MO1-neflb + MO4-tp53 standard conditions Fig. 5 from Wang et al., 2018
eye decreased size, abnormal AB + MO1-neflb + MO4-tp53 standard conditions Fig. 5 from Wang et al., 2018
thigmotaxis delayed, abnormal AB + MO1-neflb + MO4-tp53 standard conditions Fig. 5 from Wang et al., 2018
brain structure, abnormal AB + MO1-neflb + MO4-tp53 standard conditions Fig. 5 from Wang et al., 2018
brain development disrupted, abnormal AB + MO1-pcsk7 + MO4-tp53 standard conditions Fig. 4 from Turpeinen et al., 2013
otolith decreased amount, abnormal AB + MO1-pcsk7 + MO4-tp53 standard conditions Fig. 8 from Turpeinen et al., 2013
whole organism dead, abnormal AB + MO1-pcsk7 + MO4-tp53 standard conditions Fig. 4 from Turpeinen et al., 2013
heart development disrupted, abnormal AB + MO1-pcsk7 + MO4-tp53 standard conditions Fig. 4 from Turpeinen et al., 2013
otolith development disrupted, abnormal AB + MO1-pcsk7 + MO4-tp53 standard conditions Fig. 4 from Turpeinen et al., 2013
eye development disrupted, abnormal AB + MO1-pcsk7 + MO4-tp53 standard conditions Fig. 4 from Turpeinen et al., 2013
central nervous system myelination disrupted, abnormal AB + MO1-pgap3 + MO4-tp53 standard conditions Fig. 5 from Da'as et al., 2020
midbrain decreased size, abnormal AB + MO1-pgap3 + MO4-tp53 standard conditions Fig. 4 from Da'as et al., 2020
larval locomotory behavior process quality, abnormal AB + MO1-pgap3 + MO4-tp53 standard conditions Fig. 3 from Da'as et al., 2020
ventricular system dilated, abnormal AB + MO1-pgap3 + MO4-tp53 standard conditions Fig. 6 from Da'as et al., 2020
inner ear mislocalised, abnormal AB + MO1-pgap3 + MO4-tp53 standard conditions Fig. 4 from Da'as et al., 2020
brainstem malformed, abnormal AB + MO1-pgap3 + MO4-tp53 standard conditions Fig. 5 from Da'as et al., 2020
tectal ventricle separated from tectal ventricle, abnormal AB + MO1-pgap3 + MO4-tp53 standard conditions Fig. 5 from Da'as et al., 2020
swimming behavior process quality, abnormal AB + MO1-pgap3 + MO4-tp53 standard conditions Fig. 7 from Da'as et al., 2020
granular layer corpus cerebelli degeneration, abnormal AB + MO1-pgap3 + MO4-tp53 standard conditions Fig. 6 from Da'as et al., 2020
thigmotaxis disrupted, abnormal AB + MO1-pgap3 + MO4-tp53 standard conditions Fig. S Video 2 from Da'as et al., 2020
brain decreased size, abnormal AB + MO1-pgap3 + MO4-tp53 standard conditions Fig. 6 from Da'as et al., 2020
head decreased size, abnormal AB + MO1-pgap3 + MO4-tp53 standard conditions Fig. 4 from Da'as et al., 2020
ventricular system development disrupted, abnormal AB + MO1-pgap3 + MO4-tp53 standard conditions Fig. 3 from Da'as et al., 2020
midbrain hindbrain boundary morphology, abnormal AB + MO1-pgap3 + MO4-tp53 standard conditions Fig. 4Fig. 5 from Da'as et al., 2020
brain morphogenesis disrupted, abnormal AB + MO1-pgap3 + MO4-tp53 standard conditions Fig. 3 from Da'as et al., 2020
neural tube malformed, abnormal AB + MO1-pgap3 + MO4-tp53 standard conditions Fig. 3 from Da'as et al., 2020
brain development delayed, abnormal AB + MO1-pgap3 + MO4-tp53 standard conditions Fig. 4 from Da'as et al., 2020
brain degeneration, abnormal AB + MO1-pgap3 + MO4-tp53 standard conditions Fig. 6 from Da'as et al., 2020
optic tectum decreased size, abnormal AB + MO1-pgap3 + MO4-tp53 standard conditions Fig. 5 from Da'as et al., 2020
pronephros cystic, abnormal AB + MO1-pik3r4 + MO4-tp53 standard conditions Fig. 3 with image from Stoetzel et al., 2016
whole organism anterior-posterior axis curved, abnormal AB + MO1-pik3r4 + MO4-tp53 standard conditions Fig. 3 with image from Stoetzel et al., 2016
brain hydrocephalic, abnormal AB + MO1-pik3r4 + MO4-tp53 standard conditions Fig. 3 with image from Stoetzel et al., 2016
epiboly process quality, abnormal AB + MO1-prmt6 + MO4-tp53 standard conditions Fig. 2 from Zhao et al., 2016
whole organism gadd45aa expression increased amount, abnormal AB + MO1-prmt6 + MO4-tp53 standard conditions Fig. 4 from Zhao et al., 2016
apoptotic process process quality, abnormal AB + MO1-prmt6 + MO4-tp53 standard conditions Fig. 4 from Zhao et al., 2016
whole organism jun expression increased amount, abnormal AB + MO1-prmt6 + MO4-tp53 standard conditions Fig. 4 from Zhao et al., 2016
whole organism tp53 expression increased amount, abnormal AB + MO1-prmt6 + MO4-tp53 standard conditions Fig. 4 from Zhao et al., 2016
whole organism cdkn1a expression increased amount, abnormal AB + MO1-prmt6 + MO4-tp53 standard conditions Fig. 4 from Zhao et al., 2016
whole organism ab12-tp53 labeling amount, ameliorated AB + MO1-prmt6 + MO4-tp53 standard conditions Fig. 2 from Zhao et al., 2016
brain development disrupted, abnormal AB + MO1-qdprb.1 + MO4-tp53 standard conditions Fig. S3 with image from Breuer et al., 2019
midbrain morphology, abnormal AB + MO1-qdprb.1 + MO4-tp53 standard conditions Fig. S3 with image from Breuer et al., 2019
hindbrain morphology, abnormal AB + MO1-qdprb.1 + MO4-tp53 standard conditions Fig. S3 with image from Breuer et al., 2019
whole organism glutamine increased amount, abnormal AB + MO1-qdprb.1 + MO4-tp53 standard conditions Fig. S4 from Breuer et al., 2019
head decreased size, abnormal AB + MO1-qdprb.1 + MO4-tp53 standard conditions Fig. S3 with image from Breuer et al., 2019
brain decreased volume, abnormal AB + MO1-rel + MO4-tp53 standard conditions Fig. 8 from Bagheri et al., 2016
fourth ventricle morphology, abnormal AB + MO1-rel + MO4-tp53 standard conditions Fig. 8 from Bagheri et al., 2016
common myeloid progenitor spi1b expression amount, ameliorated AB + MO1-rpl5a + MO4-tp53 standard conditions Fig. 2 with image from Wan et al., 2016
angioblastic mesenchymal cell tal1 expression amount, ameliorated AB + MO1-rpl5a + MO4-tp53 standard conditions Fig. 2 with image from Wan et al., 2016
hematopoietic stem cell myb expression amount, ameliorated AB + MO1-rpl5a + MO4-tp53 standard conditions Fig. 2 with image from Wan et al., 2016
hematopoietic stem cell runx1 expression amount, ameliorated AB + MO1-rpl5a + MO4-tp53 standard conditions Fig. 2 with image from Wan et al., 2016
heart nucleate erythrocyte amount, ameliorated AB + MO1-rpl5a + MO4-tp53 standard conditions Fig. 1 with image from Wan et al., 2016
erythroid progenitor cell gata1a expression amount, ameliorated AB + MO1-rpl5a + MO4-tp53 standard conditions Fig. 2 with image from Wan et al., 2016
heart morphology, abnormal AB + MO1-sap30l + MO4-tp53 standard conditions text only from Teittinen et al., 2012
heart contraction decreased efficiency, abnormal AB + MO1-sap30l + MO4-tp53 standard conditions text only from Teittinen et al., 2012
heart contraction decreased rate, abnormal AB + MO1-sap30l + MO4-tp53 standard conditions text only from Teittinen et al., 2012
heart looping disrupted, abnormal AB + MO1-sap30l + MO4-tp53 standard conditions text only from Teittinen et al., 2012
blood circulation decreased process quality, abnormal AB + MO1-sel1l + MO4-tp53 standard conditions Table 2 from Barbieri et al., 2017
pericardium edematous, abnormal AB + MO1-sel1l + MO4-tp53 standard conditions Table 2 from Barbieri et al., 2017
blood accumulation post-vent region, abnormal AB + MO1-sel1l + MO4-tp53 standard conditions Table 2 from Barbieri et al., 2017
anterior lateral line neuromast hair cell apoptotic, abnormal AB + MO1-slc26a2 + MO4-tp53 standard conditions Fig. 6 with image from Liu et al., 2015
posterior lateral line neuromast hair cell apoptotic, abnormal AB + MO1-slc26a2 + MO4-tp53 standard conditions Fig. 6 with image from Liu et al., 2015
neural tube apoptotic process increased occurrence, abnormal AB + MO1-smc1a + MO4-tp53 standard conditions Fig. 4 from Fazio et al., 2016
eye edematous, abnormal AB + MO1-srgap2 + MO4-tp53 standard conditions Fig. 6 from Pan et al., 2017
trunk edematous, abnormal AB + MO1-srgap2 + MO4-tp53 standard conditions Fig. 6 from Pan et al., 2017
pronephric glomerulus podocyte foot morphology, abnormal AB + MO1-srgap2 + MO4-tp53 standard conditions Fig. 6 from Pan et al., 2017
pericardium edematous, abnormal AB + MO1-srgap2 + MO4-tp53 standard conditions Fig. 6 from Pan et al., 2017
pronephric glomerulus slit diaphragm disorganized, abnormal AB + MO1-srgap2 + MO4-tp53 standard conditions Fig. 6 from Pan et al., 2017
pronephric glomerular basement membrane disorganized, abnormal AB + MO1-srgap2 + MO4-tp53 standard conditions Fig. 6 from Pan et al., 2017
determination of left/right symmetry disrupted, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. 3Fig. S11 from Wilson et al., 2009
lateral floor plate aplastic, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. 2Fig. S5 from Wilson et al., 2009
Kupffer's vesicle altered number of ciliated cell axonemal microtubule, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. 3 from Wilson et al., 2009
heart tube symmetry, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. 3 from Wilson et al., 2009
liver inverted, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. S11 from Wilson et al., 2009
floor plate formation disrupted, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. 2Fig. S5 from Wilson et al., 2009
medial floor plate morphology, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. S5 from Wilson et al., 2009
smoothened signaling pathway disrupted, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. 2 from Wilson et al., 2009
Kupffer's vesicle axoneme disorganized, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. 3 from Wilson et al., 2009
heart tube inverted, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. 3 from Wilson et al., 2009
atrium inverted, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. S11 from Wilson et al., 2009
liver position, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. S11 from Wilson et al., 2009
somite muscle pioneer absent, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. 2 from Wilson et al., 2009
axoneme assembly disrupted, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. 3 from Wilson et al., 2009
heart tube straight, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. S11 from Wilson et al., 2009
eye fused with eye, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions text only from Wilson et al., 2009
heart looping disrupted, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. 3Fig. S11 from Wilson et al., 2009
somite U-shaped, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. 2 from Wilson et al., 2009
cilium or flagellum-dependent cell motility disrupted, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. 3 from Wilson et al., 2009
gut position, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. S11 from Wilson et al., 2009
pancreas inverted, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. S11 from Wilson et al., 2009
pancreas position, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. S11 from Wilson et al., 2009
midbrain hindbrain boundary malformed, abnormal AB + MO1-tfpi2 + MO4-tp53 standard conditions Fig. 4 with image from Zhang et al., 2013
third ventricle decreased size, abnormal AB + MO1-tfpi2 + MO4-tp53 standard conditions Fig. 4 with image from Zhang et al., 2013
fourth ventricle decreased size, abnormal AB + MO1-tfpi2 + MO4-tp53 standard conditions Fig. 4 with image from Zhang et al., 2013
trunk slow muscle cell ab-f59 labeling spatial pattern, ameliorated AB + MO1-tpcn1 + MO2-tpcn1 + MO4-tp53 standard conditions Fig. 1 from Rice et al., 2022
trunk slow muscle cell ab-f59 labeling spatial pattern, abnormal AB + MO1-tpcn1 + MO2-tpcn1 + MO4-tp53 standard conditions Fig. 2 from Rice et al., 2022
trunk fast muscle cell ab-f59 labeling spatial pattern, ameliorated AB + MO1-tpcn1 + MO2-tpcn1 + MO4-tp53 standard conditions Fig. 1 from Rice et al., 2022
vertical myoseptum ab-f59 labeling spatial pattern, ameliorated AB + MO1-tpcn1 + MO2-tpcn1 + MO4-tp53 standard conditions Fig. 1 from Rice et al., 2022
vertical myoseptum endolysosome irregular spatial pattern, abnormal AB + MO1-tpcn1 + MO4-tp53 standard conditions Fig. 5 from Rice et al., 2022
smooth muscle cell endolysosome irregular spatial pattern, abnormal AB + MO1-tpcn1 + MO4-tp53 standard conditions Fig. 5 from Rice et al., 2022
vertical myoseptum ab-f59 labeling spatial pattern, abnormal AB + MO1-tpcn1 + MO4-tp53 standard conditions Fig. 1Fig. 2 from Rice et al., 2022
trunk fast muscle cell ab-f59 labeling spatial pattern, abnormal AB + MO1-tpcn1 + MO4-tp53 standard conditions Fig. 1 from Rice et al., 2022
trunk slow muscle cell ab-f59 labeling spatial pattern, abnormal AB + MO1-tpcn1 + MO4-tp53 standard conditions Fig. 1Fig. 2 from Rice et al., 2022
somite 8 vertical myoseptum ab3-dag1 labeling spatial pattern, abnormal AB + MO1-tpcn1 + MO4-tp53 standard conditions Fig. 6 from Rice et al., 2022
somite 9 vertical myoseptum ab3-dag1 labeling spatial pattern, abnormal AB + MO1-tpcn1 + MO4-tp53 standard conditions Fig. 6 from Rice et al., 2022
slow muscle cell tpcn2 expression decreased amount, abnormal AB + MO1-tpcn2 + MO4-tp53 standard conditions Fig. 3 from Kelu et al., 2015
slow muscle cell ab-f59 labeling decreased amount, abnormal AB + MO1-tpcn2 + MO4-tp53 standard conditions Fig. 3 from Kelu et al., 2015
forebrain apoptotic process increased occurrence, abnormal AB + MO1-tulp3 + MO4-tp53 standard conditions Figure 6 with image from Kerek et al., 2020
hindbrain apoptotic process increased occurrence, abnormal AB + MO1-tulp3 + MO4-tp53 standard conditions Figure 6 with image from Kerek et al., 2020
embryo development delayed, abnormal AB + MO1-tulp3 + MO4-tp53 standard conditions Figure 6 with image from Kerek et al., 2020
eye decreased circumference, abnormal AB + MO1-uhrf1 + MO4-tp53 standard conditions Fig. S5 from Chu et al., 2012
eye decreased size, abnormal AB + MO1-uhrf1 + MO4-tp53 standard conditions Fig. S5 from Chu et al., 2012
midbrain hindbrain boundary morphology, abnormal AB + MO1-uhrf1 + MO4-tp53 standard conditions Fig. S5 from Chu et al., 2012
whole organism dead, abnormal AB + MO1-uhrf1 + MO4-tp53 standard conditions Fig. S5 from Chu et al., 2012
whole organism decreased life span, abnormal AB + MO1-uhrf1 + MO4-tp53 standard conditions Fig. S5 from Chu et al., 2012
embryo development disrupted, abnormal AB + MO1-uhrf1 + MO4-tp53 standard conditions Fig. S5 from Chu et al., 2012
eye decreased size, abnormal AB + MO1-xpo1a + MO4-tp53 standard conditions Fig. 7 from Bagheri et al., 2016
brain decreased volume, abnormal AB + MO1-xpo1a + MO4-tp53 standard conditions Fig. 8 from Bagheri et al., 2016
trunk morphology, abnormal AB + MO1-xpo1a + MO4-tp53 standard conditions Fig. 6Fig. 7 from Bagheri et al., 2016
head decreased size, abnormal AB + MO1-xpo1a + MO4-tp53 standard conditions Fig. 7 from Bagheri et al., 2016
head morphology, abnormal AB + MO1-xpo1a + MO4-tp53 standard conditions Fig. 6 from Bagheri et al., 2016
fin decreased size, abnormal AB + MO1-xpo1a + MO4-tp53 standard conditions Fig. 7 from Bagheri et al., 2016
fourth ventricle morphology, abnormal AB + MO1-xpo1a + MO4-tp53 standard conditions Fig. 8 from Bagheri et al., 2016
trunk curved, abnormal AB + MO1-xpo1a + MO4-tp53 standard conditions Fig. 7 from Bagheri et al., 2016
otic vesicle decreased size, abnormal AB + MO1-xpo1a + MO4-tp53 standard conditions Fig. 7 from Bagheri et al., 2016
eye decreased diameter, abnormal AB + MO1-zgc:112052 + MO4-tp53 standard conditions FIGURE 3 with image from Mignani et al., 2020
brain decreased size, abnormal AB + MO1-zgc:112052 + MO4-tp53 standard conditions FIGURE 3 with image from Mignani et al., 2020
brain morphology, abnormal AB + MO1-zgc:112052 + MO4-tp53 standard conditions FIGURE 3 with image from Mignani et al., 2020
eye decreased size, abnormal AB + MO1-zgc:112052 + MO4-tp53 standard conditions FIGURE 3 with image from Mignani et al., 2020
retina apoptotic process process quality, ameliorated AB + MO1-znf644b + MO4-tp53 standard conditions Fig. 5 with image from Olsen et al., 2016
whole organism dorsalized, abnormal AB + MO2-adpgk + MO4-tp53 standard conditions Fig. S2 from Imle et al., 2019
whole organism decreased length, abnormal AB + MO2-adpgk + MO4-tp53 standard conditions Fig. S2 from Imle et al., 2019
post-vent region decreased size, abnormal AB + MO2-bcl11aa + MO4-tp53 standard conditions Fig. 7 from Bagheri et al., 2016
trunk morphology, abnormal AB + MO2-bcl11aa + MO4-tp53 standard conditions Fig. 6 from Bagheri et al., 2016
eye decreased size, abnormal AB + MO2-bcl11aa + MO4-tp53 standard conditions Fig. 7 from Bagheri et al., 2016
brain decreased volume, abnormal AB + MO2-bcl11aa + MO4-tp53 standard conditions Fig. 8 from Bagheri et al., 2016
head morphology, abnormal AB + MO2-bcl11aa + MO4-tp53 standard conditions Fig. 6 from Bagheri et al., 2016
brain development disrupted, abnormal AB + MO2-bcl11aa + MO4-tp53 standard conditions Fig. 8 from Bagheri et al., 2016
fin decreased size, abnormal AB + MO2-bcl11aa + MO4-tp53 standard conditions Fig. 7 from Bagheri et al., 2016
otic vesicle decreased size, abnormal AB + MO2-bcl11aa + MO4-tp53 standard conditions Fig. 7 from Bagheri et al., 2016
ventricular system lumenized, abnormal AB + MO2-cldn5a + MO4-tp53 standard conditions Fig. 3 with image from Zhang et al., 2010
fourth ventricle decreased volume, abnormal AB + MO2-cldn5a + MO4-tp53 standard conditions Fig. 3 with image from Zhang et al., 2010
ventricular system development disrupted, abnormal AB + MO2-cldn5a + MO4-tp53 standard conditions Fig. 3 with image from Zhang et al., 2010
tectal ventricle decreased volume, abnormal AB + MO2-cldn5a + MO4-tp53 standard conditions Fig. 3 with image from Zhang et al., 2010
orbit edematous, abnormal AB + MO2-coq8b + MO4-tp53 standard conditions Fig. S1 from Ashraf et al., 2013
whole organism edematous, abnormal AB + MO2-coq8b + MO4-tp53 standard conditions Fig. S1 from Ashraf et al., 2013
endocrine pancreas development disrupted, abnormal AB + MO2-dachb + MO4-tp53 standard conditions Fig. 4 with image from Yang et al., 2021
whole organism ins expression decreased amount, abnormal AB + MO2-dachb + MO4-tp53 standard conditions Fig. 8 with image from Yang et al., 2021
islet ab2-isl labeling decreased amount, abnormal AB + MO2-dachb + MO4-tp53 standard conditions Fig. 4 with image from Yang et al., 2021
whole organism nkx6-1 expression decreased amount, abnormal AB + MO2-dachb + MO4-tp53 standard conditions Fig. 8 with image from Yang et al., 2021
whole organism neurod1 expression decreased amount, abnormal AB + MO2-dachb + MO4-tp53 standard conditions Fig. 8 with image from Yang et al., 2021
whole organism ptf1a expression decreased amount, abnormal AB + MO2-dachb + MO4-tp53 standard conditions Fig. 8 with image from Yang et al., 2021
type B pancreatic cell development disrupted, abnormal AB + MO2-dachb + MO4-tp53 standard conditions Fig. 4 with image from Yang et al., 2021
islet cell decreased amount, abnormal AB + MO2-dachb + MO4-tp53 standard conditions Fig. 4 with imageFig. 5 with image from Yang et al., 2021
whole organism insm1a expression decreased amount, abnormal AB + MO2-dachb + MO4-tp53 standard conditions Fig. 8 with image from Yang et al., 2021
whole organism dachb expression decreased amount, abnormal AB + MO2-dachb + MO4-tp53 standard conditions Fig. 3 with imageFig. 7 with image from Yang et al., 2021
whole organism dacha expression decreased amount, abnormal AB + MO2-dachb + MO4-tp53 standard conditions Fig. 7 with image from Yang et al., 2021
pancreatic B cell decreased amount, abnormal AB + MO2-dachb + MO4-tp53 standard conditions Fig. 4 with imageFig. 5 with image from Yang et al., 2021
islet shape, abnormal AB + MO2-dachb + MO4-tp53 standard conditions Fig. 4 with image from Yang et al., 2021
whole organism pax6a expression decreased amount, abnormal AB + MO2-dachb + MO4-tp53 standard conditions Fig. 8 with image from Yang et al., 2021
islet cell decreased volume, abnormal AB + MO2-dachb + MO4-tp53 standard conditions Fig. 4 with imageFig. 5 with image from Yang et al., 2021
whole organism sst2 expression decreased amount, abnormal AB + MO2-dachb + MO4-tp53 standard conditions Fig. 8 with image from Yang et al., 2021
pancreatic B cell ins expression decreased amount, abnormal AB + MO2-dachb + MO4-tp53 standard conditions Fig. 4 with image from Yang et al., 2021
CaP motoneuron axon ab1-tuba labeling spatial pattern, abnormal AB + MO2-dnm1a + MO4-tp53 control Fig. 4 with image from Bragato et al., 2023
CaP motoneuron neuron projection decreased branchiness, abnormal AB + MO2-dnm1a + MO4-tp53 control Fig. 4 with image from Bragato et al., 2023
muscle cell vacuole increased amount, abnormal AB + MO2-dnm1a + MO4-tp53 control Fig. 5 with image from Bragato et al., 2023
whole organism dnm1a expression absent, abnormal AB + MO2-dnm1a + MO4-tp53 control Fig. 3 with image from Bragato et al., 2023
muscle cell increased distance muscle cell, abnormal AB + MO2-dnm1a + MO4-tp53 control Fig. 5 with image from Bragato et al., 2023
CaP motoneuron neuron projection decreased distribution, abnormal AB + MO2-dnm1a + MO4-tp53 control Fig. 4 with image from Bragato et al., 2023
muscle cell disorganized, abnormal AB + MO2-dnm1a + MO4-tp53 control Fig. 5 with image from Bragato et al., 2023
slow muscle cell spatial pattern, abnormal AB + MO2-dnm1a + MO4-tp53 control Fig. 5 with image from Bragato et al., 2023
muscle cell decreased amount, abnormal AB + MO2-dnm1a + MO4-tp53 control Fig. 5 with image from Bragato et al., 2023
muscle cell atrophied, abnormal AB + MO2-dnm1a + MO4-tp53 control Fig. 5 with image from Bragato et al., 2023
somite C-shaped, abnormal AB + MO2-dnm1a + MO4-tp53 control Fig. 3 with image from Bragato et al., 2023
post-vent region curved, abnormal AB + MO2-dnm1a + MO4-tp53 control Fig. 3 with image from Bragato et al., 2023
thigmotaxis process quality, abnormal AB + MO2-dnm1a + MO4-tp53 control Table 2 from Bragato et al., 2023
myotome skeletal muscle myoblast increased amount, abnormal AB + MO2-dnm1a + MO4-tp53 control Fig. 5 with image from Bragato et al., 2023
dorsal telencephalon morphology, abnormal AB + MO2-emx3 + MO3-emx3 + MO4-tp53 heat shock Fig. 6 with image from Viktorin et al., 2009
epibranchial ganglion decreased amount, abnormal AB + MO2-fgf24 + MO4-tp53 standard conditions Fig. 7 with image from Padanad et al., 2011
Kupffer's vesicle tight junction structure, abnormal AB + MO2-jupa + MO4-tp53 standard conditions Fig. 5 with image from Dasgupta et al., 2018
Kupffer's vesicle anatomical space decreased volume, abnormal AB + MO2-jupa + MO4-tp53 chemical treatment by environment: CFTR potentiator Fig. 5 with image from Dasgupta et al., 2018
Kupffer's vesicle anatomical space decreased volume, abnormal AB + MO2-jupa + MO4-tp53 control Fig. 5 with image from Dasgupta et al., 2018
podocyte cell projection absent, abnormal AB + MO2-kank2 + MO4-tp53 standard conditions Fig. S5 from Gee et al., 2015
whole organism edematous, abnormal AB + MO2-kank2 + MO4-tp53 standard conditions Fig. 4 from Gee et al., 2015
glomerular basement membrane disorganized, abnormal AB + MO2-kank2 + MO4-tp53 standard conditions Fig. S5 from Gee et al., 2015
podocyte disorganized, abnormal AB + MO2-kank2 + MO4-tp53 standard conditions Fig. S5 from Gee et al., 2015
eye edematous, abnormal AB + MO2-kank2 + MO4-tp53 standard conditions Fig. 4 from Gee et al., 2015
apoptotic process increased process quality, abnormal AB + MO2-msrb3 + MO4-tp53 control Fig. 5 with image from Shen et al., 2015
epiboly process quality, abnormal AB + MO2-prmt6 + MO4-tp53 standard conditions Fig. 2 from Zhao et al., 2016
whole organism gadd45aa expression increased amount, abnormal AB + MO2-prmt6 + MO4-tp53 standard conditions Fig. 4 from Zhao et al., 2016
apoptotic process process quality, abnormal AB + MO2-prmt6 + MO4-tp53 standard conditions Fig. 4 from Zhao et al., 2016
whole organism jun expression increased amount, abnormal AB + MO2-prmt6 + MO4-tp53 standard conditions Fig. 4 from Zhao et al., 2016
whole organism tp53 expression increased amount, abnormal AB + MO2-prmt6 + MO4-tp53 standard conditions Fig. 4 from Zhao et al., 2016
whole organism cdkn1a expression increased amount, abnormal AB + MO2-prmt6 + MO4-tp53 standard conditions Fig. 4 from Zhao et al., 2016
whole organism ab12-tp53 labeling amount, ameliorated AB + MO2-prmt6 + MO4-tp53 standard conditions Fig. 2 from Zhao et al., 2016
heart morphology, abnormal AB + MO2-sap30l + MO4-tp53 standard conditions text only from Teittinen et al., 2012
heart contraction decreased efficiency, abnormal AB + MO2-sap30l + MO4-tp53 standard conditions text only from Teittinen et al., 2012
heart contraction decreased rate, abnormal AB + MO2-sap30l + MO4-tp53 standard conditions text only from Teittinen et al., 2012
heart looping disrupted, abnormal AB + MO2-sap30l + MO4-tp53 standard conditions text only from Teittinen et al., 2012
midbrain decreased size, abnormal AB + MO2-scgn + MO4-tp53 standard conditions Fig. S11 from Qin et al., 2020
intermediate cell mass of mesoderm gata1a expression decreased amount, abnormal AB + MO2-sparc + MO4-tp53 control Fig. 6 from Ceinos et al., 2013
otolith decreased amount, abnormal AB + MO2-tgfb1a + MO4-tp53 standard conditions Fig. 10 from Turpeinen et al., 2013
vertical myoseptum endolysosome irregular spatial pattern, abnormal AB + MO2-tpcn1 + MO4-tp53 standard conditions Fig. 5 from Rice et al., 2022
smooth muscle cell endolysosome irregular spatial pattern, abnormal AB + MO2-tpcn1 + MO4-tp53 standard conditions Fig. 5 from Rice et al., 2022
vertical myoseptum ab-f59 labeling spatial pattern, abnormal AB + MO2-tpcn1 + MO4-tp53 standard conditions Fig. 1Fig. 2 from Rice et al., 2022
trunk fast muscle cell ab-f59 labeling spatial pattern, abnormal AB + MO2-tpcn1 + MO4-tp53 standard conditions Fig. 1 from Rice et al., 2022
trunk slow muscle cell ab-f59 labeling spatial pattern, abnormal AB + MO2-tpcn1 + MO4-tp53 standard conditions Fig. 1Fig. 2 from Rice et al., 2022
somite 8 vertical myoseptum ab3-dag1 labeling spatial pattern, abnormal AB + MO2-tpcn1 + MO4-tp53 standard conditions Fig. 6 from Rice et al., 2022
somite 9 vertical myoseptum ab3-dag1 labeling spatial pattern, abnormal AB + MO2-tpcn1 + MO4-tp53 standard conditions Fig. 6 from Rice et al., 2022
Meckel's cartilage absent, abnormal AB + MO2-vdrb + MO4-tp53 standard conditions Fig. 1 with image from Kwon, 2019
palatoquadrate cartilage absent, abnormal AB + MO2-vdrb + MO4-tp53 standard conditions Fig. 1 with image from Kwon, 2019
spinal cord fsta expression increased amount, abnormal AB + MO2-vdrb + MO4-tp53 standard conditions Fig. 2 with image from Kwon, 2019
pharyngeal arch fsta expression increased amount, abnormal AB + MO2-vdrb + MO4-tp53 standard conditions Fig. 2 with image from Kwon, 2019
heart decreased functionality, abnormal AB + MO2-vdrb + MO4-tp53 standard conditions Fig. 2 from Kwon, 2016
brain fsta expression increased amount, abnormal AB + MO2-vdrb + MO4-tp53 standard conditions Fig. 2 with image from Kwon, 2019
cranial cartilage morphology, abnormal AB + MO2-vdrb + MO4-tp53 standard conditions Fig. 1 with image from Kwon, 2019
eye fsta expression increased amount, abnormal AB + MO2-vdrb + MO4-tp53 standard conditions Fig. 2 with image from Kwon, 2019
pericardium edematous, abnormal AB + MO2-vdrb + MO4-tp53 standard conditions Fig. 1 from Kwon, 2016
cranial cartilage hypoplastic, abnormal AB + MO2-vdrb + MO4-tp53 standard conditions Fig. 1 with image from Kwon, 2019
ceratobranchial cartilage decreased size, abnormal AB + MO2-vdrb + MO4-tp53 standard conditions Fig. 1 with image from Kwon, 2019
midbrain hindbrain boundary constriction midbrain-hindbrain boundary morphogenesis process quality, abnormal AB + MO2-wnt5b + MO4-tp53 control Fig. 2 with image from Gutzman et al., 2018
midbrain hindbrain boundary constriction basal region structure, abnormal AB + MO2-wnt5b + MO4-tp53 control Fig. 2 with image from Gutzman et al., 2018
midbrain hindbrain boundary constriction basal region increased width, abnormal AB + MO2-wnt5b + MO4-tp53 control Fig. 2 with image from Gutzman et al., 2018
midbrain hindbrain boundary constriction epithelial cell morphogenesis process quality, abnormal AB + MO2-wnt5b + MO4-tp53 control Fig. 2 with image from Gutzman et al., 2018
brain apoptotic process increased occurrence, abnormal AB + MO3-brd2a + MO4-tp53 standard conditions Fig. 12 with image from Murphy et al., 2017
brain cell death increased occurrence, abnormal AB + MO3-brd2a + MO4-tp53 standard conditions Fig. 6 with image from Murphy et al., 2017
brain structure, abnormal AB + MO3-brd2a + MO4-tp53 standard conditions Fig. 6 with image from Murphy et al., 2017
midbrain hindbrain boundary posterior region en2a expression decreased distribution, abnormal AB + MO3-brd2a + MO4-tp53 standard conditions Fig. 12 with image from Murphy et al., 2017
central nervous system cell death increased occurrence, abnormal AB + MO3-brd2a + MO4-tp53 standard conditions Fig. 6 with image from Murphy et al., 2017
whole organism decreased mobility, abnormal AB + MO3-ca8 + MO4-tp53 standard conditions Fig. 9 from Huang et al., 2014
thigmotaxis disrupted, abnormal AB + MO3-ca8 + MO4-tp53 standard conditions Fig. 9 from Huang et al., 2014
whole organism edematous, abnormal AB + MO3-coq8b + MO4-tp53 standard conditions Fig. 2 from Ashraf et al., 2013
orbit edematous, abnormal AB + MO3-coq8b + MO4-tp53 standard conditions Fig. 2 from Ashraf et al., 2013
heart tube extracellular matrix symmetrical, abnormal AB + MO3-hapln1a + MO4-tp53 standard conditions Figure 4 with image from Derrick et al., 2021
eye edematous, abnormal AB + MO3-lrrk2 + MO4-tp53 standard conditions Fig. 3 with image from Prabhudesai et al., 2016
post-vent region bent, abnormal AB + MO3-lrrk2 + MO4-tp53 standard conditions Fig. 3 with image from Prabhudesai et al., 2016
presumptive cephalic mesoderm gene expression disrupted, abnormal AB + MO3-myf5 + MO4-tp53 standard conditions Fig. 4 from Lin et al., 2013
pharyngeal arch 3-7 skeleton absent, abnormal AB + MO3-myf5 + MO4-tp53 standard conditions Fig. 5 from Lin et al., 2013
pharyngeal arch 5 has fewer parts of type chondroblast, abnormal AB + MO3-myf5 + MO4-tp53 standard conditions Fig. 5 from Lin et al., 2013
Meckel's cartilage malformed, abnormal AB + MO3-myf5 + MO4-tp53 standard conditions Fig. 5 from Lin et al., 2013
pharyngeal arch 6 absent, abnormal AB + MO3-myf5 + MO4-tp53 standard conditions Fig. 2 from Lin et al., 2013
pharyngeal arch 6 has fewer parts of type chondroblast, abnormal AB + MO3-myf5 + MO4-tp53 standard conditions Fig. 5 from Lin et al., 2013
palatoquadrate cartilage malformed, abnormal AB + MO3-myf5 + MO4-tp53 standard conditions Fig. 5 from Lin et al., 2013
ceratobranchial cartilage absent, abnormal AB + MO3-myf5 + MO4-tp53 standard conditions Fig. 5 from Lin et al., 2013
neuroectoderm neural crest cell decreased amount, abnormal AB + MO3-myf5 + MO4-tp53 standard conditions Fig. 4 from Lin et al., 2013
pharyngeal arch 6 has fewer parts of type cranial neural crest, abnormal AB + MO3-myf5 + MO4-tp53 standard conditions Fig. 5 from Lin et al., 2013
pharyngeal arch 3 has fewer parts of type chondroblast, abnormal AB + MO3-myf5 + MO4-tp53 standard conditions Fig. 2 from Lin et al., 2013
pharyngeal arch 5 has fewer parts of type cranial neural crest, abnormal AB + MO3-myf5 + MO4-tp53 standard conditions Fig. 5 from Lin et al., 2013
ceratohyal cartilage malformed, abnormal AB + MO3-myf5 + MO4-tp53 standard conditions Fig. 5 from Lin et al., 2013
pharyngeal arch 5 absent, abnormal AB + MO3-myf5 + MO4-tp53 standard conditions Fig. 2 from Lin et al., 2013
blood vessel endothelial cell adherens junction immature, abnormal AB + MO3-ptprb + MO4-tp53 standard conditions Fig. S5 with image from Carra et al., 2012
blood vessel endothelial cell has fewer parts of type blood vessel endothelial cell cell-cell junction, abnormal AB + MO3-ptprb + MO4-tp53 standard conditions Fig. S5 with image from Carra et al., 2012
adherens junction assembly disrupted, abnormal AB + MO3-ptprb + MO4-tp53 standard conditions Fig. S5 with image from Carra et al., 2012
eye decreased size, abnormal AB + MO3-rel + MO4-tp53 standard conditions Fig. 7 from Bagheri et al., 2016
trunk morphology, abnormal AB + MO3-rel + MO4-tp53 standard conditions Fig. 6Fig. 7 from Bagheri et al., 2016
fin decreased size, abnormal AB + MO3-rel + MO4-tp53 standard conditions Fig. 7 from Bagheri et al., 2016
trunk curved, abnormal AB + MO3-rel + MO4-tp53 standard conditions Fig. 7 from Bagheri et al., 2016
head decreased size, abnormal AB + MO3-rel + MO4-tp53 standard conditions Fig. 7 from Bagheri et al., 2016
head morphology, abnormal AB + MO3-rel + MO4-tp53 standard conditions Fig. 6 from Bagheri et al., 2016
otic placode pax2a expression decreased amount, abnormal AB + MO3-sox3 + MO4-tp53 standard conditions Fig. 7 with image from Gou et al., 2018
otic placode pax2a expression decreased distribution, abnormal AB + MO3-sox3 + MO4-tp53 standard conditions Fig. 7 with image from Gou et al., 2018
hatching process quality, abnormal AB + MO4-masp1 + MO4-tp53 standard conditions Fig. 2 from Mortensen et al., 2017
whole organism increased curvature, abnormal AB + MO4-masp1 + MO4-tp53 standard conditions Fig. 2 from Mortensen et al., 2017
pectoral fin development disrupted, abnormal AB + MO4-masp1 + MO4-tp53 standard conditions Fig. 2 from Mortensen et al., 2017
pigmentation process quality, abnormal AB + MO4-masp1 + MO4-tp53 standard conditions Fig. 2 from Mortensen et al., 2017
pericardium edematous, abnormal AB + MO4-masp1 + MO4-tp53 standard conditions Fig. 2 from Mortensen et al., 2017
brain edematous, abnormal AB + MO4-masp1 + MO4-tp53 standard conditions Fig. 2 from Mortensen et al., 2017
trunk slow muscle cell ab-f59 labeling spatial pattern, abnormal AB + MO4-tp53 standard conditions Fig. 2 from Rice et al., 2022
vertical myoseptum endolysosome irregular spatial pattern, abnormal AB + MO4-tp53 standard conditions Fig. 5 from Rice et al., 2022
smooth muscle cell endolysosome irregular spatial pattern, abnormal AB + MO4-tp53 standard conditions Fig. 5 from Rice et al., 2022
post-vent region decreased length, abnormal AB + MO4-tp53 + MO5-cav1 standard conditions Fig. 2 with image from Mo et al., 2010
notochord deformed, abnormal AB + MO4-tp53 + MO5-cav1 standard conditions Fig. 2 with image from Mo et al., 2010
trunk curved, abnormal AB + MO4-tp53 + MO5-cav1 standard conditions Fig. 2 with image from Mo et al., 2010
somite deformed, abnormal AB + MO4-tp53 + MO5-cav1 standard conditions Fig. 2 with image from Mo et al., 2010
eye decreased diameter, abnormal AB + MO4-tp53 + MO5-cpsf1 standard conditions Figure 5 with image from Ouyang et al., 2019
eye decreased size, abnormal AB + MO4-tp53 + MO5-cpsf1 standard conditions Figure 5 with image from Ouyang et al., 2019
optic fissure closure incomplete, abnormal AB + MO4-tp53 + MO5-gdf6a standard conditions Fig. 3 from Asai-Coakwell et al., 2009
eye decreased size, abnormal AB + MO4-tp53 + MO5-gdf6a standard conditions Fig. 3 from Asai-Coakwell et al., 2009
post-vent region kinked, abnormal AB + MO4-tp53 + MO5-gdf6a standard conditions Fig. 3 from Asai-Coakwell et al., 2009
trigeminal ganglion axon arborization disrupted, abnormal AB + MO4-tp53 + MO5-mecp2 standard conditions Fig. 2 with image from Leong et al., 2015
trigeminal ganglion axon branchiness, abnormal AB + MO4-tp53 + MO5-mecp2 standard conditions Fig. 2 with image from Leong et al., 2015
midbrain hindbrain boundary constriction midbrain-hindbrain boundary morphogenesis process quality, abnormal AB + MO4-tp53 + MO5-ptk2ab control Fig. 3 with image from Gutzman et al., 2018
midbrain hindbrain boundary constriction basal region structure, abnormal AB + MO4-tp53 + MO5-ptk2ab control Fig. 3 with image from Gutzman et al., 2018
midbrain hindbrain boundary constriction basal region increased width, abnormal AB + MO4-tp53 + MO5-ptk2ab control Fig. 3 with image from Gutzman et al., 2018
midbrain hindbrain boundary constriction epithelial cell morphogenesis process quality, abnormal AB + MO4-tp53 + MO5-ptk2ab control Fig. 3 with image from Gutzman et al., 2018
trunk curved lateral, abnormal AB + MO4-tp53 + MO5-slc16a2 standard conditions Fig. 3 from Campinho et al., 2014
brain development disrupted, abnormal AB + MO4-tp53 + MO5-slc16a2 standard conditions Fig. 3 from Campinho et al., 2014
apoptotic process increased occurrence, abnormal AB + MO4-tp53 + MO5-slc16a2 standard conditions Fig. 3 from Campinho et al., 2014
notochord deformed, abnormal AB + MO4-tp53 + MO6-cav1 standard conditions Fig. 2 with image from Mo et al., 2010
somite deformed, abnormal AB + MO4-tp53 + MO6-cav1 standard conditions Fig. 2 with image from Mo et al., 2010
trunk curved, abnormal AB + MO4-tp53 + MO6-cav1 standard conditions Fig. 2 with image from Mo et al., 2010
post-vent region decreased length, abnormal AB + MO4-tp53 + MO6-cav1 standard conditions Fig. 2 with image from Mo et al., 2010
eye edematous, abnormal AB + MO4-tp53 + MO7-lrrk2 standard conditions Fig. 3 with image from Prabhudesai et al., 2016
post-vent region bent, abnormal AB + MO4-tp53 + MO7-lrrk2 standard conditions Fig. 3 with image from Prabhudesai et al., 2016
cranial cartilage decreased size, abnormal AB/TL + MO1-fto + MO4-tp53 standard conditions Fig. 1 with image from Osborn et al., 2014
pronephric glomerulus podocyte differentiation decreased process quality, abnormal AB/TL + MO1-kif21a + MO4-tp53 standard conditions Figure 3 with image from Riedmann et al., 2023
heart edematous, abnormal AB/TL + MO1-kif21a + MO4-tp53 standard conditions Figure 2 with image from Riedmann et al., 2023
whole organism kif21a expression decreased amount, abnormal AB/TL + MO1-kif21a + MO4-tp53 standard conditions Figure 2 with image from Riedmann et al., 2023
pronephric podocyte podocyte foot mislocalised, abnormal AB/TL + MO1-kif21a + MO4-tp53 standard conditions Figure 3 with image from Riedmann et al., 2023
pronephros glomerular filtration decreased process quality, abnormal AB/TL + MO1-kif21a + MO4-tp53 standard conditions Figure 3 with image from Riedmann et al., 2023
whole organism curved ventral, abnormal AB/TL + MO1-srrm4 + MO4-tp53 standard conditions Fig. 6 with image from Calarco et al., 2009
ventricular system increased volume, abnormal AB/TL + MO1-srrm4 + MO4-tp53 standard conditions Fig. 6 with image from Calarco et al., 2009
head decreased width, abnormal AB/TL + MO1-tubgcp2 + MO4-tp53 control Fig. 1 with imageFig. 2 with image from Bartoszewski et al., 2022
head decreased size, abnormal AB/TL + MO1-tubgcp2 + MO4-tp53 control Fig. 1 with imageFig. 2 with image from Bartoszewski et al., 2022
whole organism decreased length, abnormal AB/TL + MO1-tubgcp2 + MO4-tp53 control Fig. 2 with image from Bartoszewski et al., 2022
pronephric glomerulus podocyte differentiation decreased process quality, abnormal AB/TL + MO2-kif21a + MO4-tp53 standard conditions Figure 3 with image from Riedmann et al., 2023
heart edematous, abnormal AB/TL + MO2-kif21a + MO4-tp53 standard conditions Figure 2 with image from Riedmann et al., 2023
whole organism kif21a expression decreased amount, abnormal AB/TL + MO2-kif21a + MO4-tp53 standard conditions Figure 2 with image from Riedmann et al., 2023
pronephric podocyte podocyte foot mislocalised, abnormal AB/TL + MO2-kif21a + MO4-tp53 standard conditions Figure 3 with image from Riedmann et al., 2023
pronephros glomerular filtration decreased process quality, abnormal AB/TL + MO2-kif21a + MO4-tp53 standard conditions Figure 3 with image from Riedmann et al., 2023
head decreased width, abnormal AB/TL + MO2-tubgcp2 + MO4-tp53 control Fig. 1 with imageFig. 2 with image from Bartoszewski et al., 2022
head decreased size, abnormal AB/TL + MO2-tubgcp2 + MO4-tp53 control Fig. 1 with imageFig. 2 with image from Bartoszewski et al., 2022
whole organism decreased length, abnormal AB/TL + MO2-tubgcp2 + MO4-tp53 control Fig. 2 with image from Bartoszewski et al., 2022
brain apoptotic, abnormal AB/TU + MO1-cables1 + MO4-tp53 standard conditions Fig. 3 from Groeneweg et al., 2011
locomotory behavior process quality, abnormal AB/TU + MO1-cables1 + MO4-tp53 standard conditions Fig. 4 from Groeneweg et al., 2011
skeletal muscle cell sparse, abnormal AB/TU + MO1-gmppb + MO4-tp53 standard conditions Fig. 7 from Zheng et al., 2021
whole organism sox2 expression decreased amount, abnormal AB/TU + MO1-gmppb + MO4-tp53 standard conditions Fig. Extended Data Fig. 9 from Zheng et al., 2021
skeletal muscle cell disorganized, abnormal AB/TU + MO1-gmppb + MO4-tp53 standard conditions Fig. 7 from Zheng et al., 2021
whole organism sox2 expression amount, ameliorated AB/TU + MO1-gmppb + MO4-tp53 chemical treatment by injection: GDP-mannose Fig. Extended Data Fig. 9 from Zheng et al., 2021
whole organism Ab1-gmppb labeling decreased amount, abnormal AB/TU + MO1-gmppb + MO4-tp53 standard conditions Fig. Extended Data Fig. 9 from Zheng et al., 2021
glycoprotein biosynthetic process decreased occurrence, abnormal AB/TU + MO1-gmppb + MO4-tp53 standard conditions Fig. Extended Data Fig. 9 from Zheng et al., 2021
whole organism GDP-mannose decreased amount, abnormal AB/TU + MO1-gmppb + MO4-tp53 standard conditions Fig. Extended Data Fig. 9 from Zheng et al., 2021
skeletal muscle cell morphology, ameliorated AB/TU + MO1-gmppb + MO4-tp53 chemical treatment by injection: GDP-mannose Fig. 7 from Zheng et al., 2021
notochord development delayed, abnormal AB/TU + MO1-igf2a + MO2-igf2a + MO4-tp53 standard conditions Fig. 4 from White et al., 2009
somite specification disrupted, abnormal AB/TU + MO1-igf2a + MO2-igf2a + MO4-tp53 standard conditions Fig. 4 from White et al., 2009
notochord undulate, abnormal AB/TU + MO1-igf2a + MO2-igf2a + MO4-tp53 standard conditions Fig. 4 from White et al., 2009
trunk has fewer parts of type somite, abnormal AB/TU + MO1-igf2a + MO2-igf2a + MO4-tp53 standard conditions Fig. 4 from White et al., 2009
post-vent region kinked, abnormal AB/TU + MO1-inpp5e + MO4-tp53 standard conditions Fig. 2 with image from Luo et al., 2012
whole organism anatomical axis asymmetrical, abnormal AB/TU + MO1-inpp5e + MO4-tp53 standard conditions Fig. 2 with image from Luo et al., 2012
pronephros cystic, abnormal AB/TU + MO1-inpp5e + MO4-tp53 standard conditions Fig. 2 with image from Luo et al., 2012
whole organism decreased pigmentation, abnormal AB/TU + MO1-inpp5e + MO4-tp53 standard conditions Fig. 2 with image from Luo et al., 2012
retina development in camera-type eye disrupted, abnormal AB/TU + MO1-inpp5e + MO4-tp53 standard conditions Fig. 2 with image from Luo et al., 2012
pericardium edematous, abnormal AB/TU + MO1-inpp5e + MO4-tp53 standard conditions Fig. 2 with image from Luo et al., 2012
retina disorganized, abnormal AB/TU + MO1-inpp5e + MO4-tp53 standard conditions Fig. 2 with image from Luo et al., 2012
eye decreased size, abnormal AB/TU + MO1-inpp5e + MO4-tp53 standard conditions Fig. 2 with image from Luo et al., 2012
whole organism klhl13 expression decreased amount, abnormal AB/TU + MO1-klhl13 + MO4-tp53 control Fig. 4 with image from Akhter et al., 2025
atrium cardiac conduction decreased velocity, abnormal AB/TU + MO1-rnf207b + MO4-tp53 standard conditions Fig. 3 from Roder et al., 2014
cardiac ventricle cardiac conduction decreased velocity, abnormal AB/TU + MO1-rnf207b + MO4-tp53 standard conditions Fig. 3 from Roder et al., 2014
heart contraction process quality, abnormal AB/TU + MO1-rnf207b + MO4-tp53 standard conditions text only from Roder et al., 2014
atrial myocardium action potential increased duration, abnormal AB/TU + MO1-rnf207b + MO4-tp53 standard conditions Fig. 2 from Roder et al., 2014
heart looping disrupted, abnormal AB/TU + MO1-rnf207b + MO4-tp53 standard conditions text only from Roder et al., 2014
ventricular myocardium action potential increased duration, abnormal AB/TU + MO1-rnf207b + MO4-tp53 standard conditions Fig. 2 from Roder et al., 2014
fourth ventricle increased size, abnormal AB/TU + MO1-tcf4 + MO2-tcf4 + MO4-tp53 standard conditions Fig. 4 from Brockschmidt et al., 2011
post-vent region curved, abnormal AB/TU + MO1-tcf4 + MO2-tcf4 + MO4-tp53 standard conditions Fig. 4Fig. 5 from Brockschmidt et al., 2011
embryo development delayed, abnormal AB/TU + MO1-tcf4 + MO2-tcf4 + MO4-tp53 standard conditions Fig. 4 from Brockschmidt et al., 2011
lens morphogenesis in camera-type eye delayed, abnormal AB/TU + MO1-tcf4 + MO2-tcf4 + MO4-tp53 standard conditions Fig. 5 from Brockschmidt et al., 2011
somite shape, abnormal AB/TU + MO2-igf2a + MO4-tp53 standard conditions text only from White et al., 2009
notochord undulate, abnormal AB/TU + MO2-igf2a + MO4-tp53 standard conditions text only from White et al., 2009
convergent extension involved in axis elongation delayed, abnormal AB/TU + MO2-igf2a + MO4-tp53 standard conditions text only from White et al., 2009
swimming behavior decreased process quality, abnormal AB/TU + MO2-klhl13 + MO4-tp53 lighting conditions Fig. 4 with image from Akhter et al., 2025
pericardium edematous, abnormal AB/TU + MO2-klhl13 + MO4-tp53 control Fig. 4 with imageFig. 5 with image from Akhter et al., 2025
swimming behavior decreased process quality, abnormal AB/TU + MO2-klhl13 + MO4-tp53 control Fig. 5 with image from Akhter et al., 2025
pericardium composition, ameliorated AB/TU + MO2-klhl13 + MO4-tp53 chemical treatment by environment: AZD-1152 Fig. 5 with image from Akhter et al., 2025
post-vent region curved, abnormal AB/TU + MO2-klhl13 + MO4-tp53 control Fig. 4 with imageFig. 5 with image from Akhter et al., 2025
whole organism decreased length, abnormal AB/TU + MO2-klhl13 + MO4-tp53 control Fig. 4 with imageFig. 5 with image from Akhter et al., 2025
ventral mandibular arch physical quality, ameliorated AB/TU + MO2-klhl13 + MO4-tp53 chemical treatment by environment: AZD-1152 Fig. 5 with image from Akhter et al., 2025
ball composition, ameliorated AB/TU + MO2-klhl13 + MO4-tp53 chemical treatment by environment: AZD-1152 Fig. 5 with image from Akhter et al., 2025
post-vent region curvature, ameliorated AB/TU + MO2-klhl13 + MO4-tp53 chemical treatment by environment: AZD-1152 Fig. 5 with image from Akhter et al., 2025
swimming behavior process quality, ameliorated AB/TU + MO2-klhl13 + MO4-tp53 chemical treatment by environment: AZD-1152 Fig. 5 with image from Akhter et al., 2025
post-vent region kinked, abnormal AB/TU + MO2-klhl13 + MO4-tp53 control Fig. 4 with imageFig. 5 with image from Akhter et al., 2025
swim bladder amount, ameliorated AB/TU + MO2-klhl13 + MO4-tp53 chemical treatment by environment: AZD-1152 Fig. 5 with image from Akhter et al., 2025
optic tectum EGFP expression spatial pattern, ameliorated AB/TU + MO2-klhl13 + MO4-tp53 chemical treatment by environment: AZD-1152 Fig. 5 with image from Akhter et al., 2025
whole organism length, ameliorated AB/TU + MO2-klhl13 + MO4-tp53 chemical treatment by environment: AZD-1152 Fig. 5 with image from Akhter et al., 2025
swim bladder absence of anatomical entity, abnormal AB/TU + MO2-klhl13 + MO4-tp53 control Fig. 4 with imageFig. 5 with image from Akhter et al., 2025
ball edematous, abnormal AB/TU + MO2-klhl13 + MO4-tp53 control Fig. 4 with imageFig. 5 with image from Akhter et al., 2025
ventral mandibular arch protruding, abnormal AB/TU + MO2-klhl13 + MO4-tp53 control Fig. 4 with imageFig. 5 with image from Akhter et al., 2025
whole organism Ab2-aurkb labeling increased amount, abnormal AB/TU + MO2-klhl13 + MO4-tp53 control Fig. 5 with image from Akhter et al., 2025
swimming behavior decreased process quality, abnormal AB/TU + MO2-klhl13 + MO4-tp53 lighting conditions Fig. 4 with image from Akhter et al., 2025
atrium cardiac conduction decreased velocity, abnormal AB/TU + MO2-rnf207b + MO4-tp53 standard conditions Fig. 3 from Roder et al., 2014
cardiac ventricle cardiac conduction decreased velocity, abnormal AB/TU + MO2-rnf207b + MO4-tp53 standard conditions Fig. 3 from Roder et al., 2014
heart contraction process quality, abnormal AB/TU + MO2-rnf207b + MO4-tp53 standard conditions text only from Roder et al., 2014
atrial myocardium action potential increased duration, abnormal AB/TU + MO2-rnf207b + MO4-tp53 standard conditions Fig. 2 from Roder et al., 2014
heart looping disrupted, abnormal AB/TU + MO2-rnf207b + MO4-tp53 standard conditions text only from Roder et al., 2014
ventricular myocardium action potential increased duration, abnormal AB/TU + MO2-rnf207b + MO4-tp53 standard conditions Fig. 2 from Roder et al., 2014
canonical Wnt signaling pathway decreased occurrence, abnormal AB/TU + MO4-tp53 + MO5-lbx2 + MO8-lbx2 control Fig. 2 from Lu et al., 2014
ventral mesoderm chrd expression mislocalised, abnormal AB/TU + MO4-tp53 + MO5-lbx2 + MO8-lbx2 standard conditions Fig. 1Fig. 5 from Lu et al., 2014
margin ventral region eve1 expression decreased amount, abnormal AB/TU + MO4-tp53 + MO5-lbx2 + MO8-lbx2 standard conditions Fig. 1 from Lu et al., 2014
caudal fin ventral region absent, abnormal AB/TU + MO4-tp53 + MO5-lbx2 + MO8-lbx2 standard conditions Fig. 1 from Lu et al., 2014
trunk posterior region absent, abnormal AB/TU + MO4-tp53 + MO5-lbx2 + MO8-lbx2 standard conditions Fig. 1 from Lu et al., 2014
axial mesoderm chrd expression increased amount, abnormal AB/TU + MO4-tp53 + MO5-lbx2 + MO8-lbx2 standard conditions Fig. 1 from Lu et al., 2014
whole organism wholly dorsalized, abnormal AB/TU + MO4-tp53 + MO5-lbx2 + MO8-lbx2 standard conditions Fig. 1 from Lu et al., 2014
whole organism elongated, abnormal AB/TU + MO4-tp53 + MO5-lbx2 + MO8-lbx2 standard conditions Fig. 1 from Lu et al., 2014
trunk ventral region absent, abnormal AB/TU + MO4-tp53 + MO5-lbx2 + MO8-lbx2 standard conditions Fig. 1 from Lu et al., 2014
margin ventral region eve1 expression decreased distribution, abnormal AB/TU + MO4-tp53 + MO5-lbx2 + MO8-lbx2 standard conditions Fig. 1 from Lu et al., 2014
presumptive ectoderm foxi1 expression decreased amount, abnormal AB/TU + MO4-tp53 + MO5-lbx2 + MO8-lbx2 standard conditions Fig. 1 from Lu et al., 2014
caudal fin posterior region absent, abnormal AB/TU + MO4-tp53 + MO5-lbx2 + MO8-lbx2 standard conditions Fig. 1 from Lu et al., 2014
presumptive ectoderm foxi1 expression decreased distribution, abnormal AB/TU + MO4-tp53 + MO5-lbx2 + MO8-lbx2 standard conditions Fig. 1 from Lu et al., 2014
axial mesoderm chrd expression increased distribution, abnormal AB/TU + MO4-tp53 + MO5-lbx2 + MO8-lbx2 standard conditions Fig. 1Fig. 5 from Lu et al., 2014
canonical Wnt signaling pathway decreased occurrence, abnormal AB/TU + MO4-tp53 + MO6-lbx2 + MO7-lbx2 control Fig. 2 from Lu et al., 2014
ventral mesoderm chrd expression mislocalised, abnormal AB/TU + MO4-tp53 + MO6-lbx2 + MO7-lbx2 standard conditions Fig. 1Fig. 5 from Lu et al., 2014
margin ventral region eve1 expression decreased amount, abnormal AB/TU + MO4-tp53 + MO6-lbx2 + MO7-lbx2 standard conditions Fig. 1 from Lu et al., 2014
caudal fin ventral region absent, abnormal AB/TU + MO4-tp53 + MO6-lbx2 + MO7-lbx2 standard conditions Fig. 1 from Lu et al., 2014
trunk posterior region absent, abnormal AB/TU + MO4-tp53 + MO6-lbx2 + MO7-lbx2 standard conditions Fig. 1 from Lu et al., 2014
axial mesoderm chrd expression increased amount, abnormal AB/TU + MO4-tp53 + MO6-lbx2 + MO7-lbx2 standard conditions Fig. 1 from Lu et al., 2014
whole organism wholly dorsalized, abnormal AB/TU + MO4-tp53 + MO6-lbx2 + MO7-lbx2 standard conditions Fig. 1 from Lu et al., 2014
whole organism elongated, abnormal AB/TU + MO4-tp53 + MO6-lbx2 + MO7-lbx2 standard conditions Fig. 1 from Lu et al., 2014
trunk ventral region absent, abnormal AB/TU + MO4-tp53 + MO6-lbx2 + MO7-lbx2 standard conditions Fig. 1 from Lu et al., 2014
margin ventral region eve1 expression decreased distribution, abnormal AB/TU + MO4-tp53 + MO6-lbx2 + MO7-lbx2 standard conditions Fig. 1 from Lu et al., 2014
presumptive ectoderm foxi1 expression decreased amount, abnormal AB/TU + MO4-tp53 + MO6-lbx2 + MO7-lbx2 standard conditions Fig. 1 from Lu et al., 2014
caudal fin posterior region absent, abnormal AB/TU + MO4-tp53 + MO6-lbx2 + MO7-lbx2 standard conditions Fig. 1 from Lu et al., 2014
presumptive ectoderm foxi1 expression decreased distribution, abnormal AB/TU + MO4-tp53 + MO6-lbx2 + MO7-lbx2 standard conditions Fig. 1 from Lu et al., 2014
axial mesoderm chrd expression increased distribution, abnormal AB/TU + MO4-tp53 + MO6-lbx2 + MO7-lbx2 standard conditions Fig. 1Fig. 5 from Lu et al., 2014
forebrain neuronal stem cell mislocalised, abnormal NHGRI-1 + MO1-snf8 + MO4-tp53 control Figure 6 with image from Brugger et al., 2024
optic chiasm morphology, abnormal NHGRI-1 + MO1-snf8 + MO4-tp53 control Figure 6 with imageFigure 7 with image from Brugger et al., 2024
brain decreased size, abnormal NHGRI-1 + MO1-snf8 + MO4-tp53 control Figure 6 with image from Brugger et al., 2024
eye decreased size, abnormal NHGRI-1 + MO1-snf8 + MO4-tp53 control Fig. S18Figure 6 with image from Brugger et al., 2024
cranial nerve II morphology, abnormal NHGRI-1 + MO1-snf8 + MO4-tp53 control Figure 6 with imageFigure 7 with image from Brugger et al., 2024
head decreased size, abnormal NHGRI-1 + MO1-snf8 + MO4-tp53 control Fig. S18Figure 6 with image from Brugger et al., 2024
post-vent region curved, abnormal NHGRI-1 + MO1-snf8 + MO4-tp53 control Fig. S18Figure 6 with image from Brugger et al., 2024
integument decreased pigmentation, abnormal NHGRI-1 + MO1-snf8 + MO4-tp53 control Fig. S18Figure 6 with image from Brugger et al., 2024
whole organism dead, abnormal TL + MO1-asrgl1 + MO4-tp53 standard conditions Table 4 from Biswas et al., 2016
whole organism decreased length, abnormal TL + MO1-asrgl1 + MO4-tp53 standard conditions Table 4 from Biswas et al., 2016
whole organism decreased life span, abnormal TL + MO1-asrgl1 + MO4-tp53 standard conditions Table 4 from Biswas et al., 2016
whole organism deformed, abnormal TL + MO1-asrgl1 + MO4-tp53 standard conditions Table 4 from Biswas et al., 2016
optic tectum regulation of neuronal action potential disrupted, abnormal TL + MO1-cln3 + MO4-tp53 standard conditions Fig. 4 from Wager et al., 2016
eye decreased diameter, abnormal TL + MO1-hars + MO4-tp53 control FIGURE 2 with image from Waldron et al., 2019
cellular respiration process quality, ameliorated TL + MO1-kcna1a + MO4-tp53 chemical treatment by environment: MC1568 Fig. 7 from Ibhazehiebo et al., 2018
optic tectum transmission of nerve impulse increased occurrence, abnormal TL + MO1-kcna1a + MO4-tp53 constant dark Fig. 6 with image from Ibhazehiebo et al., 2018
cellular respiration process quality, ameliorated TL + MO1-kcna1a + MO4-tp53 constant dark, chemical treatment by environment: valproic acid Fig. 3 from Ibhazehiebo et al., 2018
cellular respiration process quality, ameliorated TL + MO1-kcna1a + MO4-tp53 constant dark, chemical treatment by environment: primidone Fig. 2 from Ibhazehiebo et al., 2018
locomotory behavior increased occurrence, abnormal TL + MO1-kcna1a + MO4-tp53 constant dark Fig. 4 from Ibhazehiebo et al., 2018
cellular respiration process quality, ameliorated TL + MO1-kcna1a + MO4-tp53 constant dark, chemical treatment by environment: rufinamide Fig. 2 from Ibhazehiebo et al., 2018
cellular respiration process quality, ameliorated TL + MO1-kcna1a + MO4-tp53 constant dark, chemical treatment by environment: belinostat Fig. 7 from Ibhazehiebo et al., 2018
optic tectum transmission of nerve impulse occurrence, ameliorated TL + MO1-kcna1a + MO4-tp53 constant dark, chemical treatment by environment: vorinostat Fig. 6 with image from Ibhazehiebo et al., 2018
locomotory behavior increased occurrence, abnormal TL + MO1-kcna1a + MO4-tp53 constant dark, chemical treatment by environment: lamotrigine Fig. 4 from Ibhazehiebo et al., 2018
cellular respiration process quality, ameliorated TL + MO1-kcna1a + MO4-tp53 constant dark, chemical treatment by environment: topiramate Fig. 4 from Ibhazehiebo et al., 2018
locomotory behavior increased occurrence, abnormal TL + MO1-kcna1a + MO4-tp53 constant dark, chemical treatment by environment: levetiracetam Fig. 4 from Ibhazehiebo et al., 2018
oxidative phosphorylation process quality, ameliorated TL + MO1-kcna1a + MO4-tp53 constant dark, chemical treatment by environment: rufinamide Fig. 2 from Ibhazehiebo et al., 2018
cellular respiration process quality, ameliorated TL + MO1-kcna1a + MO4-tp53 constant dark, chemical treatment by environment: levetiracetam Fig. 4 from Ibhazehiebo et al., 2018
oxidative phosphorylation process quality, ameliorated TL + MO1-kcna1a + MO4-tp53 constant dark, chemical treatment by environment: eslicarbazepine acetate Fig. 2 from Ibhazehiebo et al., 2018
locomotory behavior increased occurrence, abnormal TL + MO1-kcna1a + MO4-tp53 constant dark, chemical treatment by environment: oxcarbazepine Fig. 4 from Ibhazehiebo et al., 2018
oxidative phosphorylation increased process quality, abnormal TL + MO1-kcna1a + MO4-tp53 constant dark Fig. 1Fig. 2 from Ibhazehiebo et al., 2018
cellular respiration process quality, ameliorated TL + MO1-kcna1a + MO4-tp53 constant dark, chemical treatment by environment: oxcarbazepine Fig. 4 from Ibhazehiebo et al., 2018
cellular respiration increased process quality, abnormal TL + MO1-kcna1a + MO4-tp53 constant dark Fig. 1Fig. 2Fig. 4 from Ibhazehiebo et al., 2018
locomotory behavior increased occurrence, abnormal TL + MO1-kcna1a + MO4-tp53 constant dark, chemical treatment by environment: topiramate Fig. 4 from Ibhazehiebo et al., 2018
cellular respiration process quality, ameliorated TL + MO1-kcna1a + MO4-tp53 constant dark, chemical treatment by environment: EC 3.5.1.98 (histone deacetylase) inhibitor Fig. 7 from Ibhazehiebo et al., 2018
cellular respiration process quality, ameliorated TL + MO1-kcna1a + MO4-tp53 constant dark, chemical treatment by environment: lamotrigine Fig. 4 from Ibhazehiebo et al., 2018
cellular respiration process quality, ameliorated TL + MO1-kcna1a + MO4-tp53 constant dark, chemical treatment by environment: eslicarbazepine acetate Fig. 2 from Ibhazehiebo et al., 2018
cellular respiration process quality, ameliorated TL + MO1-kcna1a + MO4-tp53 constant dark, chemical treatment by environment: vorinostat Fig. 3Fig. 5 from Ibhazehiebo et al., 2018
oxidative phosphorylation process quality, ameliorated TL + MO1-kcna1a + MO4-tp53 constant dark, chemical treatment by environment: primidone Fig. 2 from Ibhazehiebo et al., 2018
whole organism pla2g6 expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 1 from Sánchez et al., 2018
trigeminal ganglion increased length, abnormal TL + MO1-pla2g6 + MO4-tp53 control Fig. 4 from Sánchez et al., 2018
whole organism hsp90aa1.2 expression increased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 7 from Sánchez et al., 2018
whole organism huwe1 expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 7 from Sánchez et al., 2018
post-vent region curled, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 1 from Sánchez et al., 2018
forebrain sncb expression increased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 2 from Sánchez et al., 2018
whole organism npc1 expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 7 from Sánchez et al., 2018
whole organism ccng1 expression increased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 7 from Sánchez et al., 2018
medulla oblongata th expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 2 from Sánchez et al., 2018
trigeminal ganglion increased width, abnormal TL + MO1-pla2g6 + MO4-tp53 control Fig. 4 from Sánchez et al., 2018
pretectum th expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 2 from Sánchez et al., 2018
whole organism sncb expression increased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 2 from Sánchez et al., 2018
whole organism th expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 2 from Sánchez et al., 2018
whole organism mfn2 expression increased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 7 from Sánchez et al., 2018
diencephalon th expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 2 from Sánchez et al., 2018
whole organism th2 expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 2 from Sánchez et al., 2018
midbrain axonal fasciculation decreased occurrence, abnormal TL + MO1-pla2g6 + MO4-tp53 control Fig. 4Fig. 5 from Sánchez et al., 2018
whole organism cacna2d4b expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 7 from Sánchez et al., 2018
spinal cord malformed, abnormal TL + MO1-pla2g6 + MO4-tp53 control Fig. 4 from Sánchez et al., 2018
whole organism decreased size, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 1 from Sánchez et al., 2018
forebrain axon defasciculated, abnormal TL + MO1-pla2g6 + MO4-tp53 control Fig. 4Fig. 5 from Sánchez et al., 2018
brain malformed, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 1 from Sánchez et al., 2018
whole organism slc2a1a expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 7 from Sánchez et al., 2018
whole organism uchl1 expression increased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 7 from Sánchez et al., 2018
whole organism grin1b expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 7 from Sánchez et al., 2018
habenula sncb expression increased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 2 from Sánchez et al., 2018
whole organism xpr1a expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 7 from Sánchez et al., 2018
locus coeruleus th expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 2 from Sánchez et al., 2018
whole organism agrn expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 7 from Sánchez et al., 2018
endohypothalamic tract th expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 2 from Sánchez et al., 2018
whole organism mfn2 expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 7 from Sánchez et al., 2018
diencephalon has fewer parts of type dopaminergic neuron, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 2 from Sánchez et al., 2018
peripheral nervous system has fewer parts of type peripheral neuron, abnormal TL + MO1-pla2g6 + MO4-tp53 control Fig. 4 from Sánchez et al., 2018
midbrain axon defasciculated, abnormal TL + MO1-pla2g6 + MO4-tp53 control Fig. 4Fig. 5 from Sánchez et al., 2018
whole organism casp8 expression increased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 7 from Sánchez et al., 2018
whole organism hsp70l expression increased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 7 from Sánchez et al., 2018
hindbrain sncb expression increased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 2 from Sánchez et al., 2018
midbrain has fewer parts of type dopaminergic neuron, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 2 from Sánchez et al., 2018
whole organism kif5c expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 7 from Sánchez et al., 2018
hypothalamus posterior region th expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 2 from Sánchez et al., 2018
trigeminal ganglion decondensed, abnormal TL + MO1-pla2g6 + MO4-tp53 control Fig. 4 from Sánchez et al., 2018
telencephalon has fewer parts of type dopaminergic neuron, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 2 from Sánchez et al., 2018
trigeminal ganglion disorganized, abnormal TL + MO1-pla2g6 + MO4-tp53 control Fig. 5 from Sánchez et al., 2018
whole organism hspb1 expression increased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 7 from Sánchez et al., 2018
statoacoustic (VIII) ganglion sncb expression increased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 2 from Sánchez et al., 2018
brain pla2g6 expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 1 from Sánchez et al., 2018
forebrain axonal fasciculation decreased occurrence, abnormal TL + MO1-pla2g6 + MO4-tp53 control Fig. 4Fig. 5 from Sánchez et al., 2018
whole organism slc6a3 expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 2 from Sánchez et al., 2018
posterior lateral line ganglion sncb expression increased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 2 from Sánchez et al., 2018
whole organism lmna expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 7 from Sánchez et al., 2018
whole organism sptbn2 expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 7 from Sánchez et al., 2018
midbrain sncb expression increased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 2 from Sánchez et al., 2018
whole organism unc13a expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 7 from Sánchez et al., 2018
olfactory bulb th expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 2 from Sánchez et al., 2018
hindbrain has fewer parts of type dopaminergic neuron, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 2 from Sánchez et al., 2018
whole organism adar expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 7 from Sánchez et al., 2018
whole organism atp1a3a expression decreased amount, abnormal TL + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 7 from Sánchez et al., 2018
whole organism dead, abnormal TL + MO2-asrgl1 + MO4-tp53 standard conditions Table 4 from Biswas et al., 2016
whole organism decreased length, abnormal TL + MO2-asrgl1 + MO4-tp53 standard conditions Table 4 from Biswas et al., 2016
whole organism decreased life span, abnormal TL + MO2-asrgl1 + MO4-tp53 standard conditions Table 4 from Biswas et al., 2016
whole organism deformed, abnormal TL + MO2-asrgl1 + MO4-tp53 standard conditions Table 4 from Biswas et al., 2016
pectoral fin decreased size, abnormal TL + MO3-fgf16 + MO4-tp53 standard conditions text only from Laurell et al., 2014
pericardium edematous, abnormal TL + MO3-fgf16 + MO4-tp53 standard conditions text only from Laurell et al., 2014
pectoral fin development disrupted, abnormal TL + MO3-fgf16 + MO4-tp53 standard conditions text only from Laurell et al., 2014
whole organism morphology, abnormal TL + MO3-fgf16 + MO4-tp53 standard conditions text only from Laurell et al., 2014
pectoral fin decreased size, abnormal TL + MO4-fgf16 + MO4-tp53 standard conditions text only from Laurell et al., 2014
whole organism morphology, abnormal TL + MO4-fgf16 + MO4-tp53 standard conditions text only from Laurell et al., 2014
pectoral fin development disrupted, abnormal TL + MO4-fgf16 + MO4-tp53 standard conditions text only from Laurell et al., 2014
pericardium edematous, abnormal TL + MO4-fgf16 + MO4-tp53 standard conditions text only from Laurell et al., 2014
post-vent region curved dorsal, abnormal TU + MO1-atp1a2a + MO4-tp53 standard conditions Fig. 2 with image from Doganli et al., 2012
pericardium edematous, abnormal TU + MO1-atp1a2a + MO4-tp53 standard conditions Fig. 2 with image from Doganli et al., 2012
somite morphology, abnormal TU + MO1-atp1a2a + MO4-tp53 standard conditions Fig. 2 with image from Doganli et al., 2012
ventricular system dilated, abnormal TU + MO1-atp1a3a + MO4-tp53 standard conditions Fig. 2 from Doganli et al., 2013
cell division disrupted, abnormal TU + MO1-dync1li1 + MO4-tp53 standard conditions Fig. 6 with image from Mahale et al., 2016
blastodisc furrowed, abnormal TU + MO1-dync1li1 + MO4-tp53 standard conditions Fig. 6 with image from Mahale et al., 2016
hatching decreased process quality, abnormal TU + MO1-dync1li1 + MO4-tp53 standard conditions Fig. 6 with image from Mahale et al., 2016
mitotic cell cycle disrupted, abnormal TU + MO1-dync1li1 + MO4-tp53 standard conditions Fig. 6 with image from Mahale et al., 2016
cell division disrupted, abnormal TU + MO1-dync1li2 + MO4-tp53 standard conditions Fig. 6 with image from Mahale et al., 2016
blastodisc furrowed, abnormal TU + MO1-dync1li2 + MO4-tp53 standard conditions Fig. 6 with image from Mahale et al., 2016
hatching decreased process quality, abnormal TU + MO1-dync1li2 + MO4-tp53 standard conditions Fig. 6 with image from Mahale et al., 2016
mitotic cell cycle disrupted, abnormal TU + MO1-dync1li2 + MO4-tp53 standard conditions Fig. 6 with image from Mahale et al., 2016
post-vent region curved, abnormal TU + MO1-slc8a4a + MO4-tp53 standard conditions Fig. 2 with image from Doganli et al., 2012
pericardium edematous, abnormal TU + MO1-slc8a4a + MO4-tp53 standard conditions Fig. 2 with image from Doganli et al., 2012
heart contraction decreased rate, abnormal TU + MO1-slc8a4a + MO4-tp53 standard conditions Fig. 2 with image from Doganli et al., 2012
trunk decreased length, abnormal TU + MO1-stk36 + MO4-tp53 standard conditions Fig. 7 with image from Xia et al., 2010
whole organism wholly dorsalized, abnormal TU + MO1-stk36 + MO4-tp53 standard conditions Fig. 7 with image from Xia et al., 2010
eye development process quality, abnormal TU + MO1-upf1 + MO4-tp53 standard conditions Fig. S3 from Wittkopp et al., 2009
somitogenesis process quality, abnormal TU + MO1-upf1 + MO4-tp53 standard conditions Fig. S3 from Wittkopp et al., 2009
extension disorganized, abnormal TU + MO1-upf1 + MO4-tp53 standard conditions Fig. S3 from Wittkopp et al., 2009
central nervous system necrotic, abnormal TU + MO1-upf1 + MO4-tp53 standard conditions Fig. S3 from Wittkopp et al., 2009
whole organism posterior region ab1-casp3 labeling decreased amount, abnormal TU + MO1-wnt8a + MO2-wnt8a + MO4-tp53 standard conditions Fig. 4 with image from Naylor et al., 2017
apoptotic process decreased occurrence, abnormal TU + MO1-wnt8a + MO2-wnt8a + MO4-tp53 standard conditions Fig. 4 with image from Naylor et al., 2017
pronephric tubule slc12a3 expression decreased amount, abnormal TU + MO1-wnt8a + MO2-wnt8a + MO4-tp53 standard conditions Fig. 4 with image from Naylor et al., 2017
ventricular system dilated, abnormal TU + MO2-atp1a3a + MO4-tp53 standard conditions Fig. 2 from Doganli et al., 2013
ventricular system dilated, abnormal TU + MO2-atp1a3b + MO4-tp53 standard conditions Fig. 3 from Doganli et al., 2013
neural crest dlx2a expression decreased amount, abnormal TU + MO2-bmp5 + MO4-tp53 standard conditions Fig. 2 from Shih et al., 2017
neural crest cell population proliferation decreased occurrence, abnormal TU + MO2-bmp5 + MO4-tp53 standard conditions Fig. 2 from Shih et al., 2017
whole organism dlx2a expression decreased amount, abnormal TU + MO2-bmp5 + MO4-tp53 standard conditions Fig. 2 from Shih et al., 2017
whole organism sox10 expression decreased amount, abnormal TU + MO2-bmp5 + MO4-tp53 standard conditions Fig. 2 from Shih et al., 2017
neural crest sox10 expression decreased amount, abnormal TU + MO2-bmp5 + MO4-tp53 standard conditions Fig. 2 from Shih et al., 2017
neural crest apoptotic process increased occurrence, abnormal TU + MO2-bmp5 + MO4-tp53 standard conditions Fig. 2 from Shih et al., 2017
neural crest cell development decreased occurrence, abnormal TU + MO2-bmp5 + MO4-tp53 standard conditions Fig. 2 from Shih et al., 2017
post-vent region curved ventral, abnormal TU + MO3-adrb1 + MO4-tp53 standard conditions Fig. 1 from Wang et al., 2020
cerebrospinal fluid contacting neuron urp1 expression decreased distribution, abnormal TU + MO3-adrb1 + MO4-tp53 standard conditions Fig. S5 from Wang et al., 2020
trunk curved ventral, abnormal TU + MO3-adrb1 + MO4-tp53 standard conditions Fig. 1 from Wang et al., 2020
post-vent region curved ventral, abnormal TU + MO3-adrb2b + MO4-tp53 control Fig. 1 from Wang et al., 2020
trunk curved dorsal, abnormal TU + MO3-adrb2b + MO4-tp53 chemical treatment by environment: forskolin Fig. 1 from Wang et al., 2020
cerebrospinal fluid contacting neuron urp1 expression decreased distribution, abnormal TU + MO3-adrb2b + MO4-tp53 standard conditions Fig. S5 from Wang et al., 2020
trunk curved ventral, abnormal TU + MO3-adrb2b + MO4-tp53 control Fig. 1 from Wang et al., 2020
whole organism posterior region ab1-casp3 labeling decreased amount, abnormal TU + MO4-tp53 standard conditions Fig. 4 with image from Naylor et al., 2017
apoptotic process decreased occurrence, abnormal TU + MO4-tp53 standard conditions Fig. 4 with image from Naylor et al., 2017
head decreased size, abnormal WT + MO1-adarb1a + MO4-tp53 standard conditions Fig. 3 with image from Li et al., 2014
parachordal cartilage decreased size, abnormal WT + MO1-adarb1a + MO4-tp53 standard conditions Fig. 7 with image from Li et al., 2014
anterior lateral line neuromast decreased amount, abnormal WT + MO1-adarb1a + MO4-tp53 standard conditions Fig. 6 with image from Li et al., 2014
neurocranial trabecula decreased size, abnormal WT + MO1-adarb1a + MO4-tp53 standard conditions Fig. 7 with image from Li et al., 2014
third ventricle increased size, abnormal WT + MO1-adarb1a + MO4-tp53 standard conditions Fig. 3 with image from Li et al., 2014
cranial cartilage malformed, abnormal WT + MO1-adarb1a + MO4-tp53 standard conditions Fig. 7 with image from Li et al., 2014
fourth ventricle increased size, abnormal WT + MO1-adarb1a + MO4-tp53 standard conditions Fig. 3 with image from Li et al., 2014
ethmoid cartilage absent, abnormal WT + MO1-adarb1a + MO4-tp53 standard conditions Fig. 7 with image from Li et al., 2014
posterior lateral line neuromast decreased amount, abnormal WT + MO1-adarb1a + MO4-tp53 standard conditions Fig. 6 with image from Li et al., 2014
pharyngeal arch absent, abnormal WT + MO1-adarb1a + MO4-tp53 standard conditions Fig. 7 with image from Li et al., 2014
cornea increased thickness, abnormal WT + MO1-aldh1a2 + MO4-tp53 standard conditions Fig. 8 from Bohnsack et al., 2012
corneal epithelium scalloped, abnormal WT + MO1-aldh1a2 + MO4-tp53 standard conditions Fig. 8 from Bohnsack et al., 2012
photoreceptor outer segment layer absent, abnormal WT + MO1-aldh1a2 + MO4-tp53 standard conditions Fig. 8 from Bohnsack et al., 2012
head anterior-posterior axis decreased length, abnormal WT + MO1-aldh1a2 + MO4-tp53 standard conditions Fig. 8 from Bohnsack et al., 2012
medial rectus myofibril disorganized, abnormal WT + MO1-aldh1a2 + MO4-tp53 standard conditions Fig. 8 from Bohnsack et al., 2012
lens decreased size, abnormal WT + MO1-aldh1a2 + MO4-tp53 standard conditions Fig. 8 from Bohnsack et al., 2012
retinal outer plexiform layer disorganized, abnormal WT + MO1-aldh1a2 + MO4-tp53 standard conditions Fig. 8 from Bohnsack et al., 2012
mandibular arch skeleton malformed, abnormal WT + MO1-aldh1a2 + MO4-tp53 standard conditions Fig. 8 from Bohnsack et al., 2012
pectoral fin absent, abnormal WT + MO1-aldh1a2 + MO4-tp53 standard conditions Fig. 8 from Bohnsack et al., 2012
corneal endothelium absent, abnormal WT + MO1-aldh1a2 + MO4-tp53 standard conditions Fig. 8 from Bohnsack et al., 2012
lens morphology, abnormal WT + MO1-aldh1a2 + MO4-tp53 standard conditions Fig. 8 from Bohnsack et al., 2012
pigmentation delayed, abnormal WT + MO1-ambra1a + MO4-tp53 standard conditions Fig. 6 from Benato et al., 2013
embryo development disrupted, abnormal WT + MO1-ambra1a + MO4-tp53 standard conditions Fig. 6 from Benato et al., 2013
otolith decreased size, abnormal WT + MO1-ambra1a + MO4-tp53 standard conditions Fig. 6 from Benato et al., 2013
eye decreased size, abnormal WT + MO1-ambra1a + MO4-tp53 standard conditions Fig. 6 from Benato et al., 2013
post-vent region kinked, abnormal WT + MO1-ambra1a + MO4-tp53 standard conditions Fig. 6 from Benato et al., 2013
whole organism deformed, abnormal WT + MO1-ambra1a + MO4-tp53 standard conditions Fig. 6 from Benato et al., 2013
head decreased size, abnormal WT + MO1-ambra1a + MO4-tp53 standard conditions Fig. 6 from Benato et al., 2013
trunk decreased size, abnormal WT + MO1-ambra1a + MO4-tp53 standard conditions Fig. 6 from Benato et al., 2013
post-vent region kinked, abnormal WT + MO1-ambra1b + MO4-tp53 standard conditions Fig. 6 from Benato et al., 2013
whole organism deformed, abnormal WT + MO1-ambra1b + MO4-tp53 standard conditions Fig. 6 from Benato et al., 2013
pigmentation delayed, abnormal WT + MO1-ambra1b + MO4-tp53 standard conditions Fig. 6 from Benato et al., 2013
head decreased size, abnormal WT + MO1-ambra1b + MO4-tp53 standard conditions Fig. 6 from Benato et al., 2013
embryo development disrupted, abnormal WT + MO1-ambra1b + MO4-tp53 standard conditions Fig. 6 from Benato et al., 2013
eye decreased size, abnormal WT + MO1-ambra1b + MO4-tp53 standard conditions Fig. 6 from Benato et al., 2013
otolith decreased size, abnormal WT + MO1-ambra1b + MO4-tp53 standard conditions Fig. 6 from Benato et al., 2013
trunk decreased size, abnormal WT + MO1-ambra1b + MO4-tp53 standard conditions Fig. 6 from Benato et al., 2013
integument ionocyte gata3 expression spatial pattern, ameliorated WT + MO1-apcdd1l + MO4-tp53 chemical treatment by environment: dorsomorphin Fig. 4 with image from Vonica et al., 2020
notochord tbxta expression increased distribution, abnormal WT + MO1-apcdd1l + MO4-tp53 standard conditions Fig. 5 with image from Vonica et al., 2020
hematopoietic system gata1a expression spatial pattern, ameliorated WT + MO1-apcdd1l + MO4-tp53 chemical treatment by environment: dorsomorphin Fig. 4 with image from Vonica et al., 2020
whole organism dorsalized, abnormal WT + MO1-apcdd1l + MO4-tp53 standard conditions Fig. 4 with image from Vonica et al., 2020
whole organism ventral region szl expression spatial pattern, ameliorated WT + MO1-apcdd1l + MO4-tp53 chemical treatment by environment: dorsomorphin Fig. 4 with image from Vonica et al., 2020
whole organism ventral region szl expression increased distribution, abnormal WT + MO1-apcdd1l + MO4-tp53 control Fig. 4 with image from Vonica et al., 2020
shield gsc expression increased distribution, abnormal WT + MO1-apcdd1l + MO4-tp53 standard conditions Fig. 4 with image from Vonica et al., 2020
shield dkk1b expression increased distribution, abnormal WT + MO1-apcdd1l + MO4-tp53 standard conditions Fig. 5 with image from Vonica et al., 2020
shield chrd expression increased distribution, abnormal WT + MO1-apcdd1l + MO4-tp53 standard conditions Fig. 5 with image from Vonica et al., 2020
neural plate sox19b expression increased distribution, abnormal WT + MO1-apcdd1l + MO4-tp53 standard conditions Fig. 4 with image from Vonica et al., 2020
integument ionocyte gata3 expression increased distribution, abnormal WT + MO1-apcdd1l + MO4-tp53 standard conditions Fig. 4 with image from Vonica et al., 2020
hematopoietic system gata1a expression increased distribution, abnormal WT + MO1-apcdd1l + MO4-tp53 standard conditions Fig. 4 with image from Vonica et al., 2020
embryonic structure bmp4 expression increased distribution, abnormal WT + MO1-apcdd1l + MO4-tp53 standard conditions Fig. 5 with image from Vonica et al., 2020
whole organism ventro-lateral region ventx expression decreased distribution, abnormal WT + MO1-apcdd1l + MO4-tp53 standard conditions Fig. 5 with image from Vonica et al., 2020
whole organism ventralized, abnormal WT + MO1-apcdd1l + MO4-tp53 standard conditions Fig. 4 with image from Vonica et al., 2020
neuroectoderm otx2b expression increased distribution, abnormal WT + MO1-apcdd1l + MO4-tp53 standard conditions Fig. 5 with image from Vonica et al., 2020
ectoderm tp63 expression decreased distribution, abnormal WT + MO1-apcdd1l + MO4-tp53 standard conditions Fig. 5 with image from Vonica et al., 2020
heart development disrupted, abnormal WT + MO1-apln + MO4-tp53 standard conditions Fig. S4 from Zeng et al., 2007
apoptotic process decreased occurrence, abnormal WT + MO1-apln + MO4-tp53 standard conditions Fig. S4 from Zeng et al., 2007
brain isl1a expression decreased amount, abnormal WT + MO1-arglu1a + MO4-tp53 standard conditions Fig. 5 with image from Magomedova et al., 2019
whole organism decreased life span, abnormal WT + MO1-arglu1a + MO4-tp53 standard conditions text only from Magomedova et al., 2019
brain decreased size, abnormal WT + MO1-arglu1a + MO4-tp53 standard conditions Fig. 5 with image from Magomedova et al., 2019
pericardium edematous, abnormal WT + MO1-arglu1a + MO4-tp53 standard conditions Fig. 5 with image from Magomedova et al., 2019
ventricular system distended, abnormal WT + MO1-arglu1b + MO4-tp53 standard conditions Fig. 5 with image from Magomedova et al., 2019
whole organism decreased life span, abnormal WT + MO1-arglu1b + MO4-tp53 standard conditions text only from Magomedova et al., 2019
whole organism anterior-posterior axis increased curvature, abnormal WT + MO1-arglu1b + MO4-tp53 standard conditions Fig. 5 with image from Magomedova et al., 2019
embryonic heart tube elongation disrupted, abnormal WT + MO1-atp1a1a.1 + MO4-tp53 standard conditions Fig. 5 with image from Langenbacher et al., 2012
embryonic heart tube formation disrupted, abnormal WT + MO1-atp1a1a.1 + MO4-tp53 standard conditions Fig. 5 with image from Langenbacher et al., 2012
somite U-shaped, abnormal WT + MO1-b3galnt2 + MO4-tp53 standard conditions Fig. 5 from Stevens et al., 2013
whole organism decreased mobility, abnormal WT + MO1-b3galnt2 + MO4-tp53 standard conditions Fig. 5 from Stevens et al., 2013
myoseptum partially broken, abnormal WT + MO1-b3galnt2 + MO4-tp53 standard conditions Fig. 5 from Stevens et al., 2013
skeletal muscle cell disorganized, abnormal WT + MO1-b3galnt2 + MO4-tp53 standard conditions Fig. 5 from Stevens et al., 2013
muscle damaged, abnormal WT + MO1-b3galnt2 + MO4-tp53 standard conditions Fig. 5 from Stevens et al., 2013
whole organism curved, abnormal WT + MO1-b3galnt2 + MO4-tp53 standard conditions Fig. 5 from Stevens et al., 2013
brain hydrocephalic, abnormal WT + MO1-b3galnt2 + MO4-tp53 standard conditions Fig. 5 from Stevens et al., 2013
retina degeneration, abnormal WT + MO1-b3galnt2 + MO4-tp53 standard conditions Fig. 5 from Stevens et al., 2013
anterior/posterior axis specification disrupted, abnormal WT + MO1-bcl2l16 + MO4-tp53 standard conditions Fig. 3 from Prudent et al., 2013
mitochondrial calcium ion transmembrane transport disrupted, abnormal WT + MO1-bcl2l16 + MO4-tp53 standard conditions Fig. 6 from Prudent et al., 2013
somite morphology, abnormal WT + MO1-bcl2l16 + MO4-tp53 standard conditions Fig. 3 from Prudent et al., 2013
whole organism anterior-posterior axis shortened, abnormal WT + MO1-bcl2l16 + MO4-tp53 standard conditions Fig. S4 from Prudent et al., 2013
cell migration involved in gastrulation disrupted, abnormal WT + MO1-bcl2l16 + MO4-tp53 standard conditions Fig. 4 from Prudent et al., 2013
pectoral fin morphology, abnormal WT + MO1-bcl2l16 + MO4-tp53 standard conditions Fig. S4 from Prudent et al., 2013
embryo development disrupted, abnormal WT + MO1-bcl2l16 + MO4-tp53 standard conditions Fig. 3 from Prudent et al., 2013
actin polymerization or depolymerization process quality, abnormal WT + MO1-bcl2l16 + MO4-tp53 standard conditions Fig. 5 from Prudent et al., 2013
somite filamentous actin deformed, abnormal WT + MO1-bcl2l16 + MO4-tp53 standard conditions Fig. S4 from Prudent et al., 2013
notochord bent, abnormal WT + MO1-bcl2l16 + MO4-tp53 standard conditions Fig. 3 from Prudent et al., 2013
regulation of cytosolic calcium ion concentration disrupted, abnormal WT + MO1-bcl2l16 + MO4-tp53 standard conditions Fig. 7 from Prudent et al., 2013
mesodermal cell filamentous actin oriented, abnormal WT + MO1-bcl2l16 + MO4-tp53 standard conditions Fig. 5 from Prudent et al., 2013
cell cycle rate, abnormal WT + MO1-c1ql4l + MO4-tp53 standard conditions Fig. 6 with image from Mei et al., 2008
midbrain hindbrain boundary constriction cell increased length, abnormal WT + MO1-calm1a + MO4-tp53 standard conditions Fig. 5 with image from Sahu et al., 2017
midbrain hindbrain boundary ab1-myl-ser19-p labeling decreased amount, abnormal WT + MO1-calm1a + MO4-tp53 standard conditions Fig. 5 with image from Sahu et al., 2017
midbrain hindbrain boundary constriction increased angle to midbrain hindbrain boundary constriction, abnormal WT + MO1-calm1a + MO4-tp53 standard conditions Fig. 5 with image from Sahu et al., 2017
midbrain elongated, abnormal WT + MO1-camk2n2a + MO4-tp53 standard conditions Fig. S2 with image from Hsu et al., 2010
ventricular system decreased size, abnormal WT + MO1-camk2n2a + MO4-tp53 standard conditions Fig. S2 with image from Hsu et al., 2010
optic tectum increased size, abnormal WT + MO1-camk2n2a + MO4-tp53 standard conditions Fig. S2 with image from Hsu et al., 2010
somitogenesis disrupted, abnormal WT + MO1-camk2n2a + MO4-tp53 standard conditions Fig. S2 with image from Hsu et al., 2010
whole organism decreased length, abnormal WT + MO1-camk2n2a + MO4-tp53 standard conditions Fig. S2 with image from Hsu et al., 2010
pericardium edematous, abnormal WT + MO1-camk2n2a + MO4-tp53 standard conditions Fig. S2 with image from Hsu et al., 2010
midbrain hindbrain boundary decreased size, abnormal WT + MO1-camk2n2a + MO4-tp53 standard conditions Fig. S2 with image from Hsu et al., 2010
brain morphogenesis disrupted, abnormal WT + MO1-camk2n2a + MO4-tp53 standard conditions Fig. S2 with image from Hsu et al., 2010
eye decreased size, abnormal WT + MO1-camk2n2b + MO4-tp53 standard conditions Fig. S2 with image from Hsu et al., 2010
head decreased size, abnormal WT + MO1-camk2n2b + MO4-tp53 standard conditions Fig. S2 with image from Hsu et al., 2010
post-vent region kinked, abnormal WT + MO1-camk2n2b + MO4-tp53 standard conditions Fig. S2 with image from Hsu et al., 2010
somite malformed, abnormal WT + MO1-camk2n2b + MO4-tp53 standard conditions Fig. S2 with image from Hsu et al., 2010
brain malformed, abnormal WT + MO1-camk2n2b + MO4-tp53 standard conditions Fig. S2 with image from Hsu et al., 2010
pericardium edematous, abnormal WT + MO1-camk2n2b + MO4-tp53 standard conditions Fig. S2 with image from Hsu et al., 2010
trunk decreased length, abnormal WT + MO1-camk2n2b + MO4-tp53 standard conditions Fig. S2 with image from Hsu et al., 2010
brain morphogenesis disrupted, abnormal WT + MO1-camk2n2b + MO4-tp53 standard conditions Fig. S2 with image from Hsu et al., 2010
eye malformed, abnormal WT + MO1-camk2n2b + MO4-tp53 standard conditions Fig. S2 with image from Hsu et al., 2010
neuromast hair cell decreased amount, abnormal WT + MO1-canx + MO4-tp53 standard conditions Fig. 7 with image from Hung et al., 2013
neuromast decreased amount, abnormal WT + MO1-canx + MO4-tp53 standard conditions Fig. 7 with image from Hung et al., 2013
podocyte development disrupted, abnormal WT + MO1-cd2ap + MO4-tp53 standard conditions Fig. S4 from Yeo et al., 2015
glomerular filtration disrupted, abnormal WT + MO1-cd2ap + MO4-tp53 standard conditions Fig. S4 from Yeo et al., 2015
pronephric glomerular basement membrane increased permeability, abnormal WT + MO1-cd2ap + MO4-tp53 standard conditions Fig. S4 from Yeo et al., 2015
neural plate dorsal region apoptotic, abnormal WT + MO1-cdk10 + MO4-tp53 standard conditions Fig. 5 from Yeh et al., 2013
midbrain hindbrain boundary amorphous, abnormal WT + MO1-cdk10 + MO4-tp53 standard conditions Fig. 4 from Yeh et al., 2013
forebrain apoptotic, abnormal WT + MO1-cdk10 + MO4-tp53 standard conditions Fig. 5 from Yeh et al., 2013
hindbrain neuron decreased amount, abnormal WT + MO1-cdk10 + MO4-tp53 standard conditions Fig. 7 from Yeh et al., 2013
midbrain morphology, abnormal WT + MO1-cdk10 + MO4-tp53 standard conditions Fig. 4 from Yeh et al., 2013
eye decreased size, abnormal WT + MO1-cdk10 + MO4-tp53 standard conditions Fig. 4 from Yeh et al., 2013
hindbrain morphology, abnormal WT + MO1-cdk10 + MO4-tp53 standard conditions Fig. 4 from Yeh et al., 2013
optic tectum neuron decreased amount, abnormal WT + MO1-cdk10 + MO4-tp53 standard conditions Fig. 7 from Yeh et al., 2013
brain decreased size, abnormal WT + MO1-cdk10 + MO4-tp53 standard conditions Fig. 4 from Yeh et al., 2013
neurogenesis disrupted, abnormal WT + MO1-cdk10 + MO4-tp53 standard conditions Fig. 7Fig. 11 from Yeh et al., 2013
somite morphology, abnormal WT + MO1-cdk10 + MO4-tp53 standard conditions Fig. 4 from Yeh et al., 2013
motor neuron axon decreased amount, abnormal WT + MO1-cdk10 + MO4-tp53 standard conditions Fig. 7 from Yeh et al., 2013
neuronal stem cell apoptotic, abnormal WT + MO1-cdk10 + MO4-tp53 standard conditions Fig. 11 from Yeh et al., 2013
Rohon-Beard neuron decreased amount, abnormal WT + MO1-cdk10 + MO4-tp53 standard conditions Fig. 6Fig. 7 from Yeh et al., 2013
brain apoptotic, abnormal WT + MO1-cdk10 + MO4-tp53 standard conditions Fig. 5 from Yeh et al., 2013
midbrain apoptotic, abnormal WT + MO1-cdk10 + MO4-tp53 standard conditions Fig. 5 from Yeh et al., 2013
brain branching morphogenesis of a nerve decreased occurrence, abnormal WT + MO1-cdk10 + MO4-tp53 standard conditions Fig. 7 from Yeh et al., 2013
retina structure, abnormal WT + MO1-cep164 + MO4-tp53 standard conditions Fig. 6 with image from Chaki et al., 2012
brain hydrocephalic, abnormal WT + MO1-cep164 + MO4-tp53 standard conditions Fig. 6 with image from Chaki et al., 2012
apoptotic process increased occurrence, abnormal WT + MO1-cep164 + MO4-tp53 standard conditions Fig. 6 with image from Chaki et al., 2012
pronephric tubule dilated, abnormal WT + MO1-cep164 + MO4-tp53 standard conditions Fig. 6 with image from Chaki et al., 2012
whole organism curved ventral, abnormal WT + MO1-cep164 + MO4-tp53 standard conditions Fig. 6 with image from Chaki et al., 2012
signal transduction in response to DNA damage decreased process quality, abnormal WT + MO1-cep164 + MO4-tp53 standard conditions Fig. 6 with image from Chaki et al., 2012
heart looping disrupted, abnormal WT + MO1-cep164 + MO4-tp53 standard conditions Fig. 6 with image from Chaki et al., 2012
pronephric tubule cystic, abnormal WT + MO1-cep164 + MO4-tp53 standard conditions Fig. 6 with image from Chaki et al., 2012
post-vent region apoptotic, abnormal WT + MO1-chrd + MO4-tp53 standard conditions Fig. 5 with image from Robu et al., 2007
whole organism wholly ventralized, abnormal WT + MO1-chrd + MO4-tp53 standard conditions Fig. S6 with image from Moreno-Ayala et al., 2015
Fig. 8 with image from Branam et al., 2010
dorsal/ventral pattern formation disrupted, abnormal WT + MO1-chrd + MO4-tp53 standard conditions Fig. 8 with image from Branam et al., 2010
post-vent region bent, abnormal WT + MO1-chrd + MO4-tp53 standard conditions Fig. 8 with image from Branam et al., 2010
convergent extension involved in axis elongation disrupted, abnormal WT + MO1-dcn + MO4-tp53 standard conditions Fig. 5 from Zoeller et al., 2009
trunk decreased length, abnormal WT + MO1-dcn + MO4-tp53 standard conditions Fig. 5 from Zoeller et al., 2009
post-vent region decreased length, abnormal WT + MO1-dcn + MO4-tp53 standard conditions Fig. 5 from Zoeller et al., 2009
pretectum dopaminergic neuron decreased amount, abnormal WT + MO1-ddb1 + MO4-tp53 control Fig. S3 with imageTable 1 from Hu et al., 2015
retina dopaminergic neuron decreased amount, abnormal WT + MO1-ddb1 + MO4-tp53 control Fig. S3 with imageTable 1 from Hu et al., 2015
retina decreased size, abnormal WT + MO1-ddb1 + MO4-tp53 control Table 1 from Hu et al., 2015
brain decreased size, abnormal WT + MO1-ddb1 + MO4-tp53 control Table 1 from Hu et al., 2015
caudal fin deformed, abnormal WT + MO1-dennd5b + MO4-tp53 standard conditions Fig. 3 with image from Mendoza et al., 2025
head decreased size, abnormal WT + MO1-dennd5b + MO4-tp53 standard conditions Fig. 3 with image from Mendoza et al., 2025
whole organism curved, abnormal WT + MO1-dennd5b + MO4-tp53 standard conditions Fig. 3 with image from Mendoza et al., 2025
oligodendrocyte cell fate specification disrupted, abnormal WT + MO1-disc1 + MO4-tp53 standard conditions Fig. 5 from Wood et al., 2009
hindbrain oligodendrocyte decreased amount, abnormal WT + MO1-disc1 + MO4-tp53 standard conditions Fig. 5 from Wood et al., 2009
primordial germ cell cell motility decreased occurrence, abnormal WT + MO1-dnd1 + MO4-tp53 standard conditions Fig. 4 with image from Goudarzi et al., 2012
intestine well differentiated, abnormal WT + MO1-dot1l + MO4-tp53 standard conditions Fig. 8 with image from Mahmoudi et al., 2010
canonical Wnt signaling pathway decreased process quality, abnormal WT + MO1-dot1l + MO4-tp53 standard conditions Fig. 9 with image from Mahmoudi et al., 2010
intestinal villus decreased length, abnormal WT + MO1-dot1l + MO4-tp53 standard conditions Fig. 9 with image from Mahmoudi et al., 2010
intestinal epithelial structure maintenance decreased process quality, abnormal WT + MO1-dot1l + MO4-tp53 standard conditions Fig. 9 with image from Mahmoudi et al., 2010
intestinal epithelium has fewer parts of type epithelial cell, abnormal WT + MO1-dot1l + MO4-tp53 standard conditions Fig. 9 with image from Mahmoudi et al., 2010
oligodendrocyte cell division decreased process quality, abnormal WT + MO1-dync1h1 + MO4-tp53 standard conditions Fig. 3 with image from Yang et al., 2015
pigmentation process quality, abnormal WT + MO1-dync1h1 + MO4-tp53 standard conditions Fig. 2 with image from Yang et al., 2015
eye decreased size, abnormal WT + MO1-dync1h1 + MO4-tp53 standard conditions Fig. 2 with image from Yang et al., 2015
brain decreased size, abnormal WT + MO1-dync1h1 + MO4-tp53 standard conditions Fig. 2 with image from Yang et al., 2015
swim bladder absent, abnormal WT + MO1-dync1h1 + MO4-tp53 standard conditions Fig. 2 with image from Yang et al., 2015
oligodendrocyte cell migration decreased process quality, abnormal WT + MO1-dync1h1 + MO4-tp53 standard conditions Fig. 3 with image from Yang et al., 2015
pronephros cystic, abnormal WT + MO1-dynlt2b + MO4-tp53 standard conditions Fig. 3 with image from Schmidts et al., 2015
trunk curved ventral, abnormal WT + MO1-dynlt2b + MO4-tp53 standard conditions Fig. 3 with image from Schmidts et al., 2015
pronephric duct cilium decreased length, abnormal WT + MO1-dynlt2b + MO4-tp53 standard conditions Fig. 3 with image from Schmidts et al., 2015
embryonic cranial skeleton morphogenesis disrupted, abnormal WT + MO1-dynlt2b + MO4-tp53 standard conditions Fig. 3 with image from Schmidts et al., 2015
otolith morphology, abnormal WT + MO1-dynlt2b + MO4-tp53 standard conditions Fig. 3 with image from Schmidts et al., 2015
eye decreased size, abnormal WT + MO1-dynlt2b + MO4-tp53 standard conditions Fig. 3 with image from Schmidts et al., 2015
whole organism edematous, abnormal WT + MO1-dynlt2b + MO4-tp53 standard conditions Fig. 3 with image from Schmidts et al., 2015
Meckel's cartilage fused with palatoquadrate cartilage, abnormal WT + MO1-ece1 + MO4-tp53 standard conditions Fig. 2 from Iklé et al., 2017
ceratobranchial cartilage decreased amount, abnormal WT + MO1-ece1 + MO4-tp53 standard conditions Fig. 2 from Iklé et al., 2017
Meckel's cartilage curved ventral, abnormal WT + MO1-ece1 + MO4-tp53 standard conditions Fig. 2 from Iklé et al., 2017
palatoquadrate cartilage hypoplastic, abnormal WT + MO1-ece1 + MO4-tp53 standard conditions Fig. 2 from Iklé et al., 2017
basihyal cartilage decreased size, abnormal WT + MO1-ece1 + MO4-tp53 standard conditions Fig. 2 from Iklé et al., 2017
ceratohyal cartilage fused with hyosymplectic cartilage, abnormal WT + MO1-ece1 + MO4-tp53 standard conditions Fig. 2 from Iklé et al., 2017
pharyngeal arch 1 dlx5a expression decreased distribution, abnormal WT + MO1-ece1 + MO4-tp53 standard conditions Fig. 2 from Iklé et al., 2017
ceratohyal cartilage decreased size, abnormal WT + MO1-ece1 + MO4-tp53 standard conditions Fig. 2 from Iklé et al., 2017
Meckel's cartilage fused with Meckel's cartilage, abnormal WT + MO1-ece1 + MO4-tp53 standard conditions Fig. 2 from Iklé et al., 2017
basihyal cartilage curved ventral, abnormal WT + MO1-ece1 + MO4-tp53 standard conditions Fig. 2 from Iklé et al., 2017
ceratohyal cartilage curved ventral, abnormal WT + MO1-ece1 + MO4-tp53 standard conditions Fig. 2 from Iklé et al., 2017
hyosymplectic cartilage hypoplastic, abnormal WT + MO1-ece1 + MO4-tp53 standard conditions Fig. 2 from Iklé et al., 2017
pharyngeal arch 2 dlx5a expression decreased distribution, abnormal WT + MO1-ece1 + MO4-tp53 standard conditions Fig. 2 from Iklé et al., 2017
Meckel's cartilage fused with palatoquadrate cartilage, abnormal WT + MO1-edn1 + MO4-tp53 standard conditions Fig. 2 from Iklé et al., 2017
ceratobranchial 2 cartilage absent, abnormal WT + MO1-edn1 + MO4-tp53 standard conditions Fig. 2 from Iklé et al., 2017
Meckel's cartilage curved ventral, abnormal WT + MO1-edn1 + MO4-tp53 standard conditions Fig. 2 from Iklé et al., 2017
Meckel's cartilage hypoplastic, abnormal WT + MO1-edn1 + MO4-tp53 standard conditions Fig. 2 from Iklé et al., 2017
pharyngeal arch 2 dlx5a expression absent, abnormal WT + MO1-edn1 + MO4-tp53 standard conditions Fig. 2 from Iklé et al., 2017
ceratobranchial 4 cartilage absent, abnormal WT + MO1-edn1 + MO4-tp53 standard conditions Fig. 2 from Iklé et al., 2017
ceratobranchial 3 cartilage absent, abnormal WT + MO1-edn1 + MO4-tp53 standard conditions Fig. 2 from Iklé et al., 2017
pharyngeal arch 1 dlx5a expression absent, abnormal WT + MO1-edn1 + MO4-tp53 standard conditions Fig. 2 from Iklé et al., 2017
ceratobranchial 1 cartilage absent, abnormal WT + MO1-edn1 + MO4-tp53 standard conditions Fig. 2 from Iklé et al., 2017
ceratohyal cartilage curved ventral, abnormal WT + MO1-edn1 + MO4-tp53 standard conditions Fig. 2 from Iklé et al., 2017
ceratohyal cartilage hypoplastic, abnormal WT + MO1-edn1 + MO4-tp53 standard conditions Fig. 2 from Iklé et al., 2017
dorsal telencephalon morphology, abnormal WT + MO1-emx1 + MO2-emx1 + MO4-tp53 standard conditions Fig. 3 with imagetext only from Viktorin et al., 2009
dorsal telencephalon morphology, abnormal WT + MO1-emx3 + MO4-emx3 + MO4-tp53 standard conditions Fig. 3 with image from Viktorin et al., 2009
brain apoptotic, abnormal WT + MO1-epas1b + MO4-tp53 standard conditions Fig. 1 from Ko et al., 2011
regulation of neuron apoptotic process disrupted, abnormal WT + MO1-epas1b + MO4-tp53 standard conditions Fig. 1 from Ko et al., 2011
neuron apoptotic process increased occurrence, abnormal WT + MO1-epas1b + MO4-tp53 standard conditions Fig. 1 from Ko et al., 2011
rhombomere 2 egr2b expression mislocalised, abnormal WT + MO1-epha4a + MO4-tp53 standard conditions Fig. 6 with image from Addison et al., 2018
rhombomere 6 egr2b expression mislocalised, abnormal WT + MO1-epha4a + MO4-tp53 standard conditions Fig. 6 with image from Addison et al., 2018
rhombomere 4 egr2b expression mislocalised, abnormal WT + MO1-epha4a + MO4-tp53 standard conditions Fig. 6 with image from Addison et al., 2018
thymus rag1 expression decreased amount, abnormal WT + MO1-eps15l1b + MO4-tp53 standard conditions Fig. 6 with image from Seiler et al., 2015
T cell differentiation in thymus disrupted, abnormal WT + MO1-eps15l1b + MO4-tp53 standard conditions Fig. 6 with image from Seiler et al., 2015
neuromast decreased amount, abnormal WT + MO1-esr2a + MO4-tp53 standard conditions Fig. 4 with image from Froehlicher et al., 2009
trunk posterior region decreased length, abnormal WT + MO1-fam53b + MO4-tp53 standard conditions Fig. 1 with image from Kizil et al., 2014
post-vent region curled, abnormal WT + MO1-fbxo7 + MO4-tp53 standard conditions Fig. 6 with image from Zhao et al., 2012
heart malformed, abnormal WT + MO1-fbxo7 + MO4-tp53 standard conditions Fig. 6 with image from Zhao et al., 2012
heart edematous, abnormal WT + MO1-fbxo7 + MO4-tp53 standard conditions Fig. 6 with image from Zhao et al., 2012
heart edematous, abnormal WT + MO1-fer + MO4-tp53 standard conditions Fig. 3 with image from Paardekooper Overman et al., 2014
whole organism decreased length, abnormal WT + MO1-fer + MO4-tp53 standard conditions Fig. 3 with image from Paardekooper Overman et al., 2014
cranium malformed, abnormal WT + MO1-fer + MO4-tp53 standard conditions Fig. 3 with image from Paardekooper Overman et al., 2014
forebrain development disrupted, abnormal WT + MO1-fgf22 + MO4-tp53 standard conditions Fig. 2 with image from Miyake et al., 2013
midbrain-hindbrain boundary development disrupted, abnormal WT + MO1-fgf22 + MO4-tp53 standard conditions Fig. 2 with image from Miyake et al., 2013
midbrain development disrupted, abnormal WT + MO1-fgf22 + MO4-tp53 standard conditions Fig. 2 with image from Miyake et al., 2013
forebrain morphology, abnormal WT + MO1-fgf22 + MO4-tp53 standard conditions Fig. 2 with image from Miyake et al., 2013
midbrain morphology, abnormal WT + MO1-fgf22 + MO4-tp53 standard conditions Fig. 2 with image from Miyake et al., 2013
midbrain hindbrain boundary morphology, abnormal WT + MO1-fgf22 + MO4-tp53 standard conditions Fig. 2 with image from Miyake et al., 2013
trunk decreased length, abnormal WT + MO1-fhl1a + MO2-fhl1a + MO4-tp53 standard conditions Fig. 2 from Xie et al., 2013
whole organism curved, abnormal WT + MO1-fhl1a + MO2-fhl1a + MO4-tp53 standard conditions Fig. 2 from Xie et al., 2013
pigmentation decreased process quality, abnormal WT + MO1-fhl1a + MO2-fhl1a + MO4-tp53 standard conditions Fig. 2 from Xie et al., 2013
muscle pioneer increased amount, abnormal WT + MO1-gdf6a + MO4-tp53 standard conditions Fig. 7 with image from Nguyen-Chi et al., 2012
retina morphology, abnormal WT + MO1-gdf6a + MO4-tp53 standard conditions Fig. 7 with image from French et al., 2007
brain apoptotic process occurrence, ameliorated WT + MO1-glra4a + MO4-tp53 control Fig. 1 with image from Bekri et al., 2018
spinal cord apoptotic process occurrence, ameliorated WT + MO1-glra4a + MO4-tp53 control Fig. 1 with image from Bekri et al., 2018
heart edematous, abnormal WT + MO1-golgb1 + MO4-tp53 standard conditions Fig. 1 with image from Bergen et al., 2017
eye decreased size, abnormal WT + MO1-golgb1 + MO4-tp53 standard conditions Fig. 1 with image from Bergen et al., 2017
post-vent region kinked, abnormal WT + MO1-golgb1 + MO4-tp53 standard conditions Fig. 1 with image from Bergen et al., 2017
brain edematous, abnormal WT + MO1-golgb1 + MO4-tp53 standard conditions Fig. 1 with image from Bergen et al., 2017
cell population proliferation decreased occurrence, abnormal WT + MO1-gper1 + MO4-tp53 standard conditions Fig. 3 from Shi et al., 2013
apoptotic process increased occurrence, abnormal WT + MO1-gper1 + MO4-tp53 standard conditions Fig. 3 from Shi et al., 2013
determination of left/right asymmetry in lateral mesoderm process quality, abnormal WT + MO1-gpr22a + MO4-tp53 standard conditions Fig. 2 with imageFig. 3 with image from Verleyen et al., 2014
Kupffer's vesicle cilium disorganized, abnormal WT + MO1-gpr22a + MO4-tp53 standard conditions Fig. 5 with image from Verleyen et al., 2014
determination of digestive tract left/right asymmetry process quality, abnormal WT + MO1-gpr22a + MO4-tp53 standard conditions Fig. 2 with image from Verleyen et al., 2014
Kupffer's vesicle cilium decreased length, abnormal WT + MO1-gpr22a + MO4-tp53 standard conditions Fig. 5 with image from Verleyen et al., 2014
whole organism decreased length, abnormal WT + MO1-gpr22a + MO4-tp53 standard conditions Fig. 1 with image from Verleyen et al., 2014
determination of liver left/right asymmetry process quality, abnormal WT + MO1-gpr22a + MO4-tp53 standard conditions Fig. 2 with image from Verleyen et al., 2014
inner ear has extra parts of type otolith, abnormal WT + MO1-gpr22a + MO4-tp53 standard conditions Fig. S6 with image from Verleyen et al., 2014
Kupffer's vesicle cilium has fewer parts of type Kupffer's vesicle axonemal microtubule, abnormal WT + MO1-gpr22a + MO4-tp53 standard conditions Fig. 5 with image from Verleyen et al., 2014
otolith fused with otolith, abnormal WT + MO1-gpr22a + MO4-tp53 standard conditions Fig. S6 with image from Verleyen et al., 2014
caudal fin curved ventral, abnormal WT + MO1-gpr22a + MO4-tp53 standard conditions Fig. 1 with image from Verleyen et al., 2014
heart edematous, abnormal WT + MO1-gpr22a + MO4-tp53 standard conditions Fig. 1 with image from Verleyen et al., 2014
left/right axis specification process quality, abnormal WT + MO1-gpr22a + MO4-tp53 standard conditions Fig. 2 with image from Verleyen et al., 2014
ethmoid cartilage absent, abnormal WT + MO1-gria2a + MO4-tp53 standard conditions Fig. 7 with image from Li et al., 2014
posterior lateral line neuromast decreased amount, abnormal WT + MO1-gria2a + MO4-tp53 standard conditions Fig. 6 with image from Li et al., 2014
cranial cartilage malformed, abnormal WT + MO1-gria2a + MO4-tp53 standard conditions Fig. 7 with image from Li et al., 2014
parachordal cartilage decreased size, abnormal WT + MO1-gria2a + MO4-tp53 standard conditions Fig. 7 with image from Li et al., 2014
pharyngeal arch absent, abnormal WT + MO1-gria2a + MO4-tp53 standard conditions Fig. 7 with image from Li et al., 2014
anterior lateral line neuromast decreased amount, abnormal WT + MO1-gria2a + MO4-tp53 standard conditions Fig. 6 with image from Li et al., 2014
neurocranial trabecula decreased size, abnormal WT + MO1-gria2a + MO4-tp53 standard conditions Fig. 7 with image from Li et al., 2014
whole organism morphology, abnormal WT + MO1-h2af1al + MO4-tp53 standard conditions Fig. 7 from Yue et al., 2013
embryonic morphogenesis arrested, abnormal WT + MO1-h2af1al + MO4-tp53 standard conditions Fig. 7 from Yue et al., 2013
hatching arrested, abnormal WT + MO1-h2af1al + MO4-tp53 standard conditions Fig. 7 from Yue et al., 2013
whole organism monstrous, abnormal WT + MO1-h2af1al + MO4-tp53 standard conditions Fig. 7 from Yue et al., 2013
Meckel's cartilage shortened, abnormal WT + MO1-hcfc1b + MO4-tp53 standard conditions Fig. 2 with image from Quintana et al., 2014
ceratohyal cartilage malformed, abnormal WT + MO1-hcfc1b + MO4-tp53 standard conditions Fig. 2 with imageFig. 7 with imageFig. 9 with image from Quintana et al., 2014
Meckel's cartilage malformed, abnormal WT + MO1-hcfc1b + MO4-tp53 standard conditions Fig. 2 with imageFig. 7 with imageFig. 9 with image from Quintana et al., 2014
ceratobranchial cartilage absent, abnormal WT + MO1-hcfc1b + MO4-tp53 standard conditions Fig. 2 with imageFig. 4 with imageFig. 7 with imageFig. 9 with image from Quintana et al., 2014
splanchnocranium malformed, abnormal WT + MO1-hcfc1b + MO4-tp53 standard conditions Fig. 7 with imageFig. 9 with image from Quintana et al., 2014
ceratohyal cartilage inverted, abnormal WT + MO1-hcfc1b + MO4-tp53 standard conditions Fig. 2 with image from Quintana et al., 2014
heart deformed, abnormal WT + MO1-hsbp1b + MO4-tp53 standard conditions Table S3 with image from Eroglu et al., 2014
whole organism decreased length, abnormal WT + MO1-hsbp1b + MO4-tp53 standard conditions Fig. S7 with image from Eroglu et al., 2014
head deformed, abnormal WT + MO1-hsbp1b + MO4-tp53 standard conditions Fig. S7 with imageTable S3 with image from Eroglu et al., 2014
embryo development disrupted, abnormal WT + MO1-hsbp1b + MO4-tp53 standard conditions Fig. S7 with image from Eroglu et al., 2014
whole organism anterior-posterior axis increased curvature, abnormal WT + MO1-hsbp1b + MO4-tp53 standard conditions Fig. S7 with imageTable S3 with image from Eroglu et al., 2014
yolk increased size, abnormal WT + MO1-hsbp1b + MO4-tp53 standard conditions Table S3 with image from Eroglu et al., 2014
trunk kinked, abnormal WT + MO1-hspg2 + MO4-tp53 standard conditions Fig. S2 from Zoeller et al., 2008
post-vent region curved dorsal, abnormal WT + MO1-hspg2 + MO4-tp53 standard conditions Fig. S2 from Zoeller et al., 2008
determination of intestine left/right asymmetry process quality, abnormal WT + MO1-ikzf5 + MO4-tp53 standard conditions Fig. 2 with image from John et al., 2013
determination of intestine left/right asymmetry decreased process quality, abnormal WT + MO1-ikzf5 + MO4-tp53 standard conditions Fig. 2 with image from John et al., 2013
growth decreased process quality, abnormal WT + MO1-itcha + MO2-itcha + MO4-tp53 standard conditions Fig. 3 with image from Angers et al., 2014
whole organism decreased length, abnormal WT + MO1-itcha + MO2-itcha + MO4-tp53 standard conditions Fig. 3 with image from Angers et al., 2014
brain hemorrhagic, abnormal WT + MO1-itgb8 + MO4-tp53 control Fig. 4 with image from Hirota et al., 2015
brain vasculature broken, abnormal WT + MO1-itgb8 + MO4-tp53 control Fig. 4 with image from Hirota et al., 2015
brain vasculature development process quality, abnormal WT + MO1-itgb8 + MO4-tp53 control Fig. 4 with image from Hirota et al., 2015
heart edematous, abnormal WT + MO1-kif14 + MO4-tp53 standard conditions Fig. S5 from Reilly et al., 2018
whole organism increased curvature, abnormal WT + MO1-kif14 + MO4-tp53 standard conditions Fig. S5 from Reilly et al., 2018
heart decreased functionality, abnormal WT + MO1-kif20a + MO4-tp53 standard conditions text only from Louw et al., 2018
pericardium edematous, abnormal WT + MO1-kif20a + MO4-tp53 standard conditions text only from Louw et al., 2018
ionocyte decreased amount, abnormal WT + MO1-klf4 + MO2-klf4 + MO4-tp53 standard conditions Fig. S13 from Chen et al., 2019
ectoderm cell population proliferation occurrence, ameliorated WT + MO1-klf4 + MO2-klf4 + MO4-tp53 standard conditions Fig 5 with image from Chen et al., 2019
retina adherens junction distributed, abnormal WT + MO1-llgl1 + MO4-tp53 standard conditions Fig. 3 with imageFig. S3 with image from Clark et al., 2012
retinal neural layer structure, abnormal WT + MO1-llgl1 + MO4-tp53 standard conditions Fig. 1 with image from Clark et al., 2012
retina adherens junction increased size, abnormal WT + MO1-llgl1 + MO4-tp53 standard conditions Fig. 3 with imageFig. S3 with image from Clark et al., 2012
retinal neural layer apical region increased area, abnormal WT + MO1-llgl1 + MO4-tp53 standard conditions Fig. 4 with image from Clark et al., 2012
heart decreased object quality, abnormal WT + MO1-llgl1 + MO4-tp53 standard conditions Fig. S1 with image from Clark et al., 2012
cell population proliferation increased occurrence, abnormal WT + MO1-llgl1 + MO4-tp53 standard conditions Fig. 2 with image from Clark et al., 2012
eye decreased size, abnormal WT + MO1-llgl1 + MO4-tp53 standard conditions Fig. S1 with image from Clark et al., 2012
retinal neural layer cell aggregated, abnormal WT + MO1-llgl1 + MO4-tp53 standard conditions Fig. 1 with image from Clark et al., 2012
retina cell disorganized, abnormal WT + MO1-llgl1 + MO4-tp53 standard conditions Fig. S1 with image from Clark et al., 2012
retina layer formation delayed, abnormal WT + MO1-llgl1 + MO4-tp53 standard conditions Fig. 1 with image from Clark et al., 2012
brain decreased size, abnormal WT + MO1-llgl1 + MO4-tp53 standard conditions Fig. S1 with image from Clark et al., 2012
exit from mitosis decreased occurrence, abnormal WT + MO1-llgl1 + MO4-tp53 standard conditions Fig. 2 with image from Clark et al., 2012
chondrocyte differentiation decreased occurrence, abnormal WT + MO1-loxl3b + MO4-tp53 standard conditions Fig. 6 from van Boxtel et al., 2011
pharyngeal arch cartilage malformed, abnormal WT + MO1-loxl3b + MO4-tp53 standard conditions Fig. 3 from van Boxtel et al., 2011
embryonic viscerocranium morphogenesis decreased process quality, abnormal WT + MO1-loxl3b + MO4-tp53 standard conditions Fig. 3Fig. 6 from van Boxtel et al., 2011
cartilage condensation decreased occurrence, abnormal WT + MO1-loxl3b + MO4-tp53 standard conditions Fig. 6 from van Boxtel et al., 2011
eye apoptotic process increased occurrence, abnormal WT + MO1-ly6pge + MO4-tp53 standard conditions Fig. 5 with image from Ji et al., 2017
brain apoptotic process increased occurrence, abnormal WT + MO1-ly6pge + MO4-tp53 standard conditions Fig. 5 with image from Ji et al., 2017
eye decreased size, abnormal WT + MO1-ly6pge + MO4-tp53 standard conditions Fig. 5 with image from Ji et al., 2017
enteric neuron decreased amount, abnormal WT + MO1-mab21l2 + MO4-tp53 standard conditions text only from Sribudiani et al., 2018
enteric smooth muscle cell differentiation process quality, abnormal WT + MO1-mab21l2 + MO4-tp53 standard conditions text only from Sribudiani et al., 2018
pharynx development process quality, abnormal WT + MO1-mab21l2 + MO4-tp53 standard conditions text only from Sribudiani et al., 2018
brain development disrupted, abnormal WT + MO1-marcksa + MO4-tp53 standard conditions Fig. 6 from Ott et al., 2011
brain morphology, abnormal WT + MO1-marcksa + MO4-tp53 standard conditions Fig. 6 from Ott et al., 2011
post-vent region curved, abnormal WT + MO1-marcksa + MO4-tp53 standard conditions Fig. 6 from Ott et al., 2011
eye morphology, abnormal WT + MO1-marcksa + MO4-tp53 standard conditions Fig. 6 from Ott et al., 2011
eye morphology, abnormal WT + MO1-marcksb + MO4-tp53 standard conditions Fig. 6 from Ott et al., 2011
brain development disrupted, abnormal WT + MO1-marcksb + MO4-tp53 standard conditions Fig. 6 from Ott et al., 2011
post-vent region curved, abnormal WT + MO1-marcksb + MO4-tp53 standard conditions Fig. 6 from Ott et al., 2011
brain morphology, abnormal WT + MO1-marcksb + MO4-tp53 standard conditions Fig. 6 from Ott et al., 2011
whole organism klf9 expression decreased amount, abnormal WT + MO1-med17 + MO4-tp53 control Fig. 2 with image from Arkush et al., 2025
whole organism s100b expression decreased amount, abnormal WT + MO1-med17 + MO4-tp53 control Fig. 2 with image from Arkush et al., 2025
whole organism aldocb expression decreased amount, abnormal WT + MO1-med17 + MO4-tp53 control Fig. 2 with image from Arkush et al., 2025
whole organism pvalb7 expression decreased amount, abnormal WT + MO1-med17 + MO4-tp53 control Fig. 2 with image from Arkush et al., 2025
Purkinje cell pvalb7 expression decreased distribution, abnormal WT + MO1-med17 + MO4-tp53 control Fig. 2 with image from Arkush et al., 2025
whole organism klf8 expression decreased amount, abnormal WT + MO1-med17 + MO4-tp53 control Fig. 2 with image from Arkush et al., 2025
whole organism klf9 expression decreased amount, abnormal WT + MO1-med29 + MO4-tp53 control Fig. 2 with image from Arkush et al., 2025
whole organism s100b expression decreased amount, abnormal WT + MO1-med29 + MO4-tp53 control Fig. 2 with image from Arkush et al., 2025
whole organism aldocb expression decreased amount, abnormal WT + MO1-med29 + MO4-tp53 control Fig. 2 with image from Arkush et al., 2025
whole organism pvalb7 expression decreased amount, abnormal WT + MO1-med29 + MO4-tp53 control Fig. 2 with image from Arkush et al., 2025
Purkinje cell pvalb7 expression decreased distribution, abnormal WT + MO1-med29 + MO4-tp53 control Fig. 2 with image from Arkush et al., 2025
whole organism klf8 expression decreased amount, abnormal WT + MO1-med29 + MO4-tp53 control Fig. 2 with image from Arkush et al., 2025
paraxial mesoderm mespba expression increased distribution, abnormal WT + MO1-mespbb + MO4-tp53 control Fig. 4 with image from Windner et al., 2015
paraxial mesoderm mespba expression increased amount, abnormal WT + MO1-mespbb + MO4-tp53 control Fig. 4 with image from Windner et al., 2015
melanocyte absent, abnormal WT + MO1-mitfa + MO4-tp53 standard conditions Fig. 5 with image from Robu et al., 2007
ceratohyal cartilage malformed, abnormal WT + MO1-mkxa + MO4-tp53 standard conditions Fig. 8 with image from Chuang et al., 2010
ventricular system malformed, abnormal WT + MO1-mkxa + MO4-tp53 standard conditions Fig. 5 with image from Chuang et al., 2010
embryonic viscerocranium morphogenesis process quality, abnormal WT + MO1-mkxa + MO4-tp53 standard conditions Fig. 6 with imageFig. 8 with image from Chuang et al., 2010
Meckel's cartilage decreased size, abnormal WT + MO1-mkxa + MO4-tp53 standard conditions Fig. 8 with image from Chuang et al., 2010
brain morphogenesis process quality, abnormal WT + MO1-mkxa + MO4-tp53 standard conditions Fig. 5 with image from Chuang et al., 2010
brain malformed, abnormal WT + MO1-mkxa + MO4-tp53 standard conditions Fig. 5 with image from Chuang et al., 2010
pharyngeal pouch disorganized, abnormal WT + MO1-mkxa + MO4-tp53 standard conditions Fig. 6 with image from Chuang et al., 2010
cephalic musculature decreased amount, abnormal WT + MO1-mkxa + MO4-tp53 standard conditions Fig. 9 with image from Chuang et al., 2010
skeletal muscle cell irregular spatial pattern, abnormal WT + MO1-mkxa + MO4-tp53 standard conditions Fig. 11 from Chuang et al., 2014
extraocular musculature decreased amount, abnormal WT + MO1-mkxa + MO4-tp53 standard conditions Fig. 6 with image from Chuang et al., 2010
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-mkxa + MO4-tp53 standard conditions Fig. 11 from Chuang et al., 2014
neural crest physical object quality, abnormal WT + MO1-mkxa + MO4-tp53 standard conditions Fig. 7 with image from Chuang et al., 2010
ceratobranchial cartilage decreased amount, abnormal WT + MO1-mkxa + MO4-tp53 standard conditions Fig. 8 with image from Chuang et al., 2010
ceratobranchial cartilage malformed, abnormal WT + MO1-mkxa + MO4-tp53 standard conditions Fig. 8 with image from Chuang et al., 2010
whole organism curved, abnormal WT + MO1-mkxa + MO4-tp53 standard conditions Fig. 11 from Chuang et al., 2014
pharyngeal musculature decreased amount, abnormal WT + MO1-mkxa + MO4-tp53 standard conditions Fig. 6 with image from Chuang et al., 2010
palatoquadrate cartilage decreased size, abnormal WT + MO1-mkxa + MO4-tp53 standard conditions Fig. 8 with image from Chuang et al., 2010
pharyngeal arch cartilage physical object quality, abnormal WT + MO1-mkxa + MO4-tp53 standard conditions Fig. 6 with image from Chuang et al., 2010
canonical Wnt signaling pathway decreased process quality, abnormal WT + MO1-mllt10 + MO4-tp53 standard conditions Fig. 9 with image from Mahmoudi et al., 2010
intestinal epithelium has fewer parts of type epithelial cell, abnormal WT + MO1-mllt10 + MO4-tp53 standard conditions Fig. 9 with image from Mahmoudi et al., 2010
intestinal villus decreased length, abnormal WT + MO1-mllt10 + MO4-tp53 standard conditions Fig. 9 with image from Mahmoudi et al., 2010
intestine well differentiated, abnormal WT + MO1-mllt10 + MO4-tp53 standard conditions Fig. 8 with image from Mahmoudi et al., 2010
intestinal epithelial structure maintenance decreased process quality, abnormal WT + MO1-mllt10 + MO4-tp53 standard conditions Fig. 9 with image from Mahmoudi et al., 2010
ceratobranchial cartilage absent, abnormal WT + MO1-mmachc + MO4-tp53 standard conditions Fig. 7 with image from Quintana et al., 2014
Meckel's cartilage malformed, abnormal WT + MO1-mmachc + MO4-tp53 standard conditions Fig. 7 with image from Quintana et al., 2014
splanchnocranium malformed, abnormal WT + MO1-mmachc + MO4-tp53 standard conditions Fig. 7 with image from Quintana et al., 2014
ceratohyal cartilage malformed, abnormal WT + MO1-mmachc + MO4-tp53 standard conditions Fig. 7 with image from Quintana et al., 2014
apoptotic process increased occurrence, abnormal WT + MO1-mob1a + MO4-tp53 standard conditions Fig. S3 with image from Yuan et al., 2009
embryo development delayed, abnormal WT + MO1-mob1a + MO4-tp53 standard conditions Fig. S3 with image from Yuan et al., 2009
head decreased size, abnormal WT + MO1-mpzl1l + MO4-tp53 standard conditions Fig. 4 from Paardekooper Overman et al., 2014
heart edematous, abnormal WT + MO1-mpzl1l + MO4-tp53 standard conditions Fig. 4 from Paardekooper Overman et al., 2014
whole organism degenerate, abnormal WT + MO1-msi2b + MO4-tp53 standard conditions Fig. 7 from Hochgreb-Hägele et al., 2014
fourth ventricle edematous, abnormal WT + MO1-msi2b + MO4-tp53 standard conditions Fig. 7 from Hochgreb-Hägele et al., 2014
eye atrophied, abnormal WT + MO1-msi2b + MO4-tp53 standard conditions Fig. 7 from Hochgreb-Hägele et al., 2014
eye aplastic, abnormal WT + MO1-msi2b + MO4-tp53 standard conditions Fig. 7 from Hochgreb-Hägele et al., 2014
caudal fin atrophied, abnormal WT + MO1-msi2b + MO4-tp53 standard conditions Fig. 7 from Hochgreb-Hägele et al., 2014
whole organism axis shortened, abnormal WT + MO1-msi2b + MO4-tp53 standard conditions Fig. 7 from Hochgreb-Hägele et al., 2014
heart edematous, abnormal WT + MO1-msi2b + MO4-tp53 standard conditions Fig. 7 from Hochgreb-Hägele et al., 2014
ceratohyal cartilage angle palatoquadrate cartilage, abnormal WT + MO1-myt1a + MO4-tp53 standard conditions Fig. 2 from Lopez et al., 2016
ceratohyal cartilage increased angle to ceratohyal cartilage, abnormal WT + MO1-myt1a + MO4-tp53 standard conditions Fig. S2 from Lopez et al., 2016
ceratohyal cartilage flattened, abnormal WT + MO1-myt1a + MO4-tp53 standard conditions Fig. 2 from Lopez et al., 2016
ceratohyal cartilage decreased distance Meckel's cartilage, abnormal WT + MO1-myt1a + MO4-tp53 standard conditions Fig. S2 from Lopez et al., 2016
head decreased length, abnormal WT + MO1-myt1a + MO4-tp53 standard conditions Fig. S2 from Lopez et al., 2016
ceratohyal cartilage increased angle to palatoquadrate cartilage, abnormal WT + MO1-myt1a + MO4-tp53 standard conditions Fig. S2 from Lopez et al., 2016
ceratohyal cartilage angle ceratohyal cartilage, abnormal WT + MO1-myt1a + MO4-tp53 standard conditions Fig. 2 from Lopez et al., 2016
ceratohyal cartilage distance Meckel's cartilage, abnormal WT + MO1-myt1a + MO4-tp53 standard conditions Fig. 2 from Lopez et al., 2016
whole organism decreased pigmentation, abnormal WT + MO1-naa10 + MO4-tp53 standard conditions Fig. S1 from Ree et al., 2015
eye morphology, abnormal WT + MO1-naa10 + MO4-tp53 standard conditions Fig. S1 from Ree et al., 2015
eye malformed, abnormal WT + MO1-naa10 + MO4-tp53 standard conditions Fig. S1 from Ree et al., 2015
whole organism decreased length, abnormal WT + MO1-naa10 + MO4-tp53 standard conditions Fig. S1 from Ree et al., 2015
myotome compartment boundary broken, abnormal WT + MO1-naa15a + MO4-tp53 standard conditions Fig. 4Fig. 5 from Monestier et al., 2018
myotome shape, abnormal WT + MO1-naa15a + MO4-tp53 standard conditions Fig. 4 from Monestier et al., 2018
myotome development process quality, abnormal WT + MO1-naa15a + MO4-tp53 standard conditions Fig. 4Fig. 5 from Monestier et al., 2018
myotome muscle cell position, abnormal WT + MO1-naa15a + MO4-tp53 standard conditions Fig. 5 from Monestier et al., 2018
myotome compartment boundary morphology, abnormal WT + MO1-naa15a + MO4-tp53 standard conditions Fig. 4Fig. 5 from Monestier et al., 2018
myotome morphology, abnormal WT + MO1-naa15a + MO4-tp53 standard conditions Fig. 5 from Monestier et al., 2018
whole organism increased curvature, abnormal WT + MO1-naa15a + MO4-tp53 standard conditions Fig. 3 from Monestier et al., 2018
myotome compartment boundary broken, abnormal WT + MO1-naa15b + MO4-tp53 standard conditions Fig. 4 from Monestier et al., 2018
myotome shape, abnormal WT + MO1-naa15b + MO4-tp53 standard conditions Fig. 4 from Monestier et al., 2018
myotome development process quality, abnormal WT + MO1-naa15b + MO4-tp53 standard conditions Fig. 4 from Monestier et al., 2018
myotome compartment boundary morphology, abnormal WT + MO1-naa15b + MO4-tp53 standard conditions Fig. 4 from Monestier et al., 2018
muscle cell ab-mf20 labeling spatial pattern, abnormal WT + MO1-naa15b + MO4-tp53 standard conditions Fig. 5 from Monestier et al., 2018
whole organism increased curvature, abnormal WT + MO1-naa15b + MO4-tp53 standard conditions Fig. 3 from Monestier et al., 2018
whole organism ploidy, abnormal WT + MO1-ncapd2 + MO4-tp53 standard conditions text only from Seipold et al., 2009
whole organism ploidy, abnormal WT + MO1-ncaph + MO4-tp53 standard conditions text only from Seipold et al., 2009
neutrophil decreased amount, abnormal WT + MO1-ncor1 + MO4-tp53 standard conditions Fig. 3 with image from Li et al., 2014
macrophage decreased amount, abnormal WT + MO1-ncor1 + MO4-tp53 standard conditions Fig. 3 with image from Li et al., 2014
ceratohyal bone mislocalised, abnormal WT + MO1-ndst1a + MO2-ndst1a + MO4-tp53 standard conditions Fig. 6 with image from Filipek-Górniok et al., 2015
pharyngeal arch cartilage decreased size, abnormal WT + MO1-ndst1a + MO4-tp53 standard conditions Fig. 6 with image from Filipek-Górniok et al., 2015
head decreased size, abnormal WT + MO1-ndst1a + MO4-tp53 standard conditions Fig. 6 with image from Filipek-Górniok et al., 2015
pectoral fin decreased length, abnormal WT + MO1-ndst1a + MO4-tp53 standard conditions Fig. 6 with image from Filipek-Górniok et al., 2015
ceratohyal bone mislocalised, abnormal WT + MO1-ndst1a + MO4-tp53 standard conditions Fig. 6 with image from Filipek-Górniok et al., 2015
eye decreased size, abnormal WT + MO1-ndst1a + MO4-tp53 standard conditions Fig. 6 with image from Filipek-Górniok et al., 2015
whole organism decreased length, abnormal WT + MO1-ndst1a + MO4-tp53 standard conditions Fig. 6 with image from Filipek-Górniok et al., 2015
whole organism has fewer parts of type swim bladder, abnormal WT + MO1-ndst1a + MO4-tp53 standard conditions Fig. 6 with image from Filipek-Górniok et al., 2015
whole organism apoptotic, abnormal WT + MO1-nedd1 + MO2-nedd1 + MO4-tp53 standard conditions Fig. 4 from Manning et al., 2010
brain hydrophilic, abnormal WT + MO1-nphp4 + MO4-tp53 standard conditions Fig. 2 from Slanchev et al., 2011
whole organism curved ventral, abnormal WT + MO1-nphp4 + MO4-tp53 standard conditions Fig. 2 from Slanchev et al., 2011
pronephric duct dilated, abnormal WT + MO1-nphp4 + MO4-tp53 standard conditions Fig. 2 from Slanchev et al., 2011
pronephros cystic, abnormal WT + MO1-nphp4 + MO4-tp53 standard conditions Fig. 2 from Slanchev et al., 2011
pericardium edematous, abnormal WT + MO1-nphp4 + MO4-tp53 standard conditions Fig. 2 from Slanchev et al., 2011
head decreased size, abnormal WT + MO1-nr1h3 + MO4-tp53 standard conditions Fig. 2 from Archer et al., 2012
eye decreased size, abnormal WT + MO1-nr1h3 + MO4-tp53 standard conditions Fig. 2 from Archer et al., 2012
Meckel's cartilage circular, abnormal WT + MO1-nr1h3 + MO4-tp53 standard conditions Fig. 2 from Archer et al., 2012
ceratohyal cartilage curved, abnormal WT + MO1-nr1h3 + MO4-tp53 standard conditions Fig. 2 from Archer et al., 2012
Meckel's cartilage shape, abnormal WT + MO1-nr1h3 + MO4-tp53 standard conditions Fig. 2 from Archer et al., 2012
thigmotaxis decreased occurrence, abnormal WT + MO1-nrxn1a + MO4-tp53 standard conditions Fig. S2 from Rissone et al., 2012
blood accumulation heart, abnormal WT + MO1-nucleolin + MO4-tp53 standard conditions Fig. 4 from Monte et al., 2013
pericardium edematous, abnormal WT + MO1-nucleolin + MO4-tp53 standard conditions Fig. 4 from Monte et al., 2013
ceratohyal bone perichondral ossification decreased process quality, abnormal WT + MO1-panx3 + MO4-tp53 standard conditions Fig. 4 from Oh et al., 2015
hyomandibula perichondral ossification decreased process quality, abnormal WT + MO1-panx3 + MO4-tp53 standard conditions Fig. 4 from Oh et al., 2015
osteoblast col10a1a expression decreased amount, abnormal WT + MO1-panx3 + MO4-tp53 standard conditions Fig. 8 from Oh et al., 2015
ventral mandibular arch decreased size, abnormal WT + MO1-panx3 + MO4-tp53 standard conditions Fig. 4 from Oh et al., 2015
Meckel's cartilage bent, abnormal WT + MO1-panx3 + MO4-tp53 standard conditions Fig. 4 from Oh et al., 2015
cleithrum col10a1a expression decreased distribution, abnormal WT + MO1-panx3 + MO4-tp53 standard conditions Fig. 8 from Oh et al., 2015
cleithrum malformed, abnormal WT + MO1-panx3 + MO4-tp53 standard conditions Fig. 4 from Oh et al., 2015
branchiostegal ray intramembranous ossification decreased process quality, abnormal WT + MO1-panx3 + MO4-tp53 standard conditions Fig. 4 from Oh et al., 2015
intramembranous ossification decreased process quality, abnormal WT + MO1-panx3 + MO4-tp53 standard conditions Fig. 4 from Oh et al., 2015
ceratohyal cartilage bent, abnormal WT + MO1-panx3 + MO4-tp53 standard conditions Fig. 4 from Oh et al., 2015
cranial skeletal system development disrupted, abnormal WT + MO1-panx3 + MO4-tp53 standard conditions Fig. 4 from Oh et al., 2015
osteoblast col10a1a expression decreased distribution, abnormal WT + MO1-panx3 + MO4-tp53 standard conditions Fig. 8 from Oh et al., 2015
osteoblast col10a1a expression absent, abnormal WT + MO1-panx3 + MO4-tp53 standard conditions Fig. 8 from Oh et al., 2015
osteoblast differentiation delayed, abnormal WT + MO1-panx3 + MO4-tp53 standard conditions Fig. 8 from Oh et al., 2015
mouth open, abnormal WT + MO1-panx3 + MO4-tp53 standard conditions Fig. 4 from Oh et al., 2015
whole organism anterior-posterior axis increased curvature, abnormal WT + MO1-panx3 + MO4-tp53 standard conditions Fig. 4 from Oh et al., 2015
opercle intramembranous ossification decreased process quality, abnormal WT + MO1-panx3 + MO4-tp53 standard conditions Fig. 4 from Oh et al., 2015
perichondral ossification decreased process quality, abnormal WT + MO1-panx3 + MO4-tp53 standard conditions Fig. 4 from Oh et al., 2015
parasphenoid col10a1a expression decreased distribution, abnormal WT + MO1-panx3 + MO4-tp53 standard conditions Fig. 8 from Oh et al., 2015
ceratobranchial 5 bone perichondral ossification decreased process quality, abnormal WT + MO1-panx3 + MO4-tp53 standard conditions Fig. 4 from Oh et al., 2015
opercle col10a1a expression decreased distribution, abnormal WT + MO1-panx3 + MO4-tp53 standard conditions Fig. 8 from Oh et al., 2015
parasphenoid intramembranous ossification decreased process quality, abnormal WT + MO1-panx3 + MO4-tp53 standard conditions Fig. 4 from Oh et al., 2015
palatoquadrate arch absent, abnormal WT + MO1-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
Meckel's cartilage decreased size, abnormal WT + MO1-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
pharyngeal arch 3-7 decreased size, abnormal WT + MO1-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
ceratohyal cartilage absent, abnormal WT + MO1-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
trunk curved ventral, abnormal WT + MO1-pappa2 + MO4-tp53 standard conditions Fig. 3 with image from Kjaer-Sorensen et al., 2014
notochord undulate, abnormal WT + MO1-pappa2 + MO4-tp53 standard conditions Fig. 3 with image from Kjaer-Sorensen et al., 2014
Meckel's cartilage absent, abnormal WT + MO1-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
hyosymplectic cartilage decreased size, abnormal WT + MO1-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
palatoquadrate arch decreased size, abnormal WT + MO1-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
neurocranial trabecula absent, abnormal WT + MO1-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
ethmoid cartilage decreased size, abnormal WT + MO1-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
cranial neural crest cell decreased amount, abnormal WT + MO1-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
ceratohyal cartilage decreased size, abnormal WT + MO1-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
hyosymplectic cartilage absent, abnormal WT + MO1-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
neurocranial trabecula decreased size, abnormal WT + MO1-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
neuromast decreased amount, abnormal WT + MO1-pcsk5a + MO4-tp53 standard conditions Fig. 4 with image from Chitramuthu et al., 2010
neuromast development disrupted, abnormal WT + MO1-pcsk5a + MO4-tp53 standard conditions Fig. 4 with image from Chitramuthu et al., 2010
fast muscle cell disorganized, abnormal WT + MO1-pgam2 + MO4-tp53 standard conditions Fig. 3 with image from Tixier et al., 2013
fast muscle cell has fewer parts of type fast muscle cell nucleus, abnormal WT + MO1-pgam2 + MO4-tp53 standard conditions Fig. 3 with image from Tixier et al., 2013
myoblast fusion involved in skeletal muscle regeneration disrupted, abnormal WT + MO1-pgam2 + MO4-tp53 standard conditions Fig. 3 with image from Tixier et al., 2013
fast muscle cell decreased diameter, abnormal WT + MO1-pgam2 + MO4-tp53 standard conditions Fig. 3 with image from Tixier et al., 2013
fast muscle cell disheveled, abnormal WT + MO1-pgam2 + MO4-tp53 standard conditions Fig. 3 with image from Tixier et al., 2013
diencephalon has fewer parts of type dopaminergic neuron, abnormal WT + MO1-pitx3 + MO4-tp53 standard conditions Fig. S10 with imageFig. S11 with image from Filippi et al., 2007
retinal inner nuclear layer has fewer parts of type amacrine cell, abnormal WT + MO1-pitx3 + MO4-tp53 standard conditions Fig. S10 with imageFig. S11 with image from Filippi et al., 2007
whole organism decreased length, abnormal WT + MO1-plekhg5a + MO4-tp53 standard conditions Fig. S2 with image from Goh et al., 2010
whole organism viability, abnormal WT + MO1-plekhg5a + MO4-tp53 standard conditions Fig. S2 with image from Goh et al., 2010
optic vesicle shtn1 expression increased amount, abnormal WT + MO1-plxna2 + MO4-tp53 standard conditions Fig. 2 with image from Emerson et al., 2020
convergent extension process quality, abnormal WT + MO1-ppp1caa + MO4-tp53 standard conditions Fig. 6 with image from Shimizu et al., 2014
brain primary motor neuron decreased amount, abnormal WT + MO1-psenen + MO4-tp53 standard conditions Fig. 9 from Campbell et al., 2006
brain primary motor neuron spatial pattern, abnormal WT + MO1-psenen + MO4-tp53 standard conditions Fig. 9 from Campbell et al., 2006
whole organism decreased size, abnormal WT + MO1-psenen + MO4-tp53 standard conditions Fig. 8 from Campbell et al., 2006
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-rab5b + MO4-tp53 standard conditions Fig. 2 with image from Kenyon et al., 2015
head decreased size, abnormal WT + MO1-rab5b + MO4-tp53 standard conditions Fig. 2 with image from Kenyon et al., 2015
whole organism anterior-posterior axis curved, abnormal WT + MO1-rab5b + MO4-tp53 standard conditions Fig. 2 with image from Kenyon et al., 2015
skeletal muscle morphology, abnormal WT + MO1-rab5b + MO4-tp53 standard conditions Fig. 2 with image from Kenyon et al., 2015
somite shape, abnormal WT + MO1-rab5b + MO4-tp53 standard conditions Fig. 2 with image from Kenyon et al., 2015
notochord curved, abnormal WT + MO1-rab5b + MO4-tp53 standard conditions Fig. 2 with image from Kenyon et al., 2015
somite U-shaped, abnormal WT + MO1-rab5c + MO4-tp53 standard conditions Fig. 2 with image from Kenyon et al., 2015
brain necrotic, abnormal WT + MO1-rab5c + MO4-tp53 standard conditions Fig. 2 with image from Kenyon et al., 2015
skeletal muscle disorganized, abnormal WT + MO1-rab5c + MO4-tp53 standard conditions Fig. 2 with image from Kenyon et al., 2015
forebrain morphology, abnormal WT + MO1-rab5c + MO4-tp53 standard conditions Fig. 2 with image from Kenyon et al., 2015
head hypoplastic, abnormal WT + MO1-rab5c + MO4-tp53 standard conditions Fig. 2 with image from Kenyon et al., 2015
whole organism anterior-posterior axis curved, abnormal WT + MO1-rab5c + MO4-tp53 standard conditions Fig. 2 with image from Kenyon et al., 2015
rhombomere anatomical compartment boundary rfng expression decreased amount, abnormal WT + MO1-rac3b + MO4-tp53 control Fig. 3 with image from Voltes et al., 2019
whole organism myh6 expression increased amount, abnormal WT + MO1-rdh10a + MO2-rdh10a + MO4-tp53 standard conditions Fig. 3 with image from D'Aniello et al., 2015
whole organism dhrs3a expression decreased amount, abnormal WT + MO1-rdh10a + MO2-rdh10a + MO4-tp53 standard conditions Fig. 2 with image from D'Aniello et al., 2015
anatomical structure dhrs3a expression decreased amount, abnormal WT + MO1-rdh10a + MO2-rdh10a + MO4-tp53 standard conditions Fig. 2 with image from D'Aniello et al., 2015
extension increased thickness, abnormal WT + MO1-rdh10a + MO2-rdh10a + MO4-tp53 standard conditions Fig. 1 with image from D'Aniello et al., 2015
whole organism myl7 expression increased amount, abnormal WT + MO1-rdh10a + MO2-rdh10a + MO4-tp53 standard conditions Fig. 3 with image from D'Aniello et al., 2015
anatomical structure cyp26a1 expression decreased amount, abnormal WT + MO1-rdh10a + MO2-rdh10a + MO4-tp53 standard conditions Fig. 2 with image from D'Aniello et al., 2015
extension shape, abnormal WT + MO1-rdh10a + MO2-rdh10a + MO4-tp53 standard conditions Fig. 1 with image from D'Aniello et al., 2015
anatomical structure hoxb5b expression decreased amount, abnormal WT + MO1-rdh10a + MO2-rdh10a + MO4-tp53 standard conditions Fig. 2 with image from D'Aniello et al., 2015
whole organism cyp26a1 expression decreased amount, abnormal WT + MO1-rdh10a + MO2-rdh10a + MO4-tp53 standard conditions Fig. 2 with image from D'Aniello et al., 2015
whole organism hoxb5b expression decreased amount, abnormal WT + MO1-rdh10a + MO2-rdh10a + MO4-tp53 standard conditions Fig. 2 with image from D'Aniello et al., 2015
pericardium edematous, abnormal WT + MO1-rdh10a + MO2-rdh10a + MO4-tp53 standard conditions Fig. 1 with image from D'Aniello et al., 2015
whole organism myh7 expression increased amount, abnormal WT + MO1-rdh10a + MO2-rdh10a + MO4-tp53 standard conditions Fig. 3 with image from D'Aniello et al., 2015
trunk curved ventral, abnormal WT + MO1-rfx4 + MO4-tp53 standard conditions Fig. 2 with image from Sedykh et al., 2017
trunk posterior region tbx6 expression mislocalised, abnormal WT + MO1-ripply1 + MO4-tp53 control Fig. 5 with image from Windner et al., 2015
segmental plate mespba expression increased distribution, abnormal WT + MO1-ripply1 + MO4-tp53 control Fig. 4 with image from Windner et al., 2015
somite pax3a expression decreased amount, abnormal WT + MO1-ripply1 + MO4-tp53 control Fig. 5 with image from Windner et al., 2015
somite meox1 expression increased amount, abnormal WT + MO1-ripply1 + MO4-tp53 control Fig. 5 with image from Windner et al., 2015
trunk pax3a expression increased distribution, abnormal WT + MO1-ripply1 + MO4-tp53 control Fig. 5 with image from Windner et al., 2015
slow muscle myoblast ab-mf20 labeling increased amount, abnormal WT + MO1-ripply1 + MO4-tp53 control Fig. 4 with image from Windner et al., 2015
paraxial mesoderm tbx6 expression increased distribution, abnormal WT + MO1-ripply1 + MO4-tp53 control Fig. 4 with image from Windner et al., 2015
segmental plate mespbb expression increased distribution, abnormal WT + MO1-ripply1 + MO4-tp53 control Fig. 4 with image from Windner et al., 2015
trunk ab-pax7 labeling increased distribution, abnormal WT + MO1-ripply1 + MO4-tp53 control Fig. 5 with image from Windner et al., 2015
slow muscle cell mislocalised, abnormal WT + MO1-ripply1 + MO4-tp53 control Fig. 5 with image from Windner et al., 2015
dermomyotome increased amount, abnormal WT + MO1-ripply1 + MO4-tp53 control Fig. 5 with image from Windner et al., 2015
trunk pax7a expression increased distribution, abnormal WT + MO1-ripply1 + MO4-tp53 control Fig. 5 with image from Windner et al., 2015
paraxial mesoderm tbx6 expression increased amount, abnormal WT + MO1-ripply1 + MO4-tp53 control Fig. 4 with image from Windner et al., 2015
trunk posterior region tbx6 expression increased distribution, abnormal WT + MO1-ripply1 + MO4-tp53 control Fig. 5 with image from Windner et al., 2015
nucleate erythrocyte decreased amount, abnormal WT + MO1-rpl11 + MO4-tp53 standard conditions Fig. 2 from Chakraborty et al., 2017
hemopoiesis process quality, abnormal WT + MO1-rpl11 + MO4-tp53 standard conditions Fig. 4 with image from Zhang et al., 2013
nucleate erythrocyte decreased amount, abnormal WT + MO1-rpl35 + MO4-tp53 standard conditions Fig. 2 from Yadav et al., 2014
nucleate erythrocyte decreased amount, abnormal WT + MO1-rpl35a + MO4-tp53 standard conditions Fig. 2 from Yadav et al., 2014
nucleate erythrocyte decreased amount, abnormal WT + MO1-rplp1 + MO4-tp53 standard conditions Fig. 2 from Yadav et al., 2014
nucleate erythrocyte decreased amount, abnormal WT + MO1-rps3 + MO4-tp53 standard conditions Fig. 2 from Yadav et al., 2014
nucleate erythrocyte decreased amount, abnormal WT + MO1-rps19 + MO4-tp53 standard conditions Fig. 2 from Torihara et al., 2011
brain hydrocephalic, abnormal WT + MO1-rxylt1 + MO4-tp53 standard conditions Fig. 6 with image from Praissman et al., 2016
eye decreased width, abnormal WT + MO1-rxylt1 + MO4-tp53 standard conditions Fig. 6 with image from Praissman et al., 2016
heart decreased size, abnormal WT + MO1-scn5lab + MO4-tp53 standard conditions Fig. 2 from Bennett et al., 2013
heart looping arrested, abnormal WT + MO1-scn5lab + MO4-tp53 standard conditions Fig. S6 from Chopra et al., 2010
atrium orientation cardiac ventricle, abnormal WT + MO1-scn5lab + MO4-tp53 standard conditions Fig. S6 from Chopra et al., 2010
heart looping decreased process quality, abnormal WT + MO1-scn5lab + MO4-tp53 standard conditions Fig. 2 from Bennett et al., 2013
atrium orientation cardiac ventricle, abnormal WT + MO1-scn12aa + MO4-tp53 standard conditions Fig. S6 from Chopra et al., 2010
heart looping arrested, abnormal WT + MO1-scn12aa + MO4-tp53 standard conditions Fig. S6 from Chopra et al., 2010
post-vent region pigment cell decreased amount, abnormal WT + MO1-sh3pxd2aa + MO4-tp53 standard conditions Fig. 1 with image from Murphy et al., 2011
muscle decreased amount, abnormal WT + MO1-slc30a1a + MO4-tp53 standard conditions Fig. 3 from Muraina et al., 2020
zinc ion sequestering activity increased efficacy, abnormal WT + MO1-slc30a1a + MO4-tp53 standard conditions Fig. 4 from Muraina et al., 2020
central nervous system slc30a1a expression spatial pattern, abnormal WT + MO1-slc30a1a + MO4-tp53 standard conditions Fig. 3 from Muraina et al., 2020
whole organism zinc(2+) increased amount, abnormal WT + MO1-slc30a1a + MO4-tp53 standard conditions Fig. 4 from Muraina et al., 2020
yolk increased size, abnormal WT + MO1-slc30a1a + MO4-tp53 standard conditions Fig. 3 from Muraina et al., 2020
chorion zinc(2+) increased amount, abnormal WT + MO1-slc30a1a + MO4-tp53 standard conditions Fig. 5 from Muraina et al., 2020
chorion zinc(2+) present, abnormal WT + MO1-slc30a1a + MO4-tp53 standard conditions Fig. 5 from Muraina et al., 2020
hatching gland slc30a1a expression absent, abnormal WT + MO1-slc30a1a + MO4-tp53 standard conditions Fig. 3 from Muraina et al., 2020
margin zinc(2+) decreased amount, abnormal WT + MO1-slc30a1a + MO4-tp53 standard conditions Fig. 5 from Muraina et al., 2020
hatching gland zinc(2+) increased amount, ameliorated WT + MO1-slc30a1a + MO4-tp53 chemical treatment by environment: zinc sulfate Fig. 5 from Muraina et al., 2020
yolk syncytial layer slc30a1a expression spatial pattern, abnormal WT + MO1-slc30a1a + MO4-tp53 standard conditions Fig. 3 from Muraina et al., 2020
whole organism decreased pigmentation, abnormal WT + MO1-slc30a1a + MO4-tp53 standard conditions Fig. 3 from Muraina et al., 2020
blastoderm zinc(2+) decreased amount, abnormal WT + MO1-slc30a1a + MO4-tp53 standard conditions Fig. 5 from Muraina et al., 2020
chordate embryonic development delayed, exacerbated WT + MO1-slc30a1a + MO4-tp53 chemical treatment by environment: zinc sulfate Fig. 3 from Muraina et al., 2020
margin ab9-mapk labeling decreased amount, abnormal WT + MO1-slc30a1a + MO4-tp53 standard conditions Fig. 6 from Muraina et al., 2020
chordate embryonic development delayed, abnormal WT + MO1-slc30a1a + MO4-tp53 standard conditions Fig. 3 from Muraina et al., 2020
chordate embryonic development delayed, ameliorated WT + MO1-slc30a1a + MO4-tp53 chemical treatment by environment: N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine Fig. 3 from Muraina et al., 2020
epithelial to mesenchymal transition delayed, abnormal WT + MO1-slc39a10 + MO4-tp53 standard conditions Fig. S2 with image from Taylor et al., 2016
post-vent region bent, abnormal WT + MO1-slc39a10 + MO4-tp53 standard conditions Fig. 4 with image from Taylor et al., 2016
tail bud immature, abnormal WT + MO1-slc39a10 + MO4-tp53 standard conditions Fig. 4 with image from Taylor et al., 2016
head morphology, abnormal WT + MO1-slc39a10 + MO4-tp53 standard conditions Fig. 4 with image from Taylor et al., 2016
head deformed, abnormal WT + MO1-slc39a10 + MO4-tp53 standard conditions Fig. S2 with image from Taylor et al., 2016
pericardium edematous, abnormal WT + MO1-slc39a10 + MO4-tp53 standard conditions Fig. 4 with imageFig. S2 with image from Taylor et al., 2016
post-vent region curved, abnormal WT + MO1-slc39a10 + MO4-tp53 standard conditions Fig. 4 with imageFig. S2 with image from Taylor et al., 2016
eye malformed, abnormal WT + MO1-slc39a10 + MO4-tp53 standard conditions Fig. S2 with image from Taylor et al., 2016
eye morphology, abnormal WT + MO1-slc39a10 + MO4-tp53 standard conditions Fig. 4 with image from Taylor et al., 2016
epiboly involved in gastrulation with mouth forming second delayed, abnormal WT + MO1-slc39a10 + MO4-tp53 standard conditions Fig. 4 with imageFig. S2 with image from Taylor et al., 2016
heart malformed, abnormal WT + MO1-slc39a10 + MO4-tp53 standard conditions Fig. 4 with imageFig. S2 with image from Taylor et al., 2016
whole organism dorsal-ventral axis shortened, abnormal WT + MO1-slc39a10 + MO4-tp53 standard conditions Fig. 4 with imageFig. S2 with image from Taylor et al., 2016
hatching delayed, abnormal WT + MO1-slc39a10 + MO4-tp53 standard conditions Fig. S2 with image from Taylor et al., 2016
intersegmental vessel absent, abnormal WT + MO1-stab2 + MO4-stab2 + MO4-tp53 standard conditions Fig. 1 with image from Rost et al., 2014
whole organism notch1b expression amount, ameliorated WT + MO1-supt16h + MO4-tp53 standard conditions Fig. 4 from Espanola et al., 2020
apoptotic process increased occurrence, abnormal WT + MO1-surf1 + MO4-tp53 standard conditions Fig. 5 from Baden et al., 2007
post-vent region aplastic, abnormal WT + MO1-tbxta + MO4-tp53 standard conditions Fig. 5 with image from Robu et al., 2007
whole organism physical object quality, abnormal WT + MO1-tdgf1 + MO4-tp53 standard conditions Fig. S6 with image from Moreno-Ayala et al., 2015
tail bud increased size, abnormal WT + MO1-tdgf1 + MO4-tp53 standard conditions Fig. 3 with image from O'Neill et al., 2013
blood cell decreased amount, abnormal WT + MO1-tert + MO4-tp53 standard conditions Fig. 5 with image from Imamura et al., 2008
splanchnocranium morphology, abnormal WT + MO1-tp73 + MO2-tp73 + MO4-tp53 standard conditions Fig. 3 from Davidson et al., 2008
striated muscle cell decreased width, abnormal WT + MO1-tpcn2 + MO2-tpcn2 + MO4-tp53 standard conditions Fig. 4 with image from Kelu et al., 2017
myotome decreased width, abnormal WT + MO1-tpcn2 + MO2-tpcn2 + MO4-tp53 standard conditions Fig. 3 with imageFig. 4 with image from Kelu et al., 2017
striated muscle cell increased length, abnormal WT + MO1-tpcn2 + MO2-tpcn2 + MO4-tp53 standard conditions Fig. 4 with image from Kelu et al., 2017
slow muscle cell skeletal muscle myofibril disorganized, abnormal WT + MO1-tpcn2 + MO2-tpcn2 + MO4-tp53 standard conditions Fig. 3 with image from Kelu et al., 2017
slow muscle cell sarcomere morphology, abnormal WT + MO1-tpcn2 + MO2-tpcn2 + MO4-tp53 standard conditions Fig. 3 with image from Kelu et al., 2017
slow muscle cell decreased amount, abnormal WT + MO1-tpcn2 + MO2-tpcn2 + MO4-tp53 standard conditions Fig. 4 with image from Kelu et al., 2017
somite U-shaped, abnormal WT + MO1-tpcn2 + MO2-tpcn2 + MO4-tp53 standard conditions Fig. 3 with imageFig. 4 with image from Kelu et al., 2017
myotome width, ameliorated WT + MO1-tpcn2 + MO4-tp53 chemical treatment by environment: D-myo-Ins(1,4,5)P3 hexakis(butyryloxymethyl) ester Fig. 6 with image from Kelu et al., 2017
slow muscle cell sarcomere morphology, abnormal WT + MO1-tpcn2 + MO4-tp53 chemical treatment by environment: caffeine Fig. 6 with image from Kelu et al., 2017
striated muscle cell decreased width, abnormal WT + MO1-tpcn2 + MO4-tp53 control Fig. 4 with imageFig. 6 with image from Kelu et al., 2017
myotome decreased width, abnormal WT + MO1-tpcn2 + MO4-tp53 control Fig. 3 with imageFig. 4 with imageFig. 6 with image from Kelu et al., 2017
striated muscle cell increased length, abnormal WT + MO1-tpcn2 + MO4-tp53 control Fig. 4 with imageFig. 6 with image from Kelu et al., 2017
somite U-shaped, abnormal WT + MO1-tpcn2 + MO4-tp53 chemical treatment by environment: D-myo-Ins(1,4,5)P3 hexakis(butyryloxymethyl) ester Fig. 6 with image from Kelu et al., 2017
slow muscle cell skeletal muscle myofibril disorganized, abnormal WT + MO1-tpcn2 + MO4-tp53 standard conditions Fig. 3 with imageFig. 6 with image from Kelu et al., 2017
slow muscle cell amount, ameliorated WT + MO1-tpcn2 + MO4-tp53 chemical treatment by environment: caffeine Fig. 6 with image from Kelu et al., 2017
slow muscle cell sarcomere morphology, abnormal WT + MO1-tpcn2 + MO4-tp53 standard conditions Fig. 3 with imageFig. 6 with image from Kelu et al., 2017
slow muscle cell decreased amount, abnormal WT + MO1-tpcn2 + MO4-tp53 standard conditions Fig. 4 with imageFig. 6 with image from Kelu et al., 2017
striated muscle cell width, ameliorated WT + MO1-tpcn2 + MO4-tp53 chemical treatment by environment: D-myo-Ins(1,4,5)P3 hexakis(butyryloxymethyl) ester Fig. 6 with image from Kelu et al., 2017
striated muscle cell increased length, abnormal WT + MO1-tpcn2 + MO4-tp53 chemical treatment by environment: caffeine Fig. 6 with image from Kelu et al., 2017
striated muscle cell length, ameliorated WT + MO1-tpcn2 + MO4-tp53 chemical treatment by environment: D-myo-Ins(1,4,5)P3 hexakis(butyryloxymethyl) ester Fig. 6 with image from Kelu et al., 2017
striated muscle cell width, ameliorated WT + MO1-tpcn2 + MO4-tp53 chemical treatment by environment: caffeine Fig. 6 with image from Kelu et al., 2017
somite U-shaped, abnormal WT + MO1-tpcn2 + MO4-tp53 chemical treatment by environment: caffeine Fig. 6 with image from Kelu et al., 2017
slow muscle cell sarcomere morphology, ameliorated WT + MO1-tpcn2 + MO4-tp53 chemical treatment by environment: D-myo-Ins(1,4,5)P3 hexakis(butyryloxymethyl) ester Fig. 6 with image from Kelu et al., 2017
slow muscle cell skeletal muscle myofibril disorganized, abnormal WT + MO1-tpcn2 + MO4-tp53 chemical treatment by environment: caffeine Fig. 6 with image from Kelu et al., 2017
slow muscle cell skeletal muscle myofibril organization quality, ameliorated WT + MO1-tpcn2 + MO4-tp53 chemical treatment by environment: D-myo-Ins(1,4,5)P3 hexakis(butyryloxymethyl) ester Fig. 6 with image from Kelu et al., 2017
myotome width, ameliorated WT + MO1-tpcn2 + MO4-tp53 chemical treatment by environment: caffeine Fig. 6 with image from Kelu et al., 2017
somite U-shaped, abnormal WT + MO1-tpcn2 + MO4-tp53 standard conditions Fig. 3 with imageFig. 4 with imageFig. 6 with image from Kelu et al., 2017
slow muscle cell amount, ameliorated WT + MO1-tpcn2 + MO4-tp53 chemical treatment by environment: D-myo-Ins(1,4,5)P3 hexakis(butyryloxymethyl) ester Fig. 6 with image from Kelu et al., 2017
apoptotic process increased occurrence, abnormal WT + MO1-trim69 + MO4-tp53 standard conditions Fig. 6 from Han et al., 2016
nucleate erythrocyte fluorescence, abnormal WT + MO1-urod + MO4-tp53 standard conditions Fig. 5 with image from Robu et al., 2007
pharyngeal arch chondrocyte sox9a expression decreased amount, abnormal WT + MO1-vwa1 + MO4-tp53 control FIGURE 5 with image from Wang et al., 2020
pharyngeal arch 3-7 absent, abnormal WT + MO1-vwa1 + MO4-tp53 control FIGURE 4 with image from Wang et al., 2020
pharyngeal arch 1 hypoplastic, abnormal WT + MO1-vwa1 + MO4-tp53 control FIGURE 4 with image from Wang et al., 2020
neural crest dlx2a expression decreased amount, abnormal WT + MO1-vwa1 + MO4-tp53 control FIGURE 5 with image from Wang et al., 2020
pharyngeal arch chondrocyte organization quality, abnormal WT + MO1-vwa1 + MO4-tp53 control FIGURE 7 with image from Wang et al., 2020
cranial cartilage joint morphology, abnormal WT + MO1-vwa1 + MO4-tp53 control FIGURE 4 with image from Wang et al., 2020
ceratohyal cartilage increased angle to ceratohyal cartilage, abnormal WT + MO1-vwa1 + MO4-tp53 control FIGURE 4 with image from Wang et al., 2020
cranial neural crest cell decreased amount, abnormal WT + MO1-vwa1 + MO4-tp53 control FIGURE 5 with image from Wang et al., 2020
pharyngeal arch 2 hypoplastic, abnormal WT + MO1-vwa1 + MO4-tp53 control FIGURE 4 with image from Wang et al., 2020
Meckel's cartilage decreased angle to palatoquadrate cartilage, abnormal WT + MO1-vwa1 + MO4-tp53 control FIGURE 4 with image from Wang et al., 2020
midbrain development disrupted, abnormal WT + MO1-wnt1 + MO4-tp53 standard conditions Fig. 4 from Ota et al., 2012
optic tectum decreased size, abnormal WT + MO1-wnt1 + MO4-tp53 standard conditions Fig. 4 from Ota et al., 2012
pronephric proximal convoluted tubule straight, abnormal WT + MO1-wwtr1 + MO4-tp53 standard conditions Fig. 1 with image from Zhang et al., 2015
pronephric tubule orientation whole organism anterior-posterior axis, abnormal WT + MO1-wwtr1 + MO4-tp53 standard conditions Fig. 1 with image from Zhang et al., 2015
pronephric proximal tubule development process quality, abnormal WT + MO1-wwtr1 + MO4-tp53 standard conditions Fig. 1 with image from Zhang et al., 2015
pronephric proximal convoluted tubule mislocalised posteriorly, abnormal WT + MO1-wwtr1 + MO4-tp53 standard conditions Fig. 1 with image from Zhang et al., 2015
post-vent region decreased size, abnormal WT + MO1-zmiz2 + MO4-tp53 standard conditions Fig. S1 with image from Moreno-Ayala et al., 2015
whole organism morphology, abnormal WT + MO1-zmiz2 + MO4-tp53 standard conditions Fig. S1 with image from Moreno-Ayala et al., 2015
whole organism curved ventral, abnormal WT + MO1-zmiz2 + MO4-tp53 standard conditions Fig. 2 with imageFig. 8 with imageFig. S6 with image from Moreno-Ayala et al., 2015
floor plate increased width, abnormal WT + MO1-zmiz2 + MO4-tp53 standard conditions Fig. 4 with image from Moreno-Ayala et al., 2015
whole organism increased curvature, abnormal WT + MO1-zmiz2 + MO4-tp53 standard conditions Fig. 2 with imageFig. 8 with imageFig. S6 with image from Moreno-Ayala et al., 2015
trunk morphology, abnormal WT + MO1-zmiz2 + MO4-tp53 standard conditions Fig. S1 with image from Moreno-Ayala et al., 2015
notochord kinked, abnormal WT + MO1-zmiz2 + MO4-tp53 standard conditions Fig. S1 with image from Moreno-Ayala et al., 2015
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-zmiz2 + MO4-tp53 standard conditions Fig. S1 with image from Moreno-Ayala et al., 2015
whole organism apoptotic process increased occurrence, abnormal WT + MO2-agbl2 + MO4-tp53 standard conditions Fig. 2 with image from Maimouni et al., 2019
whole organism morphology, abnormal WT + MO2-agbl2 + MO4-tp53 standard conditions Fig. 2 with image from Maimouni et al., 2019
midbrain opaque, abnormal WT + MO2-agbl2 + MO4-tp53 standard conditions Fig. 2 with image from Maimouni et al., 2019
midbrain granular, abnormal WT + MO2-agbl2 + MO4-tp53 standard conditions Fig. 2 with image from Maimouni et al., 2019
hindbrain granular, abnormal WT + MO2-agbl2 + MO4-tp53 standard conditions Fig. 2 with image from Maimouni et al., 2019
whole organism decreased size, abnormal WT + MO2-agbl2 + MO4-tp53 standard conditions Fig. 2 with image from Maimouni et al., 2019
hindbrain opaque, abnormal WT + MO2-agbl2 + MO4-tp53 standard conditions Fig. 2 with image from Maimouni et al., 2019
whole organism cell death increased occurrence, abnormal WT + MO2-agbl2 + MO4-tp53 standard conditions Fig. 2 with image from Maimouni et al., 2019
embryonic heart tube elongation disrupted, abnormal WT + MO2-atp1a1a.1 + MO4-tp53 standard conditions Fig. 5 with image from Langenbacher et al., 2012
embryonic heart tube formation disrupted, abnormal WT + MO2-atp1a1a.1 + MO4-tp53 standard conditions Fig. 5 with image from Langenbacher et al., 2012
somite morphology, abnormal WT + MO2-bcl2l16 + MO4-tp53 standard conditions Fig. 3 from Prudent et al., 2013
anterior/posterior axis specification disrupted, abnormal WT + MO2-bcl2l16 + MO4-tp53 standard conditions Fig. 3 from Prudent et al., 2013
embryo development disrupted, abnormal WT + MO2-bcl2l16 + MO4-tp53 standard conditions Fig. 3 from Prudent et al., 2013
notochord bent, abnormal WT + MO2-bcl2l16 + MO4-tp53 standard conditions Fig. 3 from Prudent et al., 2013
embryonic heart tube morphogenesis disrupted, abnormal WT + MO2-cdc73 + MO4-tp53 standard conditions Fig. 3 with imageFig. 4 with image from Langenbacher et al., 2011
heart hypoplastic, abnormal WT + MO2-cdc73 + MO4-tp53 standard conditions Fig. 4 with image from Langenbacher et al., 2011
heart malformed, abnormal WT + MO2-cdc73 + MO4-tp53 standard conditions Fig. 4 with image from Langenbacher et al., 2011
cardiac muscle progenitor cell migration to the midline involved in heart field formation delayed, abnormal WT + MO2-cdc73 + MO4-tp53 standard conditions Fig. 3 with image from Langenbacher et al., 2011
cardiac muscle cell decreased amount, abnormal WT + MO2-cdc73 + MO4-tp53 standard conditions Fig. 3 with image from Langenbacher et al., 2011
whole organism decreased length, abnormal WT + MO2-chrdl2 + MO4-tp53 standard conditions Fig. 6 with image from Branam et al., 2010
post-vent region truncated, abnormal WT + MO2-chrdl2 + MO4-tp53 standard conditions Fig. 6 with image from Branam et al., 2010
yolk increased size, abnormal WT + MO2-chrdl2 + MO4-tp53 standard conditions Fig. 6 with image from Branam et al., 2010
head decreased size, abnormal WT + MO2-chrdl2 + MO4-tp53 standard conditions Fig. 6 with image from Branam et al., 2010
post-vent region bent, abnormal WT + MO2-chrdl2 + MO4-tp53 standard conditions Fig. 8 with image from Branam et al., 2010
eye decreased size, abnormal WT + MO2-chrdl2 + MO4-tp53 standard conditions Fig. 6 with image from Branam et al., 2010
pectoral fin fold decreased size, abnormal WT + MO2-chsy1 + MO4-tp53 standard conditions Fig. 4 from Li et al., 2010
ventral mandibular arch protruding, abnormal WT + MO2-chsy1 + MO4-tp53 standard conditions Fig. 4 from Li et al., 2010
forebrain medial region aplastic, abnormal WT + MO2-chsy1 + MO4-tp53 standard conditions Fig. 4 from Li et al., 2010
whole organism decreased length, abnormal WT + MO2-chsy1 + MO4-tp53 standard conditions Fig. 4 from Li et al., 2010
optic fissure present, abnormal WT + MO2-chsy1 + MO4-tp53 standard conditions Fig. 4 from Li et al., 2010
notochord degenerate, abnormal WT + MO2-chsy1 + MO4-tp53 standard conditions Fig. 4 from Li et al., 2010
optic furrow open, abnormal WT + MO2-chsy1 + MO4-tp53 standard conditions Fig. 4 from Li et al., 2010
trabecula cranii malformed, abnormal WT + MO2-chsy1 + MO4-tp53 standard conditions Fig. 4 from Li et al., 2010
head bulbous, abnormal WT + MO2-chsy1 + MO4-tp53 standard conditions Fig. 4 from Li et al., 2010
eye fused with eye, abnormal WT + MO2-chsy1 + MO4-tp53 standard conditions Fig. 4 from Li et al., 2010
notochord undulate, abnormal WT + MO2-chsy1 + MO4-tp53 standard conditions Fig. 4 from Li et al., 2010
pars superior ear morphology, abnormal WT + MO2-chsy1 + MO4-tp53 standard conditions Fig. 5 from Li et al., 2010
ethmoid cartilage malformed, abnormal WT + MO2-chsy1 + MO4-tp53 standard conditions Fig. 4 from Li et al., 2010
pectoral fin fold variability of size, abnormal WT + MO2-chsy1 + MO4-tp53 standard conditions Fig. 4 from Li et al., 2010
brain apoptotic process occurrence, ameliorated WT + MO2-crbn + MO4-tp53 control Fig. S4 from Ando et al., 2019
pretectum dopaminergic neuron decreased amount, abnormal WT + MO2-ddb1 + MO4-tp53 control Table 1 from Hu et al., 2015
retina dopaminergic neuron decreased amount, abnormal WT + MO2-ddb1 + MO4-tp53 control Table 1 from Hu et al., 2015
retina decreased size, abnormal WT + MO2-ddb1 + MO4-tp53 control Table 1 from Hu et al., 2015
brain decreased size, abnormal WT + MO2-ddb1 + MO4-tp53 control Table 1 from Hu et al., 2015
adenohypophysis corticotropin hormone secreting cell differentiation decreased occurrence, abnormal WT + MO2-dmrta2 + MO3-dmrta2 + MO4-tp53 standard conditions Fig. 4 from Graf et al., 2015
adenohypophysis has fewer parts of type adrenocorticotropic hormone secreting cell, abnormal WT + MO2-dmrta2 + MO3-dmrta2 + MO4-tp53 standard conditions Fig. 4 from Graf et al., 2015
intestinal epithelial structure maintenance decreased process quality, abnormal WT + MO2-dot1l + MO4-tp53 standard conditions Fig. 9 with image from Mahmoudi et al., 2010
canonical Wnt signaling pathway decreased process quality, abnormal WT + MO2-dot1l + MO4-tp53 standard conditions Fig. 9 with image from Mahmoudi et al., 2010
intestinal villus decreased length, abnormal WT + MO2-dot1l + MO4-tp53 standard conditions Fig. 9 with image from Mahmoudi et al., 2010
intestinal epithelium has fewer parts of type epithelial cell, abnormal WT + MO2-dot1l + MO4-tp53 standard conditions Fig. 9 with image from Mahmoudi et al., 2010
intestine well differentiated, abnormal WT + MO2-dot1l + MO4-tp53 standard conditions Fig. 8 with image from Mahmoudi et al., 2010
Meckel's cartilage curved ventral, abnormal WT + MO2-ece1 + MO4-tp53 standard conditions Fig. S3 from Iklé et al., 2017
cranial cartilage hypoplastic, abnormal WT + MO2-ece1 + MO4-tp53 standard conditions Fig. S3 from Iklé et al., 2017
Meckel's cartilage decreased size, abnormal WT + MO2-ece1 + MO4-tp53 standard conditions Fig. S3 from Iklé et al., 2017
glomerular filtration process quality, abnormal WT + MO2-emp2 + MO4-tp53 standard conditions Fig. 2 from Gee et al., 2014
dorsal telencephalon morphology, abnormal WT + MO2-emx3 + MO3-emx3 + MO4-tp53 standard conditions Fig. 3 with imageFig. 4 with image from Viktorin et al., 2009
cranial nerve I defasciculated, abnormal WT + MO2-emx3 + MO3-emx3 + MO4-tp53 standard conditions Fig. 5 with image from Viktorin et al., 2009
forebrain neuron differentiation disrupted, abnormal WT + MO2-emx3 + MO3-emx3 + MO4-tp53 standard conditions Fig. 4 with image from Viktorin et al., 2009
axon extension disrupted, abnormal WT + MO2-emx3 + MO3-emx3 + MO4-tp53 standard conditions Fig. 5 with image from Viktorin et al., 2009
supraoptic tract fasciculation, abnormal WT + MO2-emx3 + MO3-emx3 + MO4-tp53 standard conditions Fig. 5 with image from Viktorin et al., 2009
olfactory bulb development disrupted, abnormal WT + MO2-emx3 + MO3-emx3 + MO4-tp53 standard conditions Fig. 5 with image from Viktorin et al., 2009
anterior commissure aplastic, abnormal WT + MO2-emx3 + MO3-emx3 + MO4-tp53 standard conditions Fig. 5 with image from Viktorin et al., 2009
telencephalon ventricular zone increased width, abnormal WT + MO2-emx3 + MO3-emx3 + MO4-tp53 standard conditions Fig. 5 with image from Viktorin et al., 2009
axonal fasciculation disrupted, abnormal WT + MO2-emx3 + MO3-emx3 + MO4-tp53 standard conditions Fig. 5 with image from Viktorin et al., 2009
supraoptic tract decreased thickness, abnormal WT + MO2-emx3 + MO3-emx3 + MO4-tp53 standard conditions Fig. 5 with image from Viktorin et al., 2009
glomerular layer decreased size, abnormal WT + MO2-emx3 + MO3-emx3 + MO4-tp53 standard conditions Fig. 5 with image from Viktorin et al., 2009
brain development process quality, abnormal WT + MO2-esr2a + MO4-tp53 standard conditions Fig. 3 from Celeghin et al., 2011
splanchnocranium morphology, abnormal WT + MO2-esr2a + MO4-tp53 standard conditions Fig. 3 from Celeghin et al., 2011
developmental growth delayed, abnormal WT + MO2-esr2a + MO4-tp53 standard conditions Fig. 3 from Celeghin et al., 2011
thigmotaxis disrupted, abnormal WT + MO2-esr2a + MO4-tp53 standard conditions Fig. 3 from Celeghin et al., 2011
whole organism viability, abnormal WT + MO2-esr2a + MO4-tp53 standard conditions Fig. 3 from Celeghin et al., 2011
otic vesicle decreased size, abnormal WT + MO2-esr2a + MO4-tp53 standard conditions Fig. 3 from Celeghin et al., 2011
caudal fin hypoplastic, abnormal WT + MO2-esr2a + MO4-tp53 standard conditions Fig. 3 from Celeghin et al., 2011
extension decreased size, abnormal WT + MO2-esr2a + MO4-tp53 standard conditions Fig. 3 from Celeghin et al., 2011
eye decreased size, abnormal WT + MO2-esr2a + MO4-tp53 standard conditions Fig. 3 from Celeghin et al., 2011
whole organism circling, abnormal WT + MO2-esr2a + MO4-tp53 standard conditions Fig. 3 from Celeghin et al., 2011
yolk increased volume, abnormal WT + MO2-esr2a + MO4-tp53 standard conditions Fig. 3 from Celeghin et al., 2011
trunk curved, abnormal WT + MO2-esr2a + MO4-tp53 standard conditions Fig. 3 from Celeghin et al., 2011
pericardium edematous, abnormal WT + MO2-esr2a + MO4-tp53 standard conditions Fig. 3 from Celeghin et al., 2011
extension edematous, abnormal WT + MO2-esr2a + MO4-tp53 standard conditions Fig. 3 from Celeghin et al., 2011
brain decreased size, abnormal WT + MO2-esr2a + MO4-tp53 standard conditions Fig. 3 from Celeghin et al., 2011
swim bladder inflation arrested, abnormal WT + MO2-esr2a + MO4-tp53 standard conditions Fig. 3 from Celeghin et al., 2011
whole organism decreased size, abnormal WT + MO2-esr2a + MO4-tp53 standard conditions Fig. 3 from Celeghin et al., 2011
trunk posterior region decreased length, abnormal WT + MO2-fam53b + MO4-tp53 standard conditions Fig. 1 with image from Kizil et al., 2014
heart malformed, abnormal WT + MO2-fbxo7 + MO4-tp53 standard conditions Fig. 6 with image from Zhao et al., 2012
post-vent region curled, abnormal WT + MO2-fbxo7 + MO4-tp53 standard conditions Fig. 6 with image from Zhao et al., 2012
heart edematous, abnormal WT + MO2-fbxo7 + MO4-tp53 standard conditions Fig. 6 with image from Zhao et al., 2012
cranium malformed, abnormal WT + MO2-fer + MO4-tp53 standard conditions Fig. 3 with image from Paardekooper Overman et al., 2014
heart edematous, abnormal WT + MO2-fer + MO4-tp53 standard conditions Fig. 3 with image from Paardekooper Overman et al., 2014
whole organism decreased length, abnormal WT + MO2-fer + MO4-tp53 standard conditions Fig. 3 with image from Paardekooper Overman et al., 2014
cardiac muscle cell development disrupted, abnormal WT + MO2-flncb + MO4-tp53 standard conditions Fig. 6 with image from Begay et al., 2016
sarcomere organization disrupted, abnormal WT + MO2-flncb + MO4-tp53 standard conditions Fig. 6 with image from Begay et al., 2016
cardiac muscle cell autophagosome present, abnormal WT + MO2-flncb + MO4-tp53 standard conditions Fig. 6 with image from Begay et al., 2016
cardiac muscle cell vacuolated, abnormal WT + MO2-flncb + MO4-tp53 standard conditions Fig. 6 with image from Begay et al., 2016
heart decreased functionality, abnormal WT + MO2-flncb + MO4-tp53 standard conditions Fig. 5 from Begay et al., 2016
whole organism decreased life span, abnormal WT + MO2-flncb + MO4-tp53 standard conditions Fig. 4 with image from Begay et al., 2016
heart cardiac myofibril disorganized, abnormal WT + MO2-flncb + MO4-tp53 standard conditions Fig. 6 with image from Begay et al., 2016
heart Z disc disorganized, abnormal WT + MO2-flncb + MO4-tp53 standard conditions Fig. 6 with image from Begay et al., 2016
pericardium edematous, abnormal WT + MO2-flncb + MO4-tp53 standard conditions Fig. 4 with image from Begay et al., 2016
heart contraction decreased rate, abnormal WT + MO2-flncb + MO4-tp53 standard conditions Fig. 5 from Begay et al., 2016
whole organism dead, abnormal WT + MO2-flncb + MO4-tp53 standard conditions Fig. 4 with image from Begay et al., 2016
heart edematous, abnormal WT + MO2-golgb1 + MO4-tp53 standard conditions Fig. 1 with image from Bergen et al., 2017
eye decreased size, abnormal WT + MO2-golgb1 + MO4-tp53 standard conditions Fig. 1 with image from Bergen et al., 2017
post-vent region kinked, abnormal WT + MO2-golgb1 + MO4-tp53 standard conditions Fig. 1 with image from Bergen et al., 2017
brain edematous, abnormal WT + MO2-golgb1 + MO4-tp53 standard conditions Fig. 1 with image from Bergen et al., 2017
heart deformed, abnormal WT + MO2-hsbp1b + MO4-tp53 standard conditions Table S3 with image from Eroglu et al., 2014
whole organism anterior-posterior axis increased curvature, abnormal WT + MO2-hsbp1b + MO4-tp53 standard conditions Fig. S7 with imageTable S3 with image from Eroglu et al., 2014
head deformed, abnormal WT + MO2-hsbp1b + MO4-tp53 standard conditions Fig. S7 with imageTable S3 with image from Eroglu et al., 2014
yolk increased size, abnormal WT + MO2-hsbp1b + MO4-tp53 standard conditions Table S3 with image from Eroglu et al., 2014
whole organism decreased length, abnormal WT + MO2-hsbp1b + MO4-tp53 standard conditions Fig. S7 with image from Eroglu et al., 2014
embryo development disrupted, abnormal WT + MO2-hsbp1b + MO4-tp53 standard conditions Fig. S7 with image from Eroglu et al., 2014
eye decreased size, abnormal WT + MO2-inpp5b + MO4-tp53 standard conditions Fig. 3 with image from Luo et al., 2013
post-vent region kinked, abnormal WT + MO2-inpp5b + MO4-tp53 standard conditions Fig. 3 with image from Luo et al., 2013
pericardium edematous, abnormal WT + MO2-inpp5b + MO4-tp53 standard conditions Fig. 3 with image from Luo et al., 2013
growth decreased process quality, abnormal WT + MO2-itchb + MO4-tp53 standard conditions Fig. 3 with image from Angers et al., 2014
whole organism decreased length, abnormal WT + MO2-itchb + MO4-tp53 standard conditions Fig. 3 with image from Angers et al., 2014
axon extension decreased occurrence, abnormal WT + MO2-katna1 + MO4-tp53 standard conditions Fig. 2 with image from Butler et al., 2010
motor neuron axon decreased length, abnormal WT + MO2-katna1 + MO4-tp53 standard conditions Fig. 2 with image from Butler et al., 2010
gut morphology, abnormal WT + MO2-lrba + MO4-tp53 standard conditions Fig. 2 with image from Sribudiani et al., 2018
whole organism anterior-posterior axis decreased length, abnormal WT + MO2-lrba + MO4-tp53 standard conditions Fig. 2 with image from Sribudiani et al., 2018
melanocyte migration disrupted, abnormal WT + MO2-lrmda + MO4-tp53 standard conditions Fig. 4 from Gronskov et al., 2013
melanocyte decreased amount, abnormal WT + MO2-lrmda + MO4-tp53 standard conditions Fig. 4 from Gronskov et al., 2013
whole organism decreased pigmentation, abnormal WT + MO2-lrmda + MO4-tp53 standard conditions Fig. 4 from Gronskov et al., 2013
epidermis blistered, abnormal WT + MO2-lrmda + MO4-tp53 standard conditions Fig. 4 from Gronskov et al., 2013
intestinal epithelial structure maintenance decreased process quality, abnormal WT + MO2-mllt10 + MO4-tp53 standard conditions Fig. 9 with image from Mahmoudi et al., 2010
canonical Wnt signaling pathway decreased process quality, abnormal WT + MO2-mllt10 + MO4-tp53 standard conditions Fig. 9 with image from Mahmoudi et al., 2010
intestinal villus decreased length, abnormal WT + MO2-mllt10 + MO4-tp53 standard conditions Fig. 9 with image from Mahmoudi et al., 2010
intestine well differentiated, abnormal WT + MO2-mllt10 + MO4-tp53 standard conditions Fig. 8 with image from Mahmoudi et al., 2010
intestinal epithelium has fewer parts of type epithelial cell, abnormal WT + MO2-mllt10 + MO4-tp53 standard conditions Fig. 9 with image from Mahmoudi et al., 2010
heart edematous, abnormal WT + MO2-msi2b + MO4-tp53 standard conditions Fig. 7 from Hochgreb-Hägele et al., 2014
caudal fin atrophied, abnormal WT + MO2-msi2b + MO4-tp53 standard conditions Fig. 7 from Hochgreb-Hägele et al., 2014
eye atrophied, abnormal WT + MO2-msi2b + MO4-tp53 standard conditions Fig. 7 from Hochgreb-Hägele et al., 2014
whole organism axis shortened, abnormal WT + MO2-msi2b + MO4-tp53 standard conditions Fig. 7 from Hochgreb-Hägele et al., 2014
eye aplastic, abnormal WT + MO2-msi2b + MO4-tp53 standard conditions Fig. 7 from Hochgreb-Hägele et al., 2014
whole organism degenerate, abnormal WT + MO2-msi2b + MO4-tp53 standard conditions Fig. 7 from Hochgreb-Hägele et al., 2014
whole organism axis truncated, abnormal WT + MO2-msi2b + MO4-tp53 standard conditions Fig. 7 from Hochgreb-Hägele et al., 2014
fourth ventricle edematous, abnormal WT + MO2-msi2b + MO4-tp53 standard conditions Fig. 7 from Hochgreb-Hägele et al., 2014
ceratohyal cartilage angle palatoquadrate cartilage, abnormal WT + MO2-myt1a + MO4-tp53 standard conditions Fig. 2 from Lopez et al., 2016
ceratohyal cartilage flattened, abnormal WT + MO2-myt1a + MO4-tp53 standard conditions Fig. 2 from Lopez et al., 2016
ceratohyal cartilage angle ceratohyal cartilage, abnormal WT + MO2-myt1a + MO4-tp53 standard conditions Fig. 2 from Lopez et al., 2016
ceratohyal cartilage distance Meckel's cartilage, abnormal WT + MO2-myt1a + MO4-tp53 standard conditions Fig. 2 from Lopez et al., 2016
neutrophil decreased amount, abnormal WT + MO2-ncor2 + MO4-tp53 standard conditions Fig. 3 with image from Li et al., 2014
macrophage decreased amount, abnormal WT + MO2-ncor2 + MO4-tp53 standard conditions Fig. 3 with image from Li et al., 2014
pharyngeal arch cartilage decreased size, abnormal WT + MO2-ndst1a + MO4-tp53 standard conditions Fig. 6 with image from Filipek-Górniok et al., 2015
head decreased size, abnormal WT + MO2-ndst1a + MO4-tp53 standard conditions Fig. 6 with image from Filipek-Górniok et al., 2015
pectoral fin decreased length, abnormal WT + MO2-ndst1a + MO4-tp53 standard conditions Fig. 6 with image from Filipek-Górniok et al., 2015
ceratohyal bone mislocalised, abnormal WT + MO2-ndst1a + MO4-tp53 standard conditions Fig. 6 with image from Filipek-Górniok et al., 2015
eye decreased size, abnormal WT + MO2-ndst1a + MO4-tp53 standard conditions Fig. 6 with image from Filipek-Górniok et al., 2015
whole organism decreased length, abnormal WT + MO2-ndst1a + MO4-tp53 standard conditions Fig. 6 with image from Filipek-Górniok et al., 2015
whole organism has fewer parts of type swim bladder, abnormal WT + MO2-ndst1a + MO4-tp53 standard conditions Fig. 6 with image from Filipek-Górniok et al., 2015
Meckel's cartilage curved ventral, abnormal WT + MO2-nkx2-5 + MO4-tp53 standard conditions text only from Iklé et al., 2017
ceratobranchial cartilage hypoplastic, abnormal WT + MO2-nkx2-5 + MO4-tp53 standard conditions text only from Iklé et al., 2017
hyosymplectic cartilage hypoplastic, abnormal WT + MO2-nkx2-5 + MO4-tp53 standard conditions text only from Iklé et al., 2017
cranial cartilage hypoplastic, abnormal WT + MO2-nkx2-5 + MO4-tp53 standard conditions text only from Iklé et al., 2017
basihyal cartilage decreased size, abnormal WT + MO2-nkx2-5 + MO4-tp53 standard conditions text only from Iklé et al., 2017
palatoquadrate cartilage malformed, abnormal WT + MO2-nkx2-5 + MO4-tp53 standard conditions text only from Iklé et al., 2017
brain hemorrhagic, abnormal WT + MO2-nrp1a + MO4-tp53 control Fig. 4 with image from Hirota et al., 2015
brain vasculature broken, abnormal WT + MO2-nrp1a + MO4-tp53 control Fig. 4 with image from Hirota et al., 2015
brain vasculature development process quality, abnormal WT + MO2-nrp1a + MO4-tp53 control Fig. 4 with image from Hirota et al., 2015
cardiac muscle progenitor cell migration to the midline involved in heart field formation delayed, abnormal WT + MO2-paf1 + MO4-tp53 standard conditions Fig. 3 with image from Langenbacher et al., 2011
cardiac muscle cell decreased amount, abnormal WT + MO2-paf1 + MO4-tp53 standard conditions Fig. 3 with image from Langenbacher et al., 2011
heart hypoplastic, abnormal WT + MO2-paf1 + MO4-tp53 standard conditions Fig. 4 with image from Langenbacher et al., 2011
myocardial precursor decreased amount, abnormal WT + MO2-paf1 + MO4-tp53 standard conditions Fig. 3 with image from Langenbacher et al., 2011
embryonic heart tube morphogenesis disrupted, abnormal WT + MO2-paf1 + MO4-tp53 standard conditions Fig. 3 with image from Langenbacher et al., 2011
heart malformed, abnormal WT + MO2-paf1 + MO4-tp53 standard conditions Fig. 4 with image from Langenbacher et al., 2011
hyosymplectic cartilage decreased size, abnormal WT + MO2-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
ethmoid cartilage decreased size, abnormal WT + MO2-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
Meckel's cartilage decreased size, abnormal WT + MO2-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
ceratohyal cartilage decreased size, abnormal WT + MO2-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
cranial neural crest cell decreased amount, abnormal WT + MO2-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
notochord undulate, abnormal WT + MO2-pappa2 + MO4-tp53 standard conditions Fig. 3 with image from Kjaer-Sorensen et al., 2014
ceratohyal cartilage absent, abnormal WT + MO2-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
palatoquadrate arch decreased size, abnormal WT + MO2-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
Meckel's cartilage absent, abnormal WT + MO2-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
palatoquadrate arch absent, abnormal WT + MO2-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
pharyngeal arch 3-7 decreased size, abnormal WT + MO2-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
neurocranial trabecula absent, abnormal WT + MO2-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
hyosymplectic cartilage absent, abnormal WT + MO2-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
neurocranial trabecula decreased size, abnormal WT + MO2-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
trunk curved ventral, abnormal WT + MO2-pappa2 + MO4-tp53 standard conditions Fig. 3 with image from Kjaer-Sorensen et al., 2014
pericardium edematous, abnormal WT + MO2-pard6gb + MO4-tp53 standard conditions Fig. 7 from Slanchev et al., 2011
pronephros cystic, abnormal WT + MO2-pard6gb + MO4-tp53 standard conditions Fig. 7 from Slanchev et al., 2011
pronephric duct cilium disoriented, abnormal WT + MO2-pard6gb + MO4-tp53 standard conditions Fig. 7 from Slanchev et al., 2011
whole organism curved, abnormal WT + MO2-pard6gb + MO4-tp53 standard conditions Fig. 7 from Slanchev et al., 2011
notochord undulate, abnormal WT + MO2-pard6gb + MO4-tp53 standard conditions Fig. 7 from Slanchev et al., 2011
pronephric duct dilated, abnormal WT + MO2-pard6gb + MO4-tp53 standard conditions Fig. 7 from Slanchev et al., 2011
pericardium edematous, abnormal WT + MO2-pip4k2aa + MO4-tp53 standard conditions Fig. 2 from Elouarrat et al., 2013
embryo development disrupted, abnormal WT + MO2-pip4k2aa + MO4-tp53 standard conditions Fig. 2 from Elouarrat et al., 2013
whole organism morphology, abnormal WT + MO2-pip4k2aa + MO4-tp53 standard conditions Fig. 2 from Elouarrat et al., 2013
midbrain decreased size, abnormal WT + MO2-scgn + MO4-tp53 standard conditions Fig. 3 from Sifuentes-Dominguez et al., 2019
neuron differentiation increased occurrence, abnormal WT + MO2-scrt2 + MO4-tp53 standard conditions Fig. 2 from Rodríguez-Aznar et al., 2013
spinal cord has extra parts of type neuron, abnormal WT + MO2-scrt2 + MO4-tp53 standard conditions Fig. 2 from Rodríguez-Aznar et al., 2013
retina layer formation disrupted, abnormal WT + MO2-sec13 + MO4-tp53 standard conditions Fig. 2 with image from Schmidt et al., 2013
fin kinked, abnormal WT + MO2-sec13 + MO4-tp53 standard conditions Fig. 2 with image from Schmidt et al., 2013
glomerular filtration disrupted, abnormal WT + MO2-shroom3 + MO4-tp53 standard conditions Fig. 2Fig. 5Fig. S4 from Yeo et al., 2015
renal filtration disrupted, abnormal WT + MO2-shroom3 + MO4-tp53 standard conditions Fig. 4 from Prokop et al., 2018
pericardium edematous, abnormal WT + MO2-shroom3 + MO4-tp53 standard conditions Fig. 2Fig. S4 from Yeo et al., 2015
podocyte development disrupted, abnormal WT + MO2-shroom3 + MO4-tp53 standard conditions Fig. 5Fig. S4 from Yeo et al., 2015
pronephric glomerular basement membrane increased permeability, abnormal WT + MO2-shroom3 + MO4-tp53 standard conditions Fig. S4 from Yeo et al., 2015
head decreased size, abnormal WT + MO2-six6b + MO4-tp53 standard conditions Fig. 1 from Iglesias et al., 2014
mandibular arch skeleton shortened, abnormal WT + MO2-six6b + MO4-tp53 standard conditions Fig. 1 from Iglesias et al., 2014
eye decreased size, abnormal WT + MO2-six6b + MO4-tp53 standard conditions Fig. 1 from Iglesias et al., 2014
eye development delayed, abnormal WT + MO2-six6b + MO4-tp53 standard conditions Fig. 1 from Iglesias et al., 2014
pericardium edematous, abnormal WT + MO2-six6b + MO4-tp53 standard conditions Fig. 1 from Iglesias et al., 2014
pigmentation process quality, abnormal WT + MO2-six6b + MO4-tp53 standard conditions Fig. 1 from Iglesias et al., 2014
whole organism increased curvature, abnormal WT + MO2-socs4 + MO4-tp53 standard conditions Figure 2 with image from Trengove et al., 2022
post-vent region curved ventral, abnormal WT + MO2-socs4 + MO4-tp53 standard conditions Figure 2 with image from Trengove et al., 2022
motor neuron axon decreased length, abnormal WT + MO2-spast + MO4-tp53 standard conditions Fig. 2 with image from Butler et al., 2010
axon extension decreased occurrence, abnormal WT + MO2-spast + MO4-tp53 standard conditions Fig. 2 with image from Butler et al., 2010
paraventricular organ serotonin biosynthetic process disrupted, abnormal WT + MO2-th2 + MO4-tp53 standard conditions Fig. 4 from Ren et al., 2013
striated muscle cell decreased width, abnormal WT + MO2-tpcn2 + MO4-tp53 standard conditions Fig. 4 with image from Kelu et al., 2017
myotome decreased width, abnormal WT + MO2-tpcn2 + MO4-tp53 standard conditions Fig. 3 with imageFig. 4 with image from Kelu et al., 2017
striated muscle cell increased length, abnormal WT + MO2-tpcn2 + MO4-tp53 standard conditions Fig. 4 with image from Kelu et al., 2017
slow muscle cell skeletal muscle myofibril disorganized, abnormal WT + MO2-tpcn2 + MO4-tp53 standard conditions Fig. 3 with image from Kelu et al., 2017
slow muscle cell sarcomere morphology, abnormal WT + MO2-tpcn2 + MO4-tp53 standard conditions Fig. 3 with image from Kelu et al., 2017
slow muscle cell decreased amount, abnormal WT + MO2-tpcn2 + MO4-tp53 standard conditions Fig. 4 with image from Kelu et al., 2017
somite U-shaped, abnormal WT + MO2-tpcn2 + MO4-tp53 standard conditions Fig. 3 with imageFig. 4 with image from Kelu et al., 2017
somite condensed, abnormal WT + MO2-wnt5b + MO4-tp53 standard conditions Fig. 1 with image from Robu et al., 2007
post-vent region decreased length, abnormal WT + MO2-wnt5b + MO4-tp53 standard conditions Fig. 1 with image from Robu et al., 2007
whole organism decreased length, abnormal WT + MO2-wnt5b + MO4-tp53 standard conditions Fig. 1 with image from Robu et al., 2007
T cell differentiation in thymus disrupted, abnormal WT + MO3-agtpbp1 + MO4-tp53 standard conditions Fig. 6 with image from Seiler et al., 2015
thymus rag1 expression decreased amount, abnormal WT + MO3-agtpbp1 + MO4-tp53 standard conditions Fig. 6 with image from Seiler et al., 2015
thymocyte migration disrupted, abnormal WT + MO3-ccl25a + MO4-tp53 standard conditions Fig. 10 from Lu et al., 2012
head apoptotic process increased occurrence, abnormal WT + MO3-crispld2 + MO4-tp53 standard conditions Fig. 3 with image from Swindell et al., 2015
glomerular filtration process quality, abnormal WT + MO3-emp2 + MO4-tp53 standard conditions Fig. 2 from Gee et al., 2014
convergent extension process quality, abnormal WT + MO3-hipk2 + MO4-tp53 standard conditions Fig. 1 with image from Shimizu et al., 2014
canonical Wnt signaling pathway process quality, abnormal WT + MO3-hipk2 + MO4-tp53 standard conditions Fig. 1 with image from Shimizu et al., 2014
brain hemorrhagic, abnormal WT + MO3-itgb8 + MO4-tp53 control Fig. 4 with image from Hirota et al., 2015
brain vasculature broken, abnormal WT + MO3-itgb8 + MO4-tp53 control Fig. 4 with image from Hirota et al., 2015
brain vasculature development process quality, abnormal WT + MO3-itgb8 + MO4-tp53 control Fig. 4 with image from Hirota et al., 2015
gut morphology, abnormal WT + MO3-lrba + MO4-tp53 standard conditions Fig. 2 with image from Sribudiani et al., 2018
whole organism anterior-posterior axis decreased length, abnormal WT + MO3-lrba + MO4-tp53 standard conditions Fig. 2 with image from Sribudiani et al., 2018
ceratobranchial 3 cartilage aplastic, abnormal WT + MO3-lrp5 + MO4-lrp5 + MO4-tp53 standard conditions Fig. 2 with image from Willems et al., 2015
embryonic cranial skeleton morphogenesis process quality, abnormal WT + MO3-lrp5 + MO4-lrp5 + MO4-tp53 standard conditions Fig. 2 with image from Willems et al., 2015
cranium malformed, abnormal WT + MO3-lrp5 + MO4-lrp5 + MO4-tp53 standard conditions Fig. 2 with image from Willems et al., 2015
ceratobranchial 2 cartilage aplastic, abnormal WT + MO3-lrp5 + MO4-lrp5 + MO4-tp53 standard conditions Fig. 2 with image from Willems et al., 2015
ceratobranchial 1 cartilage aplastic, abnormal WT + MO3-lrp5 + MO4-lrp5 + MO4-tp53 standard conditions Fig. 2 with image from Willems et al., 2015
ceratobranchial 4 cartilage aplastic, abnormal WT + MO3-lrp5 + MO4-lrp5 + MO4-tp53 standard conditions Fig. 2 with image from Willems et al., 2015
caudal fin curved, abnormal WT + MO3-matn1 + MO4-tp53 standard conditions Fig. 3 from Neacsu et al., 2014
whole organism decreased size, abnormal WT + MO3-matn1 + MO4-tp53 standard conditions Fig. 3 from Neacsu et al., 2014
head malformed, abnormal WT + MO3-matn1 + MO4-tp53 standard conditions Fig. 3 from Neacsu et al., 2014
extension shortened, abnormal WT + MO3-matn1 + MO4-tp53 standard conditions Fig. 3 from Neacsu et al., 2014
trunk curved, abnormal WT + MO3-matn1 + MO4-tp53 standard conditions Fig. 3 from Neacsu et al., 2014
caudal fin deformed, abnormal WT + MO3-matn1 + MO4-tp53 standard conditions Fig. 3 from Neacsu et al., 2014
embryonic cranial skeleton morphogenesis process quality, ameliorated WT + MO3-nolc1 + MO4-tp53 standard conditions Fig. 2 with image from de Peralta et al., 2016
whole organism pmaip1 expression amount, ameliorated WT + MO3-nolc1 + MO4-tp53 standard conditions Fig. 2 with image from de Peralta et al., 2016
whole organism ccng1 expression increased amount, abnormal WT + MO3-nolc1 + MO4-tp53 standard conditions Fig. 2 with image from de Peralta et al., 2016
cranial cartilage morphology, ameliorated WT + MO3-nolc1 + MO4-tp53 standard conditions Fig. 2 with image from de Peralta et al., 2016
whole organism tp53inp1 expression amount, ameliorated WT + MO3-nolc1 + MO4-tp53 standard conditions Fig. 2 with image from de Peralta et al., 2016
apoptotic process process quality, ameliorated WT + MO3-nolc1 + MO4-tp53 standard conditions Fig. 2 with image from de Peralta et al., 2016
pronephric duct cilium decreased length, abnormal WT + MO3-nphp4 + MO4-tp53 standard conditions Fig. 3 from Slanchev et al., 2011
heart tube centered, abnormal WT + MO3-nphp4 + MO4-tp53 standard conditions Fig. 3 from Slanchev et al., 2011
brain hydrophilic, abnormal WT + MO3-nphp4 + MO4-tp53 standard conditions Fig. 2 from Slanchev et al., 2011
cloaca development disrupted, abnormal WT + MO3-nphp4 + MO4-tp53 standard conditions Fig. 4 from Slanchev et al., 2011
whole organism curved ventral, abnormal WT + MO3-nphp4 + MO4-tp53 standard conditions Fig. 2 from Slanchev et al., 2011
Kupffer's vesicle cilium decreased amount, abnormal WT + MO3-nphp4 + MO4-tp53 standard conditions Fig. 3 from Slanchev et al., 2011
heart looping disrupted, abnormal WT + MO3-nphp4 + MO4-tp53 standard conditions Fig. 3 from Slanchev et al., 2011
positive regulation of apoptotic process disrupted, abnormal WT + MO3-nphp4 + MO4-tp53 standard conditions Fig. 4 from Slanchev et al., 2011
pronephros cystic, abnormal WT + MO3-nphp4 + MO4-tp53 standard conditions Fig. 2 from Slanchev et al., 2011
pericardium edematous, abnormal WT + MO3-nphp4 + MO4-tp53 standard conditions Fig. 2 from Slanchev et al., 2011
pronephric duct dilated, abnormal WT + MO3-nphp4 + MO4-tp53 standard conditions Fig. 2 from Slanchev et al., 2011
proctodeum anatomical region unfused from cloacal chamber, abnormal WT + MO3-nphp4 + MO4-tp53 standard conditions Fig. 4 from Slanchev et al., 2011
pronephric duct cilium curved, abnormal WT + MO3-nphp4 + MO4-tp53 standard conditions Fig. 3 from Slanchev et al., 2011
pronephric duct cilium disoriented, abnormal WT + MO3-nphp4 + MO4-tp53 standard conditions Fig. 3 from Slanchev et al., 2011
Kupffer's vesicle decreased size, abnormal WT + MO3-nphp4 + MO4-tp53 standard conditions Fig. 3Fig. S2 from Slanchev et al., 2011
heart tube left side of axis, abnormal WT + MO3-nphp4 + MO4-tp53 standard conditions Fig. 3 from Slanchev et al., 2011
hyosymplectic cartilage decreased size, abnormal WT + MO3-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
ethmoid cartilage decreased size, abnormal WT + MO3-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
Meckel's cartilage decreased size, abnormal WT + MO3-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
ceratohyal cartilage decreased size, abnormal WT + MO3-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
cranial neural crest cell decreased amount, abnormal WT + MO3-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
notochord undulate, abnormal WT + MO3-pappa2 + MO4-tp53 standard conditions Fig. 3 with image from Kjaer-Sorensen et al., 2014
ceratohyal cartilage absent, abnormal WT + MO3-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
palatoquadrate arch decreased size, abnormal WT + MO3-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
Meckel's cartilage absent, abnormal WT + MO3-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
palatoquadrate arch absent, abnormal WT + MO3-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
hyosymplectic cartilage absent, abnormal WT + MO3-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
neurocranial trabecula absent, abnormal WT + MO3-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
neurocranial trabecula decreased size, abnormal WT + MO3-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
pharyngeal arch 3-7 decreased size, abnormal WT + MO3-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
trunk curved ventral, abnormal WT + MO3-pappa2 + MO4-tp53 standard conditions Fig. 3 with image from Kjaer-Sorensen et al., 2014
intestinal epithelium has fewer parts of type epithelial cell, abnormal WT + MO3-tcf7l2 + MO4-tp53 standard conditions Fig. 9 with image from Mahmoudi et al., 2010
intestine well differentiated, abnormal WT + MO3-tcf7l2 + MO4-tp53 standard conditions Fig. 8 with image from Mahmoudi et al., 2010
intestinal epithelial structure maintenance decreased process quality, abnormal WT + MO3-tcf7l2 + MO4-tp53 standard conditions Fig. 9 with image from Mahmoudi et al., 2010
intestinal villus decreased length, abnormal WT + MO3-tcf7l2 + MO4-tp53 standard conditions Fig. 9 with image from Mahmoudi et al., 2010
canonical Wnt signaling pathway decreased process quality, abnormal WT + MO3-tcf7l2 + MO4-tp53 standard conditions Fig. 9 with image from Mahmoudi et al., 2010
whole organism egr2a expression decreased amount, abnormal WT + MO4-apex1 + MO4-tp53 control Fig. 4 with image from Pei et al., 2019
whole organism mdm2 expression increased amount, abnormal WT + MO4-apex1 + MO4-tp53 control Fig. 4 with image from Pei et al., 2019
whole organism creb1a expression decreased amount, abnormal WT + MO4-apex1 + MO4-tp53 control Fig. 4 with image from Pei et al., 2019
whole organism polb expression decreased amount, abnormal WT + MO4-apex1 + MO4-tp53 control Fig. 4 with image from Pei et al., 2019
whole organism ogg1 expression decreased amount, abnormal WT + MO4-apex1 + MO4-tp53 control Fig. 4 with image from Pei et al., 2019
whole organism apex1 expression decreased amount, abnormal WT + MO4-apex1 + MO4-tp53 control Fig. 4 with image from Pei et al., 2019
whole organism tp53 expression increased amount, abnormal WT + MO4-apex1 + MO4-tp53 control Fig. 4 with image from Pei et al., 2019
whole organism cdkn1a expression increased amount, abnormal WT + MO4-apex1 + MO4-tp53 control Fig. 4 with image from Pei et al., 2019
thymocyte migration disrupted, abnormal WT + MO4-ccl25a + MO4-tp53 standard conditions Fig. 10 from Lu et al., 2012
glomerular filtration process quality, abnormal WT + MO4-emp2 + MO4-tp53 standard conditions Fig. 2 from Gee et al., 2014
cell increased size, abnormal WT + MO4-fbxo5 + MO4-tp53 standard conditions Fig. 3 with image from Robu et al., 2012
erythroblast decreased amount, abnormal WT + MO4-gfi1b + MO4-tp53 + MO5-gfi1b control Fig. 5 with image from Thambyrajah et al., 2016
convergent extension process quality, abnormal WT + MO4-hipk2 + MO4-tp53 standard conditions Fig. 1 with image from Shimizu et al., 2014
canonical Wnt signaling pathway process quality, abnormal WT + MO4-hipk2 + MO4-tp53 standard conditions Fig. 1 with image from Shimizu et al., 2014
intermediate cell mass of mesoderm neutrophil absent, abnormal WT + MO4-sbds + MO4-tp53 standard conditions Fig. 3 with image from Provost et al., 2012
somite shape, abnormal WT + MO4-smo + MO4-tp53 standard conditions Fig. 1 with image from Robu et al., 2007
spinal cord curved, abnormal WT + MO4-smo + MO4-tp53 standard conditions Fig. 1 with image from Robu et al., 2007
pharyngeal arch 2 malformed, abnormal WT + MO4-tbx2a + MO4-tp53 standard conditions Fig. 3 with image from Thi Thu et al., 2013
pharyngeal arch disorganized, abnormal WT + MO4-tbx2a + MO4-tp53 standard conditions Fig. 3 with image from Thi Thu et al., 2013
pharyngeal arch malformed, abnormal WT + MO4-tbx2a + MO4-tp53 standard conditions Fig. 3 with image from Thi Thu et al., 2013
whole organism decreased sensitivity to irradiation, abnormal WT + MO4-tp53 radiation Fig. S6 with image from Sidi et al., 2008
double-strand break repair via nonhomologous end joining increased frequency, abnormal WT + MO4-tp53 standard conditions Fig. 1 from Gong et al., 2015
double-strand break repair via single-strand annealing increased frequency, abnormal WT + MO4-tp53 standard conditions Fig. 1 from Gong et al., 2015
whole organism mdm2 expression increased amount, abnormal WT + MO4-tp53 control Fig. 4 with image from Pei et al., 2019
whole organism hsf1 expression increased amount, abnormal WT + MO4-tp53 heat exposure Fig. 5 from Gong et al., 2019
whole organism tp53 expression increased amount, abnormal WT + MO4-tp53 control Fig. 4 with image from Pei et al., 2019
whole organism cdkn1a expression increased amount, abnormal WT + MO4-tp53 control Fig. 4 with image from Pei et al., 2019
apoptotic process disrupted, abnormal WT + MO4-tp53 radiation Fig. S6 with image from Sidi et al., 2008
double-strand break repair via homologous recombination increased frequency, abnormal WT + MO4-tp53 standard conditions Fig. 1 from Gong et al., 2015
whole organism semi-viable, abnormal WT + MO4-tp53 x-ray Fig. 1 from Davidson et al., 2008
whole organism gadd45bb expression decreased amount, abnormal WT + MO4-tp53 standard conditions Fig. 4 from Zhai et al., 2019
nucleate erythrocyte immature, abnormal WT + MO4-tp53 standard conditions Fig. 5 with image from Imamura et al., 2008
intestine well differentiated, abnormal WT + MO4-tp53 standard conditions Fig. 8 with image from Mahmoudi et al., 2010
whole organism hspa8 expression increased amount, abnormal WT + MO4-tp53 heat exposure Fig. 5 from Gong et al., 2019
whole organism notch1b expression decreased amount, abnormal WT + MO4-tp53 standard conditions Fig. 4 from Espanola et al., 2020
apoptotic process decreased occurrence, abnormal WT + MO4-tp53 standard conditions Fig. S3 with image from Chakraborty et al., 2009
Fig. S4 from Zeng et al., 2007
response to X-ray disrupted, abnormal WT + MO4-tp53 x-ray Fig. 1 from Davidson et al., 2008
regulation of canonical Wnt signaling pathway disrupted, abnormal WT + MO4-tp53 + MO5-insm1a standard conditions Fig. 6 with image from He et al., 2017
posterior lateral line primordium lef1 expression increased distribution, abnormal WT + MO4-tp53 + MO5-insm1a standard conditions Fig. 6 with image from He et al., 2017
posterior lateral line primordium cxcr4b expression increased amount, abnormal WT + MO4-tp53 + MO5-insm1a standard conditions Fig. 5 with image from He et al., 2017
posterior lateral line primordium axin2 expression increased distribution, abnormal WT + MO4-tp53 + MO5-insm1a standard conditions Fig. 6 with image from He et al., 2017
posterior lateral line primordium ackr3b expression decreased amount, abnormal WT + MO4-tp53 + MO5-insm1a standard conditions Fig. 5 with image from He et al., 2017
myoseptum cxcl12a expression decreased amount, abnormal WT + MO4-tp53 + MO5-insm1a standard conditions Fig. 5 with image from He et al., 2017
posterior lateral line primordium etv4 expression decreased amount, abnormal WT + MO4-tp53 + MO5-insm1a standard conditions Fig. 6 with image from He et al., 2017
posterior lateral line neuromast mislocalised, abnormal WT + MO4-tp53 + MO5-prnprs3 standard conditions Fig. 2 with image from Huc-Brandt et al., 2014
posterior lateral line has fewer parts of type posterior lateral line neuromast, abnormal WT + MO4-tp53 + MO5-prnprs3 standard conditions Fig. 2 with image from Huc-Brandt et al., 2014
posterior lateral line development decreased process quality, abnormal WT + MO4-tp53 + MO5-prnprs3 standard conditions Fig. 2 with image from Huc-Brandt et al., 2014
blood island increased size, abnormal WT + MO4-tp53 + MO5-smoc2 standard conditions Fig. 2 with image from Mommaerts et al., 2014
myeloid cell development process quality, abnormal WT + MO4-tp53 + MO5-smoc2 standard conditions Fig. 6 with imageFig. 8 with image from Mommaerts et al., 2014
whole organism anterior-posterior axis decreased length, abnormal WT + MO4-tp53 + MO5-smoc2 standard conditions Fig. 2 with image from Mommaerts et al., 2014
blood circulation delayed, abnormal WT + MO4-tp53 + MO5-smoc2 standard conditions Fig. 2 with image from Mommaerts et al., 2014
BMP signaling pathway decreased process quality, abnormal WT + MO4-tp53 + MO5-smoc2 standard conditions Fig. 11 with image from Mommaerts et al., 2014
hemopoiesis process quality, abnormal WT + MO4-tp53 + MO5-smoc2 standard conditions Fig. 5 with imageFig. 6 with image from Mommaerts et al., 2014
caudal fin curved ventral, abnormal WT + MO4-tp53 + MO5-smoc2 standard conditions Fig. 2 with image from Mommaerts et al., 2014
somite shape, abnormal WT + MO4-tp53 + MO5-smoc2 standard conditions Fig. 2 with image from Mommaerts et al., 2014
extension decreased length, abnormal WT + MO4-tp53 + MO5-smoc2 standard conditions Fig. 2 with image from Mommaerts et al., 2014
skeletal muscle cell morphology, abnormal WT + MO4-tp53 + MO6-myod1 standard conditions Fig. 11 from Chuang et al., 2014
blood circulation delayed, abnormal WT + MO4-tp53 + MO6-smoc2 standard conditions Fig. 2 with image from Mommaerts et al., 2014
blood island increased size, abnormal WT + MO4-tp53 + MO6-smoc2 standard conditions Fig. 2 with image from Mommaerts et al., 2014
extension decreased length, abnormal WT + MO4-tp53 + MO6-smoc2 standard conditions Fig. 2 with image from Mommaerts et al., 2014
caudal fin curved ventral, abnormal WT + MO4-tp53 + MO6-smoc2 standard conditions Fig. 2 with image from Mommaerts et al., 2014
brain hemorrhagic, abnormal WT + MO4-tp53 + MO8-nrp1a control Fig. 4 with image from Hirota et al., 2015
brain vasculature broken, abnormal WT + MO4-tp53 + MO8-nrp1a control Fig. 4 with image from Hirota et al., 2015
brain vasculature development process quality, abnormal WT + MO4-tp53 + MO8-nrp1a control Fig. 4 with image from Hirota et al., 2015
optic tectum neuron decreased amount, abnormal as8Tg + MO1-cdk10 + MO4-tp53 standard conditions Fig. 8 from Yeh et al., 2013
olfactory bulb disorganized, abnormal as8Tg + MO1-cdk10 + MO4-tp53 standard conditions Fig. 8 from Yeh et al., 2013
neural tube neuron decreased amount, abnormal as8Tg + MO1-cdk10 + MO4-tp53 standard conditions Fig. 8 from Yeh et al., 2013
hindbrain neuron decreased amount, abnormal as8Tg + MO1-cdk10 + MO4-tp53 standard conditions Fig. 8 from Yeh et al., 2013
retinal ganglion cell decreased amount, abnormal as8Tg + MO1-cdk10 + MO4-tp53 standard conditions Fig. 8 from Yeh et al., 2013
telencephalon disorganized, abnormal as8Tg + MO1-cdk10 + MO4-tp53 standard conditions Fig. 8 from Yeh et al., 2013
telencephalon neuron decreased amount, abnormal as8Tg + MO1-cdk10 + MO4-tp53 standard conditions Fig. 8 from Yeh et al., 2013
cranial neural crest cell cell population proliferation decreased process quality, abnormal ba2Tg + MO1-hcfc1b + MO4-tp53 standard conditions Fig. 5 with image from Quintana et al., 2014
chondrocranium cartilage malformed, abnormal ba4Tg + MO1-rbms3 + MO4-tp53 standard conditions Fig. 6 with image from Jayasena et al., 2012
embryonic viscerocranium morphogenesis decreased process quality, abnormal ba4Tg + MO1-rbms3 + MO4-tp53 standard conditions Fig. 6 with image from Jayasena et al., 2012
posterior lateral line axon defasciculated, abnormal ba4Tg + MO4-tp53 + MO5-prnprs3 standard conditions Fig. 8 with image from Huc-Brandt et al., 2014
posterior lateral line increased diameter, abnormal ba4Tg + MO4-tp53 + MO5-prnprs3 standard conditions Fig. 8 with image from Huc-Brandt et al., 2014
posterior lateral line development decreased process quality, abnormal ba4Tg + MO4-tp53 + MO5-prnprs3 standard conditions Fig. 8 with image from Huc-Brandt et al., 2014
posterior lateral line primordium circular, abnormal ba4Tg + MO4-tp53 + MO5-prnprs3 standard conditions Fig. 8 with image from Huc-Brandt et al., 2014
myelination of posterior lateral line nerve axons decreased occurrence, abnormal ba4Tg + MO4-tp53 + MO5-prnprs3 standard conditions Fig. 8 with image from Huc-Brandt et al., 2014
heart looping disrupted, abnormal chb1Tg + MO1-nucleolin + MO4-tp53 standard conditions Fig. 4 from Monte et al., 2013
cardiac ventricle decreased size, abnormal chb1Tg + MO1-nucleolin + MO4-tp53 standard conditions Fig. 4 from Monte et al., 2013
erythroid lineage cell decreased amount, abnormal cz3325Tg + MO1-pi4kaa + MO4-tp53 control Fig. 5 from Ziyad et al., 2018
swim bladder absent, abnormal em2Tg + MO1-ihha + MO4-tp53 standard conditions Fig. 4 with image from Sribudiani et al., 2018
enteric neuron decreased amount, abnormal em2Tg + MO1-ihha + MO4-tp53 standard conditions Fig. 4 with image from Sribudiani et al., 2018
trunk increased curvature, abnormal em2Tg + MO1-ihha + MO4-tp53 standard conditions Fig. 4 with image from Sribudiani et al., 2018
head morphology, abnormal em2Tg + MO1-ihha + MO4-tp53 standard conditions Fig. 4 with image from Sribudiani et al., 2018
eye decreased size, abnormal em2Tg + MO1-ihha + MO4-tp53 standard conditions Fig. 4 with image from Sribudiani et al., 2018
intestine distal region lacks all parts of type enteric neuron, abnormal em2Tg + MO1-ncln + MO4-tp53 standard conditions Fig. 1 with image from Gui et al., 2017
intestine distal region lacks all parts of type enteric neuron, abnormal em2Tg + MO1-tbata + MO4-tp53 standard conditions Fig. 1 with image from Gui et al., 2017
intestine distal region lacks all parts of type enteric neuron, abnormal em2Tg + MO3-nup98 + MO4-tp53 standard conditions Fig. 1 with image from Gui et al., 2017
atrium elongated, abnormal f1Tg + MO2-flncb + MO4-tp53 standard conditions Fig. 4 with image from Begay et al., 2016
blood circulation disrupted, abnormal f1Tg + MO2-flncb + MO4-tp53 standard conditions Fig. SVideo3 from Begay et al., 2016
blood circulation arrested, abnormal f1Tg + MO2-flncb + MO4-tp53 standard conditions Fig. SVideo3 from Begay et al., 2016
pericardium edematous, abnormal f1Tg + MO2-flncb + MO4-tp53 standard conditions Fig. 4 with image from Begay et al., 2016
cardiac ventricle truncated, abnormal f1Tg + MO2-flncb + MO4-tp53 standard conditions Fig. 4 with image from Begay et al., 2016
heart looping disrupted, abnormal f1Tg + MO2-flncb + MO4-tp53 standard conditions Fig. 4 with image from Begay et al., 2016
cardiac muscle cell increased amount, abnormal f2Tg + MO1-rdh10a + MO2-rdh10a + MO4-tp53 standard conditions Fig. 3 with image from D'Aniello et al., 2015
cardiac ventricle cardiac muscle cell increased amount, abnormal f2Tg + MO1-rdh10a + MO2-rdh10a + MO4-tp53 standard conditions Fig. 3 with image from D'Aniello et al., 2015
atrium cardiac muscle cell increased amount, abnormal f2Tg + MO1-rdh10a + MO2-rdh10a + MO4-tp53 standard conditions Fig. 3 with image from D'Aniello et al., 2015
heart looping decreased process quality, abnormal f2Tg + MO1-scn5lab + MO4-tp53 standard conditions Fig. 1 from Bennett et al., 2013
heart has fewer parts of type cardiac muscle cell, abnormal f2Tg + MO1-scn5lab + MO4-tp53 standard conditions Fig. 1 from Bennett et al., 2013
cardiac muscle cell proliferation decreased process quality, abnormal f2Tg + MO1-scn5lab + MO4-tp53 standard conditions Fig. 6 from Bennett et al., 2013
cardiac ventricle has extra parts of type cardiac muscle cell, abnormal f2Tg + MO1-tcf7l1a + MO4-tp53 standard conditions Fig. 1 with image from Sorrell et al., 2013
heart increased size, abnormal f2Tg + MO1-tcf7l1a + MO4-tp53 standard conditions Fig. 1 with image from Sorrell et al., 2013
heart linear, abnormal f2Tg + MO1-tcf7l1a + MO4-tp53 standard conditions Fig. 1 with image from Sorrell et al., 2013
atrium has extra parts of type cardiac muscle cell, abnormal f2Tg + MO1-tcf7l1a + MO4-tp53 standard conditions Fig. 1 with image from Sorrell et al., 2013
heart has extra parts of type cardiac muscle cell, abnormal f2Tg + MO1-tcf7l1a + MO4-tp53 standard conditions Fig. 1 with image from Sorrell et al., 2013
atrium has extra parts of type cardiac muscle cell, abnormal f2Tg + MO1-tcf7l1b + MO4-tp53 standard conditions Fig. 1 with image from Sorrell et al., 2013
heart has extra parts of type cardiac muscle cell, abnormal f2Tg + MO1-tcf7l1b + MO4-tp53 standard conditions Fig. 1 with image from Sorrell et al., 2013
heart linear, abnormal f2Tg + MO1-tcf7l1b + MO4-tp53 standard conditions Fig. 1 with image from Sorrell et al., 2013
heart increased size, abnormal f2Tg + MO1-tcf7l1b + MO4-tp53 standard conditions Fig. 1 with image from Sorrell et al., 2013
cardiac ventricle has extra parts of type cardiac muscle cell, abnormal f2Tg + MO1-tcf7l1b + MO4-tp53 standard conditions Fig. 1 with image from Sorrell et al., 2013
cardiac ventricle has extra parts of type cardiac muscle cell, abnormal f2Tg + MO2-rarab + MO4-tp53 standard conditions Fig. 2 with imageFig. 5 with imageFig. 6 with image from D'Aniello et al., 2013
heart has extra parts of type cardiac muscle cell, abnormal f2Tg + MO2-rarab + MO4-tp53 standard conditions Fig. 2 with imageFig. 5 with imageFig. 6 with image from D'Aniello et al., 2013
heart increased size, abnormal f2Tg + MO2-rarab + MO4-tp53 standard conditions Fig. 2 with image from D'Aniello et al., 2013
atrium has extra parts of type cardiac muscle cell, abnormal f2Tg + MO2-rarab + MO4-tp53 standard conditions Fig. 2 with imageFig. 5 with imageFig. 6 with image from D'Aniello et al., 2013
presumptive bulbus arteriosus ripply3 expression increased amount, abnormal fb7Tg + MO1-hdac1 + MO4-tp53 standard conditions Fig 7 with image from Song et al., 2019
presumptive bulbus arteriosus cdkn1a expression increased amount, abnormal fb7Tg + MO1-hdac1 + MO4-tp53 standard conditions Fig 5 with image from Song et al., 2019
liver DsRed expression decreased amount, abnormal gz15Tg + MO1-id2a + MO4-tp53 standard conditions Fig. S1 with image from Khaliq et al., 2015
liver decreased size, abnormal gz15Tg + MO1-id2a + MO4-tp53 standard conditions Fig. S1 with image from Khaliq et al., 2015
endoderm increased width, abnormal ha01Tg + MO1-fn1a + MO4-tp53 standard conditions Fig. S6 with image from Hu et al., 2018
endoderm increased width, abnormal ha01Tg + MO1-lamb1a + MO4-tp53 standard conditions Fig. S6 with image from Hu et al., 2018
calcium-mediated signaling decreased process quality, abnormal hkz100Tg + MO1-tpcn2 + MO4-tp53 standard conditions Fig. 1 from Kelu et al., 2015
slow muscle cell calcium-mediated signaling process quality, ameliorated hkz100Tg + MO1-tpcn2 + MO4-tp53 (AB) chemical treatment by environment: D-myo-Ins(1,4,5)P3 hexakis(butyryloxymethyl) ester Fig. 7 from Kelu et al., 2017
slow muscle cell calcium-mediated signaling process quality, ameliorated hkz100Tg + MO1-tpcn2 + MO4-tp53 (AB) chemical treatment by environment: caffeine Fig. 7 from Kelu et al., 2017
slow muscle cell calcium-mediated signaling process quality, abnormal hkz100Tg + MO1-tpcn2 + MO4-tp53 (AB) control Fig. 7 from Kelu et al., 2017
cilium movement arrested, abnormal hsc5Tg + MO1-ccsapb + MO4-tp53 standard conditions Fig. 6 from Backer et al., 2012
neutrophil phagocytosis decreased process quality, abnormal i114Tg + MO1-duox + MO4-tp53 standard conditions Fig. 4 with image from Brothers et al., 2013
defense response to fungus process quality, abnormal i114Tg + MO1-duox + MO4-tp53 standard conditions Fig. 4 with imageFig. 5 with image from Brothers et al., 2013
neutrophil chemotaxis process quality, abnormal i114Tg + MO1-duox + MO4-tp53 standard conditions Fig. 4 with image from Brothers et al., 2013
neutrophil chemotaxis decreased process quality, abnormal i114Tg + MO1-duox + MO4-tp53 amputation: caudal fin Fig. 2 from de Oliveira et al., 2014
neutrophil decreased amount, abnormal i114Tg + MO4-tp53 + MO5-smoc2 standard conditions Fig. 8 with image from Mommaerts et al., 2014
fast muscle cell muscle cell development decreased process quality, abnormal i135Tg + MO1-six1a + MO4-tp53 standard conditions Fig. 2 with image from Nord et al., 2013
fast muscle cell muscle cell development decreased process quality, abnormal i135Tg + MO4-six1b + MO4-tp53 standard conditions Fig. 2 with image from Nord et al., 2013
slow muscle cell GCaMP expression spatial pattern, abnormal i280Tg + MO1-cd38 + MO4-tp53 control Fig. 6 from Kelu et al., 2018
slow muscle cell calcium-mediated signaling decreased frequency, abnormal i280Tg + MO1-cd38 + MO4-tp53 standard conditions Fig. 6 from Kelu et al., 2018
slow muscle cell calcium-mediated signaling decreased process quality, abnormal i280Tg + MO1-cd38 + MO4-tp53 standard conditions Fig. 6 from Kelu et al., 2018
slow muscle cell GCaMP expression decreased amount, abnormal i280Tg + MO1-cd38 + MO4-tp53 control Fig. 6 from Kelu et al., 2018
neural crest cell cell growth decreased rate, abnormal ioz16Tg + MO1-vwa1 + MO4-tp53 control FIGURE 6 with image from Wang et al., 2020
pharyngeal arch decreased size, abnormal ir937Tg + MO1-fscn1a + MO4-tp53 standard conditions Fig. 4 with image from Boer et al., 2016
pharyngeal pouch neural crest cell migration decreased occurrence, abnormal ir937Tg + MO1-fscn1a + MO4-tp53 standard conditions Fig. 3 with image from Boer et al., 2016
ventral mandibular arch decreased size, abnormal ir937Tg + MO1-fscn1a + MO4-tp53 standard conditions Fig. 4 with image from Boer et al., 2016
pharyngeal pouch neural crest cell migration process quality, abnormal ir937Tg + MO1-fscn1a + MO4-tp53 standard conditions Fig. 3 with image from Boer et al., 2016
pronephric glomerulus podocyte foot morphology, abnormal ki1Tg + MO1-abtb1 + MO4-tp53 standard conditions Fig. S3 from Guo et al., 2020
glomerular basement membrane disorganized, abnormal ki1Tg + MO1-abtb1 + MO4-tp53 standard conditions Fig. S3 from Guo et al., 2020
pronephric glomerulus vascular endothelium deformed, abnormal ki1Tg + MO1-abtb1 + MO4-tp53 standard conditions Fig. S3 from Guo et al., 2020
pericardium edematous, abnormal ki1Tg + MO1-abtb1 + MO4-tp53 standard conditions Fig. S3 from Guo et al., 2020
pronephric glomerulus EGFP expression decreased amount, abnormal ki1Tg + MO1-abtb1 + MO4-tp53 standard conditions Fig. S3 from Guo et al., 2020
whole organism EGFP expression decreased amount, abnormal ki1Tg + MO1-tmem234 + MO4-tp53 standard conditions Fig. 11 from Rodriguez et al., 2015
pericardium edematous, abnormal ki1Tg + MO1-tmem234 + MO4-tp53 standard conditions Fig. 11 from Rodriguez et al., 2015
pronephric podocyte EGFP expression absent, abnormal ki1Tg + MO1-tmem234 + MO4-tp53 standard conditions Fig. 11 from Rodriguez et al., 2015
pericardium edematous, abnormal ki1Tg + MO2-abtb1 + MO4-tp53 standard conditions Fig. S3 from Guo et al., 2020
pronephric glomerulus EGFP expression decreased amount, abnormal ki1Tg + MO2-abtb1 + MO4-tp53 standard conditions Fig. S3 from Guo et al., 2020
canonical Wnt signaling pathway process quality, abnormal kyu2Tg + MO3-hipk2 + MO4-tp53 standard conditions Fig. 1 with image from Shimizu et al., 2014
canonical Wnt signaling pathway process quality, abnormal kyu2Tg + MO4-hipk2 + MO4-tp53 standard conditions Fig. 1 with image from Shimizu et al., 2014
pronephric duct cystic, abnormal li1Tg + MO1-cby1 + MO4-tp53 (AB/TL) control Figure 2 with image from Epting et al., 2020
trunk curved, abnormal li1Tg + MO1-cby1 + MO4-tp53 (AB/TL) control Figure 2 with image from Epting et al., 2020
whole organism Ab1-cby1 labeling decreased amount, abnormal li1Tg + MO1-cby1 + MO4-tp53 (AB/TL) control Fig. S2 from Epting et al., 2020
pronephric duct cystic, abnormal li1Tg + MO1-glis2b + MO4-tp53 standard conditions Fig. 3 from Ramachandran et al., 2014
pronephric glomerulus kif21a expression decreased amount, abnormal li1Tg + MO1-kif21a + MO4-tp53 standard conditions Figure 2 with image from Riedmann et al., 2023
whole organism curved ventral, abnormal li1Tg + MO1-nphp1 + MO4-tp53 standard conditions Fig. 6 from Slanchev et al., 2011
pronephros cystic, abnormal li1Tg + MO1-nphp1 + MO4-tp53 standard conditions Fig. 2 with image from Viau et al., 2018
ventricular system swollen, abnormal li1Tg + MO1-tmem218 + MO4-tp53 (AB/TL) control Fig. 4 from Epting et al., 2022
pronephros cystic, abnormal li1Tg + MO1-tmem218 + MO4-tp53 (AB/TL) control Fig. 4 from Epting et al., 2022
pronephric glomerulus swollen, abnormal li1Tg + MO1-tmem218 + MO4-tp53 (AB/TL) control Fig. 4 from Epting et al., 2022
ventricular system cerebrospinal fluid circulation decreased process quality, abnormal li1Tg + MO1-tmem218 + MO4-tp53 (AB/TL) control Fig. 4 from Epting et al., 2022
pronephric duct cystic, abnormal li1Tg + MO1-trim32 + MO4-tp53 standard conditions Fig. 3 from Ramachandran et al., 2014
pronephric duct cystic, abnormal li1Tg + MO2-cby1 + MO4-tp53 (AB/TL) control Figure 2 with image from Epting et al., 2020
trunk curved, abnormal li1Tg + MO2-cby1 + MO4-tp53 (AB/TL) control Figure 2 with image from Epting et al., 2020
pronephros cystic, abnormal li1Tg + MO2-glis2a + MO4-tp53 standard conditions Fig. 3 with image from Ramachandran et al., 2016
pronephric glomerulus kif21a expression decreased amount, abnormal li1Tg + MO2-kif21a + MO4-tp53 standard conditions Figure 2 with image from Riedmann et al., 2023
pronephric tubule morphology, ameliorated li1Tg + MO3-mdm2 + MO4-tp53 standard conditions Fig. 2 with image from Thomasova et al., 2016
pronephric tubule epithelial cell ab1-atp1a1 labeling amount, ameliorated li1Tg + MO3-mdm2 + MO4-tp53 standard conditions Fig. 2 with image from Thomasova et al., 2016
renal capsular space morphology, ameliorated li1Tg + MO3-mdm2 + MO4-tp53 standard conditions Fig. SMovie2 from Thomasova et al., 2016
pronephric glomerulus cystic, abnormal li1Tg + MO3-nphp4 + MO4-tp53 standard conditions Fig. 2 from Slanchev et al., 2011
heart tube centered, abnormal li1Tg + MO3-nphp4 + MO4-tp53 standard conditions Fig. 6 from Slanchev et al., 2011
heart tube left side of axis, abnormal li1Tg + MO3-nphp4 + MO4-tp53 standard conditions Fig. 6 from Slanchev et al., 2011
whole organism curved ventral, abnormal li1Tg + MO3-nphp4 + MO4-tp53 standard conditions Fig. 6 from Slanchev et al., 2011
RoP motor neuron decreased amount, abnormal mi2001Tg + MO1-lamc3 + MO4-tp53 standard conditions Fig. 4 with image from Eve et al., 2017
primary motor neuron shape, abnormal mi2001Tg + MO1-lamc3 + MO4-tp53 standard conditions Fig. 4 with image from Eve et al., 2017
CaP motoneuron increased branchiness, abnormal mi2001Tg + MO1-lamc3 + MO4-tp53 standard conditions Fig. 4 with image from Eve et al., 2017
CaP motoneuron axon length, ameliorated ml2Tg + MO1-gmppb + MO4-tp53 chemical treatment by injection: GDP-mannose Fig. 7 from Zheng et al., 2021
CaP motoneuron axon decreased length, abnormal ml2Tg + MO1-gmppb + MO4-tp53 standard conditions Fig. 7 from Zheng et al., 2021
rhombomere anatomical compartment boundary d2EGFP expression decreased amount, abnormal mw50Tg + MO1-rac3b + MO4-tp53 control Fig. 3 with image from Voltes et al., 2019
eye decreased size, abnormal mw50Tg + MO1-yap1 + MO4-tp53 standard conditions Fig. 4 from Miesfeld et al., 2014
trunk musculature striated muscle cell d2EGFP expression decreased amount, abnormal mw50Tg + MO1-yap1 + MO4-tp53 standard conditions Fig. 4 from Miesfeld et al., 2014
heart d2EGFP expression decreased amount, abnormal mw50Tg + MO1-yap1 + MO4-tp53 standard conditions Fig. 4 from Miesfeld et al., 2014
retinal pigmented epithelium d2EGFP expression decreased amount, abnormal mw50Tg + MO1-yap1 + MO4-tp53 standard conditions Fig. 4 from Miesfeld et al., 2014
somite TagRFP expression mislocalised, abnormal nim5Tg + MO1-lamc3 + MO4-tp53 standard conditions Fig. 4 with image from Eve et al., 2017
slow muscle cell TagRFP expression increased distribution, abnormal nim5Tg + MO1-lamc3 + MO4-tp53 standard conditions Fig. 4 with image from Eve et al., 2017
forebrain mitotic cell cycle increased process quality, abnormal nl1Tg + MO1-tubgcp2 + MO4-tp53 (AB/TL) control Fig. 3 with image from Bartoszewski et al., 2022
midbrain mitotic cell cycle increased process quality, abnormal nl1Tg + MO1-tubgcp2 + MO4-tp53 (AB/TL) control Fig. 3 with image from Bartoszewski et al., 2022
optic tectum increased area, abnormal nl1Tg + MO2-klhl13 + MO4-tp53 (AB/TU) control Fig. 4 with imageFig. 5 with image from Akhter et al., 2025
optic tectum area, ameliorated nl1Tg + MO2-klhl13 + MO4-tp53 (AB/TU) chemical treatment by environment: AZD-1152 Fig. 5 with image from Akhter et al., 2025
optic tectum EGFP expression increased distribution, abnormal nl1Tg + MO2-klhl13 + MO4-tp53 (AB/TU) control Fig. 4 with imageFig. 5 with image from Akhter et al., 2025
forebrain mitotic cell cycle increased process quality, abnormal nl1Tg + MO2-tubgcp2 + MO4-tp53 (AB/TL) control Fig. 3 with image from Bartoszewski et al., 2022
midbrain mitotic cell cycle increased process quality, abnormal nl1Tg + MO2-tubgcp2 + MO4-tp53 (AB/TL) control Fig. 3 with image from Bartoszewski et al., 2022
neutrophil chemotaxis decreased process quality, abnormal nz50Tg + MO1-duox + MO4-tp53 amputation: caudal fin Fig. 2 from de Oliveira et al., 2014
serotonin metabolic process disrupted, abnormal pku2Et + MO2-th2 + MO4-tp53 standard conditions Fig. 5 from Ren et al., 2013
brain development disrupted, abnormal rw0Tg + MO1-exosc8 + MO4-tp53 standard conditions Fig. 8 with image from Boczonadi et al., 2014
hindbrain morphology, abnormal rw0Tg + MO1-exosc8 + MO4-tp53 standard conditions Fig. 8 with image from Boczonadi et al., 2014
midbrain morphology, abnormal rw0Tg + MO1-exosc8 + MO4-tp53 standard conditions Fig. 8 with image from Boczonadi et al., 2014
vagal lobe motor neuron decreased amount, abnormal rw0Tg + MO1-hmx4 + MO2-hmx4 + MO4-tp53 standard conditions Fig. 5 with image from Gongal et al., 2011
optic tectum decreased size, abnormal rw0130aTg + MO1-nlk2 + MO4-tp53 standard conditions Fig. 2 from Ota et al., 2012
midbrain development disrupted, abnormal rw0130aTg + MO1-nlk2 + MO4-tp53 standard conditions Fig. 2 from Ota et al., 2012
optic tectum decreased size, abnormal rw0130aTg + MO2-lef1 + MO4-tp53 standard conditions Fig. 2 from Ota et al., 2012
midbrain development disrupted, abnormal rw0130aTg + MO2-lef1 + MO4-tp53 standard conditions Fig. 2 from Ota et al., 2012
optic tectum decreased size, abnormal rw0130aTg + MO2-nlk2 + MO4-tp53 standard conditions Fig. 2 from Ota et al., 2012
midbrain development disrupted, abnormal rw0130aTg + MO2-nlk2 + MO4-tp53 standard conditions Fig. 2 from Ota et al., 2012
optic tectum neuron decreased amount, abnormal rw0130aTg + MO3-fsta + MO4-tp53 standard conditions Fig. 4Fig. S13 from Tsukada et al., 2010
optic tectum decreased size, abnormal rw0130aTg + MO3-fsta + MO4-tp53 standard conditions Fig. 4Fig. S13 from Tsukada et al., 2010
optic tectum decreased size, abnormal rw0130aTg + MO4-fsta + MO4-tp53 standard conditions Fig. S13 from Tsukada et al., 2010
optic tectum neuron decreased amount, abnormal rw0130aTg + MO4-fsta + MO4-tp53 standard conditions Fig. S13 from Tsukada et al., 2010
posterior lateral line primordium decreased size, abnormal s356tTg + MO4-tp53 + MO5-insm1a standard conditions Fig. 4 with image from He et al., 2017
neuromast hair cell decreased amount, abnormal s356tTg + MO4-tp53 + MO5-insm1a standard conditions Fig. 3 with image from He et al., 2017
neuromast hair cell development disrupted, abnormal s356tTg + MO4-tp53 + MO5-insm1a standard conditions Fig. 3 with image from He et al., 2017
posterior lateral line primordium morphology, abnormal s356tTg + MO4-tp53 + MO5-insm1a standard conditions Fig. 4 with image from He et al., 2017
posterior lateral line primordium cell population proliferation disrupted, abnormal s356tTg + MO4-tp53 + MO5-insm1a standard conditions Fig. 4 with image from He et al., 2017
heart contraction decreased rate, abnormal s843Tg + MO1-lrp1aa + MO4-tp53 standard conditions text only from Pi et al., 2012
caudal vein plexus decreased branchiness, abnormal s843Tg + MO1-lrp1aa + MO4-tp53 standard conditions text only from Pi et al., 2012
intersegmental vessel morphology, abnormal s843Tg + MO1-lrp1aa + MO4-tp53 standard conditions text only from Pi et al., 2012
vasculature development disrupted, abnormal s843Tg + MO1-lrp1aa + MO4-tp53 standard conditions text only from Pi et al., 2012
trunk vasculature morphology, abnormal s843Tg + MO1-lrp1aa + MO4-tp53 standard conditions text only from Pi et al., 2012
blood circulation disrupted, abnormal s843Tg + MO1-lrp1aa + MO4-tp53 standard conditions text only from Pi et al., 2012
intersegmental vessel hypoplastic, abnormal s843Tg + MO1-rasip1 + MO4-tp53 standard conditions Fig. 3 from Wilson et al., 2013
pericardium edematous, abnormal s843Tg + MO1-rasip1 + MO4-tp53 standard conditions Fig. 3 from Wilson et al., 2013
sprouting angiogenesis delayed, abnormal s843Tg + MO1-rasip1 + MO4-tp53 standard conditions Fig. 3 from Wilson et al., 2013
intersegmental vessel absent, abnormal s843Tg + MO1-stab2 + MO4-stab2 + MO4-tp53 standard conditions Fig. 2 with image from Rost et al., 2014
intersegmental vessel decreased size, abnormal s843Tg + MO1-stab2 + MO4-stab2 + MO4-tp53 standard conditions Fig. 2 with image from Rost et al., 2014
subintestinal vein decreased length, abnormal s843Tg + MO2-angpt2b + MO4-tp53 standard conditions Fig. 5 from Li et al., 2014
subintestinal vein morphology, abnormal s843Tg + MO2-angpt2b + MO4-tp53 standard conditions Fig. 5 from Li et al., 2014
aortic arch morphology, ameliorated s843Tg + MO3-foxe3 + MO4-tp53 standard conditions Fig. 2Fig. 8 from Kuang et al., 2016
peripheral nervous system development process quality, abnormal sb2Tg + MO4-tp53 standard conditions Fig. 4 with image from Boer et al., 2016
erythroid lineage cell decreased amount, abnormal sd2Tg + MO1-pi4kaa + MO4-tp53 control Fig. 5 from Ziyad et al., 2018
spinal cord EGFP expression decreased amount, abnormal sk72Tg + MO1-rdh10a + MO2-rdh10a + MO4-tp53 standard conditions Fig. 1 with image from D'Aniello et al., 2015
whole organism EGFP expression decreased amount, abnormal sk72Tg + MO1-rdh10a + MO2-rdh10a + MO4-tp53 standard conditions Fig. 1 with image from D'Aniello et al., 2015
retinoic acid receptor signaling pathway decreased occurrence, abnormal sk72Tg + MO1-rdh10a + MO2-rdh10a + MO4-tp53 standard conditions Fig. 1 with image from D'Aniello et al., 2015
spinal cord EGFP expression decreased distribution, abnormal sk72Tg + MO1-rdh10a + MO2-rdh10a + MO4-tp53 standard conditions Fig. 1 with image from D'Aniello et al., 2015
Kupffer's vesicle anatomical space increased permeability, abnormal sny101Tg + MO2-jupa + MO4-tp53 control Fig. 5 with image from Dasgupta et al., 2018
neuromast hair cell decreased functionality, abnormal sqet4Et + MO4-tp53 + MO5-yap1 standard conditions Fig. 4 with image from Loh et al., 2014
posterior lateral line neuromast decreased amount, abnormal sqet4Et + MO4-tp53 + MO5-yap1 standard conditions Fig. 2 with image from Loh et al., 2014
pronephric distal early tubule decreased length, abnormal sqet11Et + MO1-wwtr1 + MO4-tp53 chemical treatment by environment: retinoic acid Fig. 5 with image from Zhang et al., 2015
pronephric proximal convoluted tubule increased length, abnormal sqet11Et + MO1-wwtr1 + MO4-tp53 standard conditions Fig. 3 with imageFig. 5 with image from Zhang et al., 2015
pronephric duct malformed, abnormal sqet11Et + MO1-wwtr1 + MO4-tp53 standard conditions Fig. 2 with image from Zhang et al., 2015
pronephric proximal convoluted tubule dilated, exacerbated sqet11Et + MO1-wwtr1 + MO4-tp53 chemical treatment by environment: retinoic acid Fig. 5 with image from Zhang et al., 2015
pronephric distal late tubule increased length, abnormal sqet11Et + MO1-wwtr1 + MO4-tp53 chemical treatment: 4-(diethylamino)benzaldehyde Fig. 5 with image from Zhang et al., 2015
pronephric proximal straight tubule decreased length, abnormal sqet11Et + MO1-wwtr1 + MO4-tp53 standard conditions Fig. 3 with imageFig. 5 with image from Zhang et al., 2015
trunk decreased length, abnormal sqet11Et + MO1-wwtr1 + MO4-tp53 standard conditions Fig. 2 with image from Zhang et al., 2015
pronephric duct single ciliated epithelial cell decreased amount, abnormal sqet11Et + MO1-wwtr1 + MO4-tp53 standard conditions Fig. 3 with image from Zhang et al., 2015
pronephric proximal convoluted tubule dilated, abnormal sqet11Et + MO1-wwtr1 + MO4-tp53 standard conditions Fig. 3 with imageFig. 5 with image from Zhang et al., 2015
pronephric proximal convoluted tubule size, ameliorated sqet11Et + MO1-wwtr1 + MO4-tp53 chemical treatment: 4-(diethylamino)benzaldehyde Fig. 5 with image from Zhang et al., 2015
pronephric proximal convoluted tubule increased length, exacerbated sqet11Et + MO1-wwtr1 + MO4-tp53 chemical treatment by environment: retinoic acid Fig. 5 with image from Zhang et al., 2015
pronephric distal late tubule decreased length, abnormal sqet11Et + MO1-wwtr1 + MO4-tp53 standard conditions Fig. 3 with image from Zhang et al., 2015
pronephric distal early tubule decreased length, abnormal sqet11Et + MO1-wwtr1 + MO4-tp53 control Fig. 3 with imageFig. 5 with image from Zhang et al., 2015
pronephric proximal convoluted tubule decreased length, abnormal sqet11Et + MO1-wwtr1 + MO4-tp53 chemical treatment: 4-(diethylamino)benzaldehyde Fig. 5 with image from Zhang et al., 2015
swim bladder decreased size, abnormal sqET33-2Et + MO1-wif1 + MO4-tp53 standard conditions Fig. 3 from Yin et al., 2012
anterior swim bladder bud absent, abnormal sqET33-2Et + MO1-wif1 + MO4-tp53 standard conditions Fig. 3 from Yin et al., 2012
somite immature, abnormal sqET33-2Et + MO1-wif1 + MO4-tp53 standard conditions Fig. 3 from Yin et al., 2012
trunk decreased length, abnormal sqET33-2Et + MO1-wif1 + MO4-tp53 standard conditions Fig. 3 from Yin et al., 2012
swim bladder development disrupted, abnormal sqET33-2Et + MO1-wif1 + MO4-tp53 standard conditions Fig. 3 from Yin et al., 2012
anterior swim bladder bud decreased size, abnormal sqET33-2Et + MO1-wif1 + MO4-tp53 standard conditions Fig. 3 from Yin et al., 2012
anterior swim bladder bud absent, abnormal sqET33-2Et + MO2-wif1 + MO4-tp53 standard conditions Fig. 3 from Yin et al., 2012
swim bladder decreased size, abnormal sqET33-2Et + MO2-wif1 + MO4-tp53 standard conditions Fig. 3 from Yin et al., 2012
somite immature, abnormal sqET33-2Et + MO2-wif1 + MO4-tp53 standard conditions Fig. 3 from Yin et al., 2012
swim bladder development disrupted, abnormal sqET33-2Et + MO2-wif1 + MO4-tp53 standard conditions Fig. 3 from Yin et al., 2012
anterior swim bladder bud decreased size, abnormal sqET33-2Et + MO2-wif1 + MO4-tp53 standard conditions Fig. 3 from Yin et al., 2012
trunk decreased length, abnormal sqET33-2Et + MO2-wif1 + MO4-tp53 standard conditions Fig. 3 from Yin et al., 2012
notochord mislocalised laterally, abnormal t10Tg + MO1-bcl2l16 + MO4-tp53 standard conditions Fig. 3 from Prudent et al., 2013
notochord bent, abnormal t10Tg + MO1-bcl2l16 + MO4-tp53 standard conditions Fig. 3 from Prudent et al., 2013
heart has extra parts of type cardiac muscle cell, abnormal twu26Tg + MO2-rarab + MO4-tp53 standard conditions Fig. 3 with image from D'Aniello et al., 2013
heart looping disrupted, abnormal twu34Tg + MO1-cep162 + MO4-tp53 standard conditions Fig. 2 from Wang et al., 2013
left/right axis specification process quality, abnormal twu34Tg + MO1-gpr22a + MO4-tp53 standard conditions Fig. 2 with image from Verleyen et al., 2014
heart looping process quality, abnormal twu34Tg + MO1-gpr22a + MO4-tp53 standard conditions Fig. 2 with image from Verleyen et al., 2014
heart mislocalised radially, abnormal twu34Tg + MO2-gmnn + MO4-tp53 standard conditions Fig. 2 from Huang et al., 2011
determination of heart left/right asymmetry disrupted, abnormal twu34Tg + MO2-gmnn + MO4-tp53 standard conditions Fig. 2 from Huang et al., 2011
heart tube morphology, abnormal twu34Tg + MO3-pals1a + MO4-tp53 standard conditions Fig. 3 from Bit-Avragim et al., 2008
heart morphogenesis disrupted, abnormal twu34Tg + MO3-pals1a + MO4-tp53 standard conditions Fig. 3 from Bit-Avragim et al., 2008
heart tube cardiac muscle cell structure, abnormal twu34Tg + MO3-pals1a + MO4-tp53 standard conditions Fig. 3 from Bit-Avragim et al., 2008
heart tube cardiac muscle cell size, abnormal twu34Tg + MO3-pals1a + MO4-tp53 standard conditions Fig. 3 from Bit-Avragim et al., 2008
endothelial cell apoptotic process increased occurrence, ameliorated ubs1Tg + MO1-tnnt2a + MO4-tp53 control Fig. 6 from Serbanovic-Canic et al., 2017
urine protein increased amount, abnormal uf4Tg + MO1-kif21a + MO4-tp53 standard conditions Figure 3 with image from Riedmann et al., 2023
pronephros glomerular filtration decreased process quality, abnormal uf4Tg + MO1-kif21a + MO4-tp53 standard conditions Figure 3 with image from Riedmann et al., 2023
pronephros glomerular filtration decreased process quality, abnormal uf4Tg + MO1-nphs1 + MO4-tp53 standard conditions Figure 3 with image from Riedmann et al., 2023
urine protein increased amount, abnormal uf4Tg + MO1-nphs1 + MO4-tp53 standard conditions Figure 3 with image from Riedmann et al., 2023
regulation of Notch signaling pathway disrupted, abnormal um13Tg + MO1-pappa2 + MO4-tp53 standard conditions Fig. 6 with image from Kjaer-Sorensen et al., 2014
Notch signaling pathway disrupted, abnormal um13Tg + MO1-pappa2 + MO4-tp53 standard conditions Fig. 7 with image from Kjaer-Sorensen et al., 2014
Notch signaling pathway disrupted, abnormal um13Tg + MO2-pappa2 + MO4-tp53 standard conditions Fig. 7 with image from Kjaer-Sorensen et al., 2014
regulation of Notch signaling pathway disrupted, abnormal um13Tg + MO2-pappa2 + MO4-tp53 standard conditions Fig. 6 with image from Kjaer-Sorensen et al., 2014
Notch signaling pathway disrupted, abnormal um13Tg + MO3-pappa2 + MO4-tp53 standard conditions Fig. 7 with image from Kjaer-Sorensen et al., 2014
regulation of Notch signaling pathway disrupted, abnormal um13Tg + MO3-pappa2 + MO4-tp53 standard conditions Fig. 6 with image from Kjaer-Sorensen et al., 2014
eye closure incomplete, abnormal upo334Tg + MO4-tp53 + MO6-vsx2 standard conditions Fig. 7 from Gago-Rodrigues et al., 2015
eye open, abnormal upo334Tg + MO4-tp53 + MO6-vsx2 standard conditions Fig. 6 from Gago-Rodrigues et al., 2015
eye decreased size, abnormal upo334Tg + MO4-tp53 + MO6-vsx2 standard conditions Fig. 6 from Gago-Rodrigues et al., 2015
optic cup formation involved in camera-type eye development process quality, abnormal upo334Tg + MO4-tp53 + MO6-vsx2 standard conditions Fig. 6Fig. 7 from Gago-Rodrigues et al., 2015
whole organism lacks parts or has fewer parts of type eye, abnormal upo334Tg + MO4-tp53 + MO6-vsx2 standard conditions Fig. 6 from Gago-Rodrigues et al., 2015
peptidyl-tyrosine autophosphorylation decreased occurrence, abnormal uwm5Tg + MO1-duox + MO4-tp53 physical alteration: anatomical structure Fig. 1 from Yoo et al., 2011
macrophage response to wounding process quality, abnormal uwm12Tg + MO1-duox + MO4-tp53 amputation: caudal fin Fig. 3 from Tauzin et al., 2014
macrophage chemotaxis process quality, abnormal uwm12Tg + MO1-duox + MO4-tp53 amputation: caudal fin Fig. 3 from Tauzin et al., 2014
regenerating fin caudal fin EGFP expression decreased amount, abnormal uwm37Tg + MO1-duox + MO4-tp53 (AB) resection: caudal fin Fig. 2 S1 with image from LeBert et al., 2018
hindbrain has fewer parts of type cranial motor neuron, abnormal vu12Tg + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 3 from Sánchez et al., 2018
midbrain has fewer parts of type cranial motor neuron, abnormal vu12Tg + MO1-pla2g6 + MO4-tp53 standard conditions Fig. 3 from Sánchez et al., 2018
spinal cord oligodendrocyte ab1-rps6 labeling increased amount, abnormal vu12Tg + MO1-ptena + MO4-tp53 standard conditions Fig. 3 from Mathews et al., 2016
oligodendrocyte TOR signaling increased occurrence, abnormal vu12Tg + MO1-ptena + MO4-tp53 standard conditions Fig. 3 from Mathews et al., 2016
cranial neural crest cell cell death increased occurrence, abnormal vu234Tg + MO1-fscn1a + MO4-tp53 standard conditions Fig. 2 with imageFig. 5 with image from Boer et al., 2016
head cell death increased occurrence, abnormal vu234Tg + MO1-fscn1a + MO4-tp53 standard conditions Fig. 5 with image from Boer et al., 2016
cranial neural crest cell filopodium decreased amount, abnormal vu234Tg + MO1-fscn1a + MO4-tp53 standard conditions Fig. 2 with image from Boer et al., 2016
cranial neural crest cell filopodium decreased length, abnormal vu234Tg + MO1-fscn1a + MO4-tp53 standard conditions Fig. 2 with image from Boer et al., 2016
ceratobranchial cartilage absent, abnormal vu234Tg + MO1-hcfc1b + MO4-tp53 standard conditions Fig. 4 with image from Quintana et al., 2014
canonical Wnt signaling pathway decreased process quality, abnormal w25Tg + MO1-dot1l + MO4-tp53 standard conditions Fig. 7 with image from Mahmoudi et al., 2010
canonical Wnt signaling pathway decreased process quality, abnormal w25Tg + MO1-mllt10 + MO4-tp53 standard conditions Fig. 7 with image from Mahmoudi et al., 2010
canonical Wnt signaling pathway decreased process quality, abnormal w25Tg + MO2-dot1l + MO4-tp53 standard conditions Fig. 7 with image from Mahmoudi et al., 2010
canonical Wnt signaling pathway decreased process quality, abnormal w25Tg + MO2-mllt10 + MO4-tp53 standard conditions Fig. 7 with image from Mahmoudi et al., 2010
canonical Wnt signaling pathway decreased process quality, abnormal w25Tg + MO3-tcf7l2 + MO4-tp53 standard conditions Fig. 7 with image from Mahmoudi et al., 2010
peripheral nervous system development process quality, abnormal w37Tg + MO1-fscn1a + MO4-tp53 standard conditions Fig. 4 with image from Boer et al., 2016
sprouting angiogenesis disrupted, abnormal y1Tg + MO1-foxf1 + MO4-tp53 standard conditions Fig. 5 with image from Sturtzel et al., 2018
thoracic duct absent, abnormal y1Tg + MO1-foxf1 + MO4-tp53 standard conditions Fig. 5 with image from Sturtzel et al., 2018
intersegmental vessel morphology, abnormal y1Tg + MO1-foxf1 + MO4-tp53 standard conditions Fig. 5 with image from Sturtzel et al., 2018
vascular lymphangioblast absent, abnormal y1Tg + MO1-foxf1 + MO4-tp53 standard conditions Fig. 5 with image from Sturtzel et al., 2018
dorsal longitudinal anastomotic vessel morphology, abnormal y1Tg + MO1-foxf1 + MO4-tp53 standard conditions Fig. 5 with image from Sturtzel et al., 2018
intersegmental vessel morphology, abnormal y1Tg + MO1-glo1 + MO4-tp53 standard conditions Fig. 2 from Jörgens et al., 2015
blood vessel morphology, abnormal y1Tg + MO1-glo1 + MO4-tp53 standard conditions Fig. 2 from Jörgens et al., 2015
intersegmental vessel structure, abnormal y1Tg + MO1-glo1 + MO4-tp53 standard conditions Fig. 2 from Jörgens et al., 2015
blood vessel increased branchiness, abnormal y1Tg + MO1-glo1 + MO4-tp53 standard conditions Fig. 2 from Jörgens et al., 2015
angiogenesis disrupted, abnormal y1Tg + MO1-iqsec1a + MO4-tp53 standard conditions Fig. 6 from Manavski et al., 2014
vasculature development disrupted, abnormal y1Tg + MO1-iqsec1a + MO4-tp53 standard conditions Fig. 6 from Manavski et al., 2014
parachordal vessel aplastic, abnormal y1Tg + MO1-iqsec1a + MO4-tp53 standard conditions Fig. 6 from Manavski et al., 2014
vascular lymphangioblast decreased amount, abnormal y1Tg + MO1-iqsec1a + MO4-tp53 standard conditions Fig. 6Fig. S6 from Manavski et al., 2014
intersegmental vessel malformed, abnormal y1Tg + MO1-iqsec1a + MO4-tp53 standard conditions Fig. 6 from Manavski et al., 2014
dorsal longitudinal anastomotic vessel incomplete structure, abnormal y1Tg + MO1-iqsec1b + MO4-tp53 standard conditions Fig. 6 from Manavski et al., 2014
dorsal longitudinal anastomotic vessel malformed, abnormal y1Tg + MO1-iqsec1b + MO4-tp53 standard conditions Fig. 6 from Manavski et al., 2014
vasculature development disrupted, abnormal y1Tg + MO1-iqsec1b + MO4-tp53 standard conditions Fig. 6 from Manavski et al., 2014
angiogenesis disrupted, abnormal y1Tg + MO1-iqsec1b + MO4-tp53 standard conditions Fig. 6 from Manavski et al., 2014
parachordal vessel aplastic, abnormal y1Tg + MO1-iqsec1b + MO4-tp53 standard conditions Fig. 6 from Manavski et al., 2014
vascular lymphangioblast decreased amount, abnormal y1Tg + MO1-iqsec1b + MO4-tp53 standard conditions Fig. 6 from Manavski et al., 2014
intersegmental vessel malformed, abnormal y1Tg + MO1-iqsec1b + MO4-tp53 standard conditions Fig. 6 from Manavski et al., 2014
hyaloid vessel irregular spatial pattern, abnormal y1Tg + MO1-mab21l2 + MO4-tp53 standard conditions Fig. 4 with image from Alvarez et al., 2007
hyaloid vessel increased thickness, abnormal y1Tg + MO1-mab21l2 + MO4-tp53 standard conditions Fig. 4 with image from Alvarez et al., 2007
hyaloid vessel blood vessel endothelial cell aggregated, abnormal y1Tg + MO1-mfap2 + MO4-tp53 standard conditions Fig. 4 with image from Alvarez et al., 2007
hyaloid vessel hypoplastic, abnormal y1Tg + MO1-mfap2 + MO4-tp53 standard conditions Fig. 4 with image from Alvarez et al., 2007
hyaloid vessel increased thickness, abnormal y1Tg + MO1-mfap2 + MO4-tp53 standard conditions Fig. 4 with image from Alvarez et al., 2007
pharyngeal arch 3-7 skeleton decreased size, abnormal y1Tg + MO1-ndst1a + MO4-tp53 standard conditions Fig. 6 with image from Filipek-Górniok et al., 2015
ceratohyal bone mislocalised, abnormal y1Tg + MO1-ndst1a + MO4-tp53 standard conditions Fig. 6 with image from Filipek-Górniok et al., 2015
pharyngeal arch cartilage malformed, abnormal y1Tg + MO1-ndst1a + MO4-tp53 standard conditions Fig. 6 with image from Filipek-Górniok et al., 2015
basihyal cartilage decreased size, abnormal y1Tg + MO1-ndst1a + MO4-tp53 standard conditions Fig. 6 with image from Filipek-Górniok et al., 2015
intersegmental vessel extends beyond somite, abnormal y1Tg + MO1-pappa2 + MO4-tp53 standard conditions Fig. 6 with image from Kjaer-Sorensen et al., 2014
intersegmental vessel decreased size, abnormal y1Tg + MO1-pappa2 + MO4-tp53 standard conditions Fig. 6 with image from Kjaer-Sorensen et al., 2014
intersegmental vessel branched, abnormal y1Tg + MO1-pappa2 + MO4-tp53 standard conditions Fig. 6 with image from Kjaer-Sorensen et al., 2014
angiogenesis disrupted, abnormal y1Tg + MO1-pappa2 + MO4-tp53 standard conditions Fig. 6 with image from Kjaer-Sorensen et al., 2014
blood vessel morphology, abnormal y1Tg + MO1-pdx1 + MO4-tp53 standard conditions Fig. 2 from Jörgens et al., 2015
intersegmental vessel morphology, abnormal y1Tg + MO1-pdx1 + MO4-tp53 standard conditions Fig. 2 from Jörgens et al., 2015
blood vessel increased branchiness, abnormal y1Tg + MO1-pdx1 + MO4-tp53 standard conditions Fig. 2 from Jörgens et al., 2015
intersegmental vessel structure, abnormal y1Tg + MO1-pdx1 + MO4-tp53 standard conditions Fig. 2 from Jörgens et al., 2015
angiogenesis delayed, abnormal y1Tg + MO1-tinagl1 + MO4-tp53 standard conditions Fig. 6 with image from Brown et al., 2010
intersegmental vessel immature, abnormal y1Tg + MO1-tinagl1 + MO4-tp53 standard conditions Fig. 6 with image from Brown et al., 2010
blood vessel increased branchiness, abnormal y1Tg + MO2-glo1 + MO4-tp53 standard conditions Fig. 2 from Jörgens et al., 2015
intersegmental vessel morphology, abnormal y1Tg + MO2-glo1 + MO4-tp53 standard conditions Fig. 2 from Jörgens et al., 2015
intersegmental vessel structure, abnormal y1Tg + MO2-glo1 + MO4-tp53 standard conditions Fig. 2 from Jörgens et al., 2015
blood vessel morphology, abnormal y1Tg + MO2-glo1 + MO4-tp53 standard conditions Fig. 2 from Jörgens et al., 2015
hyaloid vessel irregular spatial pattern, abnormal y1Tg + MO2-hs6st2 + MO4-tp53 standard conditions Fig. 4 with image from Alvarez et al., 2007
vasculature development disrupted, abnormal y1Tg + MO2-iqsec1a + MO4-tp53 standard conditions Fig. 6 from Manavski et al., 2014
angiogenesis disrupted, abnormal y1Tg + MO2-iqsec1a + MO4-tp53 standard conditions Fig. 6 from Manavski et al., 2014
parachordal vessel aplastic, abnormal y1Tg + MO2-iqsec1a + MO4-tp53 standard conditions Fig. 6 from Manavski et al., 2014
vascular lymphangioblast decreased amount, abnormal y1Tg + MO2-iqsec1a + MO4-tp53 standard conditions Fig. 6Fig. S6 from Manavski et al., 2014
intersegmental vessel malformed, abnormal y1Tg + MO2-iqsec1a + MO4-tp53 standard conditions Fig. 6 from Manavski et al., 2014
dorsal longitudinal anastomotic vessel incomplete structure, abnormal y1Tg + MO2-iqsec1b + MO4-tp53 standard conditions Fig. 6 from Manavski et al., 2014
dorsal longitudinal anastomotic vessel structure, abnormal y1Tg + MO2-iqsec1b + MO4-tp53 standard conditions Fig. S6 from Manavski et al., 2014
vascular lymphangioblast absent, abnormal y1Tg + MO2-iqsec1b + MO4-tp53 standard conditions Fig. 6 from Manavski et al., 2014
dorsal longitudinal anastomotic vessel malformed, abnormal y1Tg + MO2-iqsec1b + MO4-tp53 standard conditions Fig. 6 from Manavski et al., 2014
vasculature development disrupted, abnormal y1Tg + MO2-iqsec1b + MO4-tp53 standard conditions Fig. 6 from Manavski et al., 2014
angiogenesis disrupted, abnormal y1Tg + MO2-iqsec1b + MO4-tp53 standard conditions Fig. 6 from Manavski et al., 2014
parachordal vessel aplastic, abnormal y1Tg + MO2-iqsec1b + MO4-tp53 standard conditions Fig. 6 from Manavski et al., 2014
vascular lymphangioblast decreased amount, abnormal y1Tg + MO2-iqsec1b + MO4-tp53 standard conditions Fig. 6Fig. S6 from Manavski et al., 2014
intersegmental vessel structure, abnormal y1Tg + MO2-iqsec1b + MO4-tp53 standard conditions Fig. S6 from Manavski et al., 2014
intersegmental vessel malformed, abnormal y1Tg + MO2-iqsec1b + MO4-tp53 standard conditions Fig. 6 from Manavski et al., 2014
lymph vessel development delayed, abnormal y1Tg + MO2-junba + MO4-tp53 control Fig. 2 with image from Kiesow et al., 2015
vascular lymphangioblast absent, abnormal y1Tg + MO2-junba + MO4-tp53 control Fig. 2 with image from Kiesow et al., 2015
pharyngeal arch 3-7 skeleton decreased size, abnormal y1Tg + MO2-ndst1a + MO4-tp53 standard conditions Fig. 6 with image from Filipek-Górniok et al., 2015
ceratohyal bone mislocalised, abnormal y1Tg + MO2-ndst1a + MO4-tp53 standard conditions Fig. 6 with image from Filipek-Górniok et al., 2015
pharyngeal arch cartilage malformed, abnormal y1Tg + MO2-ndst1a + MO4-tp53 standard conditions Fig. 6 with image from Filipek-Górniok et al., 2015
basihyal cartilage decreased size, abnormal y1Tg + MO2-ndst1a + MO4-tp53 standard conditions Fig. 6 with image from Filipek-Górniok et al., 2015
intersegmental vessel branched, abnormal y1Tg + MO2-pappa2 + MO4-tp53 standard conditions Fig. 6 with image from Kjaer-Sorensen et al., 2014
angiogenesis disrupted, abnormal y1Tg + MO2-pappa2 + MO4-tp53 standard conditions Fig. 6 with image from Kjaer-Sorensen et al., 2014
intersegmental vessel decreased size, abnormal y1Tg + MO2-pappa2 + MO4-tp53 standard conditions Fig. 6 with image from Kjaer-Sorensen et al., 2014
intersegmental vessel extends beyond somite, abnormal y1Tg + MO2-pappa2 + MO4-tp53 standard conditions Fig. 6 with image from Kjaer-Sorensen et al., 2014
metallopeptidase activity increased occurrence, abnormal y1Tg + MO3-adtrp1 + MO4-tp53 control Fig. 16 from Patel et al., 2018
whole organism mmp9 expression amount, ameliorated y1Tg + MO3-adtrp1 + MO4-tp53 chemical treatment by environment: IWR-1-endo Fig. 17 from Patel et al., 2018
intersegmental vessel morphology, abnormal y1Tg + MO3-adtrp1 + MO4-tp53 control Fig. 3Fig. 16 from Patel et al., 2018
intersegmental vessel morphology, ameliorated y1Tg + MO3-adtrp1 + MO4-tp53 chemical treatment by environment: ilomastat Fig. 16 from Patel et al., 2018
caudal vein plexus disorganized, abnormal y1Tg + MO3-adtrp1 + MO4-tp53 control Fig. 3 from Patel et al., 2018
common cardinal vein anatomical region Ab3-mmp9 labeling increased amount, abnormal y1Tg + MO3-adtrp1 + MO4-tp53 control Fig. 16 from Patel et al., 2018
caudal vein plexus dilated, ameliorated y1Tg + MO3-adtrp1 + MO4-tp53 chemical treatment by environment: ilomastat Fig. 16 from Patel et al., 2018
caudal vein plexus hemorrhagic, abnormal y1Tg + MO3-adtrp1 + MO4-tp53 control Fig. 3 from Patel et al., 2018
whole organism mmp9 expression increased amount, abnormal y1Tg + MO3-adtrp1 + MO4-tp53 control Fig. 17 from Patel et al., 2018
common cardinal vein anatomical region mmp9 expression increased amount, abnormal y1Tg + MO3-adtrp1 + MO4-tp53 control Fig. 16 from Patel et al., 2018
head hemorrhagic, abnormal y1Tg + MO3-adtrp1 + MO4-tp53 control Fig. 3 from Patel et al., 2018
caudal vein plexus dilated, abnormal y1Tg + MO3-adtrp1 + MO4-tp53 control Fig. 3Fig. 16 from Patel et al., 2018
caudal vein plexus edematous, abnormal y1Tg + MO3-adtrp1 + MO4-tp53 control Fig. 3 from Patel et al., 2018
lymph vessel development arrested, abnormal y1Tg + MO3-dre-mir-182 + MO4-tp53 control Fig. 6 with imageFig. 7 from Kiesow et al., 2015
lymph vessel development delayed, abnormal y1Tg + MO3-dre-mir-182 + MO4-tp53 control Fig. 4 with image from Kiesow et al., 2015
thoracic duct absent, abnormal y1Tg + MO3-dre-mir-182 + MO4-tp53 control Fig. 6 with image from Kiesow et al., 2015
vascular lymphangioblast absent, abnormal y1Tg + MO3-dre-mir-182 + MO4-tp53 control Fig. 4 with imageFig. 7 from Kiesow et al., 2015
vascular lymphangioblast malformed, abnormal y1Tg + MO3-hdac9b + MO4-tp53 standard conditions Fig. 3Fig. 6 from Kaluza et al., 2013
dorsal longitudinal anastomotic vessel malformed, abnormal y1Tg + MO3-hdac9b + MO4-tp53 standard conditions Fig. 3 from Kaluza et al., 2013
lymph vessel development process quality, abnormal y1Tg + MO3-hdac9b + MO4-tp53 standard conditions Fig. 3 from Kaluza et al., 2013
vasculature development process quality, abnormal y1Tg + MO3-hdac9b + MO4-tp53 standard conditions Fig. 3 from Kaluza et al., 2013
intersegmental vessel malformed, abnormal y1Tg + MO3-hdac9b + MO4-tp53 standard conditions Fig. 3 from Kaluza et al., 2013
lymph vessel development delayed, abnormal y1Tg + MO3-junbb + MO4-tp53 control Fig. 2 with image from Kiesow et al., 2015
vascular lymphangioblast absent, abnormal y1Tg + MO3-junbb + MO4-tp53 control Fig. 2 with image from Kiesow et al., 2015
intersegmental vessel morphology, abnormal y1Tg + MO4-adtrp1 + MO4-tp53 control Fig. 3 from Patel et al., 2018
caudal vein plexus disorganized, abnormal y1Tg + MO4-adtrp1 + MO4-tp53 control Fig. 3 from Patel et al., 2018
caudal vein plexus hemorrhagic, abnormal y1Tg + MO4-adtrp1 + MO4-tp53 control Fig. 3 from Patel et al., 2018
head hemorrhagic, abnormal y1Tg + MO4-adtrp1 + MO4-tp53 control Fig. 3 from Patel et al., 2018
caudal vein plexus dilated, abnormal y1Tg + MO4-adtrp1 + MO4-tp53 control Fig. 3 from Patel et al., 2018
caudal vein plexus edematous, abnormal y1Tg + MO4-adtrp1 + MO4-tp53 control Fig. 3 from Patel et al., 2018
vascular lymphangioblast malformed, abnormal y1Tg + MO4-hdac9b + MO4-tp53 standard conditions Fig. 3 from Kaluza et al., 2013
dorsal longitudinal anastomotic vessel malformed, abnormal y1Tg + MO4-hdac9b + MO4-tp53 standard conditions Fig. 3 from Kaluza et al., 2013
lymph vessel development process quality, abnormal y1Tg + MO4-hdac9b + MO4-tp53 standard conditions Fig. 3 from Kaluza et al., 2013
vasculature development process quality, abnormal y1Tg + MO4-hdac9b + MO4-tp53 standard conditions Fig. 3 from Kaluza et al., 2013
intersegmental vessel malformed, abnormal y1Tg + MO4-hdac9b + MO4-tp53 standard conditions Fig. 3 from Kaluza et al., 2013
intersegmental vessel sprouting angiogenesis delayed, abnormal y7Tg + MO1-igf2a + MO2-igf2a + MO4-tp53 standard conditions Fig. 4 with image from Dallinga et al., 2018
intersegmental vessel filopodium absent, abnormal y7Tg + MO1-igf2a + MO2-igf2a + MO4-tp53 standard conditions Fig. 4 with image from Dallinga et al., 2018
trunk vasculature broken, abnormal y7Tg + MO1-rasip1 + MO4-tp53 standard conditions Fig. S5 from Wilson et al., 2013
intersegmental vessel filopodium decreased amount, abnormal y7Tg + MO2-igf2b + MO3-igf2b + MO4-tp53 standard conditions Fig. 4 with image from Dallinga et al., 2018
intersegmental vessel sprouting angiogenesis disrupted, abnormal y7Tg + MO2-igf2b + MO3-igf2b + MO4-tp53 standard conditions Fig. 4 with image from Dallinga et al., 2018
cranial nerve VIII axon guidance process quality, abnormal zc7Tg + MO1-slit1a + MO4-tp53 control Fig. 8 from Zecca et al., 2015
cranial nerve VIII axon mislocalised, abnormal zc7Tg + MO1-slit1a + MO4-tp53 control Fig. 8 from Zecca et al., 2015
cranial nerve VIII defasciculated, abnormal zc7Tg + MO1-slit1a + MO4-tp53 control Fig. 8 from Zecca et al., 2015
cranial nerve VIII axon guidance process quality, abnormal zc7Tg + MO1-slit1b + MO4-tp53 control Fig. 8 from Zecca et al., 2015
cranial nerve VIII axon mislocalised, abnormal zc7Tg + MO1-slit1b + MO4-tp53 control Fig. 8 from Zecca et al., 2015
cranial nerve VIII defasciculated, abnormal zc7Tg + MO1-slit1b + MO4-tp53 control Fig. 8 from Zecca et al., 2015
retinal ganglion cell layer decreased thickness, abnormal zc7Tg + MO2-igf2bp1 + MO4-tp53 standard conditions Fig. 4 with image from Gaynes et al., 2015
retina apoptotic process increased occurrence, abnormal zc7Tg + MO2-igf2bp1 + MO4-tp53 standard conditions Fig. 4 with image from Gaynes et al., 2015
statoacoustic (VIII) ganglion has fewer parts of type neuron, abnormal zc7Tg + MO2-pgk1 + MO3-pgk1 + MO4-tp53 control Figure 3 - figure supplement 3 from Kantarci et al., 2020
statoacoustic (VIII) ganglion has fewer parts of type neuron, abnormal zc7Tg + MO2-pgk1 + MO4-pgk1 + MO4-tp53 control Figure 3 - figure supplement 3 from Kantarci et al., 2020
statoacoustic (VIII) ganglion has fewer parts of type neuron, abnormal zc7Tg + MO2-pgk1 + MO4-tp53 control Figure 3 - figure supplement 3 from Kantarci et al., 2020
statoacoustic (VIII) ganglion has fewer parts of type neuron, abnormal zc7Tg + MO3-pgk1 + MO4-tp53 control Figure 3 - figure supplement 3 from Kantarci et al., 2020
statoacoustic (VIII) ganglion has fewer parts of type neuron, abnormal zc7Tg + MO4-pgk1 + MO4-tp53 control Figure 3 - figure supplement 3 from Kantarci et al., 2020
statoacoustic (VIII) ganglion has fewer parts of type neuron, abnormal zc7Tg + MO4-pgk1 + MO4-tp53 heat shock Figure 4 - figure supplement 4 from Kantarci et al., 2020
cranial nerve VIII axon guidance process quality, abnormal zc7Tg + MO4-tp53 + MO5-robo2 control Fig. 8 from Zecca et al., 2015
cranial nerve VIII defasciculated, abnormal zc7Tg + MO4-tp53 + MO5-robo2 control Fig. 8 from Zecca et al., 2015
cranial nerve VIII axon mislocalised, abnormal zc7Tg + MO4-tp53 + MO5-robo2 control Fig. 8 from Zecca et al., 2015
intrinsic apoptotic signaling pathway in response to DNA damage disrupted, abnormal zdf11Tg + MO4-tp53 radiation Fig. 2 with image from Sidi et al., 2008
whole organism decreased sensitivity to irradiation, abnormal zdf11Tg + MO4-tp53 radiation Fig. 2 with image from Sidi et al., 2008
whole organism decreased sensitivity to irradiation, abnormal zf102Tg + MO4-tp53 radiation Fig. 2 with image from Sidi et al., 2008
intrinsic apoptotic signaling pathway in response to DNA damage disrupted, abnormal zf102Tg + MO4-tp53 radiation Fig. 2 with image from Sidi et al., 2008
neuromast deposition process quality, abnormal zf106Tg + MO1-fgf10a + MO4-tp53 chemical treatment: dimethyl sulfoxide Fig. 6 with image from Matsuda et al., 2013
neuromast deposition process quality, abnormal zf106Tg + MO1-fgf10a + MO4-tp53 standard conditions Fig. 5 with image from Matsuda et al., 2013
cloacal chamber distended, abnormal zf106Tg + MO1-nphp1 + MO4-tp53 standard conditions Fig. S3 from Slanchev et al., 2011
cloaca development disrupted, abnormal zf106Tg + MO1-nphp1 + MO4-tp53 standard conditions Fig. S3 from Slanchev et al., 2011
pronephric duct decreased length, abnormal zf106Tg + MO1-nphp1 + MO4-tp53 standard conditions Fig. S3 from Slanchev et al., 2011
ventral fin fold absent, abnormal zf106Tg + MO1-nphp1 + MO4-tp53 standard conditions Fig. S3 from Slanchev et al., 2011
posterior lateral line neuromast development process quality, abnormal zf106Tg + MO1-sox21a + MO4-tp53 standard conditions Fig. 4 with image from Ariza-Cosano et al., 2015
protoneuromast decreased amount, abnormal zf106Tg + MO1-sox21a + MO4-tp53 standard conditions Fig. 4 with image from Ariza-Cosano et al., 2015
pronephric duct morphogenesis disrupted, abnormal zf106Tg + MO1-stx16 + MO4-tp53 standard conditions Fig. S1 with image from Jung et al., 2013
whole organism increased curvature, abnormal zf106Tg + MO1-stx16 + MO4-tp53 standard conditions Fig. S1 with image from Jung et al., 2013
pronephric duct structure, abnormal zf106Tg + MO1-stx16 + MO4-tp53 standard conditions Fig. S1 with image from Jung et al., 2013
epithelial tube formation disrupted, abnormal zf106Tg + MO1-stx16 + MO4-tp53 standard conditions Fig. S1 with image from Jung et al., 2013
pericardium edematous, abnormal zf106Tg + MO1-stx16 + MO4-tp53 standard conditions Fig. S1 with image from Jung et al., 2013
posterior lateral line neuromast primordium migration disrupted, abnormal zf106Tg + MO2-gnb1a + MO4-tp53 standard conditions Fig. 2 with image from Xu et al., 2014
posterior lateral line neuromast primordium migration process quality, abnormal zf106Tg + MO2-gnb1a + MO4-tp53 standard conditions Fig. 2 with image from Xu et al., 2014
posterior lateral line neuromast deposition decreased process quality, abnormal zf106Tg + MO2-gnb1a + MO4-tp53 standard conditions Fig. 2 with image from Xu et al., 2014
neuromast decreased amount, abnormal zf106Tg + MO2-gnb1a + MO4-tp53 standard conditions Fig. 2 with image from Xu et al., 2014
posterior lateral line primordium disorganized, abnormal zf106Tg + MO2-itchb + MO4-tp53 standard conditions Fig. 4 with image from Angers et al., 2014
posterior lateral line neuromast primordium migration process quality, abnormal zf106Tg + MO2-itchb + MO4-tp53 standard conditions Fig. 4 with image from Angers et al., 2014
posterior lateral line neuromast decreased amount, abnormal zf106Tg + MO2-itchb + MO4-tp53 standard conditions Fig. 4 with image from Angers et al., 2014
cloaca development disrupted, abnormal zf106Tg + MO2-pard6gb + MO4-tp53 standard conditions Fig. 8 from Slanchev et al., 2011
cloacal chamber distended, abnormal zf106Tg + MO2-pard6gb + MO4-tp53 standard conditions Fig. 8 from Slanchev et al., 2011
pronephric duct decreased length, abnormal zf106Tg + MO2-pard6gb + MO4-tp53 standard conditions Fig. 8 from Slanchev et al., 2011
distal tubule morphogenesis disrupted, abnormal zf106Tg + MO2-pard6gb + MO4-tp53 standard conditions Fig. 8 from Slanchev et al., 2011
pronephric distal late tubule cell migration disrupted, abnormal zf106Tg + MO2-pard6gb + MO4-tp53 standard conditions Fig. 8 from Slanchev et al., 2011
whole organism increased curvature, abnormal zf106Tg + MO2-stx16 + MO4-tp53 standard conditions Fig. 7 with image from Jung et al., 2013
epithelial tube formation disrupted, abnormal zf106Tg + MO2-stx16 + MO4-tp53 standard conditions Fig. 7 with image from Jung et al., 2013
pronephric duct morphogenesis disrupted, abnormal zf106Tg + MO2-stx16 + MO4-tp53 standard conditions Fig. 7 with image from Jung et al., 2013
pronephric duct structure, abnormal zf106Tg + MO2-stx16 + MO4-tp53 standard conditions Fig. 7 with image from Jung et al., 2013
pericardium edematous, abnormal zf106Tg + MO2-stx16 + MO4-tp53 standard conditions Fig. 7 with image from Jung et al., 2013
pronephric duct dilated, abnormal zf106Tg + MO2-stx16 + MO4-tp53 standard conditions Fig. 7 with image from Jung et al., 2013
neuromast decreased distance neuromast, abnormal zf106Tg + MO3-lef1 + MO4-tp53 standard conditions Fig. 1 with image from Matsuda et al., 2013
posterior lateral line neuromast primordium migration process quality, abnormal zf106Tg + MO3-lef1 + MO4-tp53 standard conditions Fig. 3 with image from Matsuda et al., 2013
posterior lateral line primordium cell division decreased process quality, abnormal zf106Tg + MO3-lef1 + MO4-tp53 standard conditions Fig. 2 with image from Matsuda et al., 2013
neuromast deposition process quality, abnormal zf106Tg + MO3-lef1 + MO4-tp53 standard conditions Fig. 1 with imageFig. 3 with image from Matsuda et al., 2013
posterior lateral line primordium cell population proliferation decreased process quality, abnormal zf106Tg + MO3-lef1 + MO4-tp53 standard conditions Fig. 2 with image from Matsuda et al., 2013
distal tubule morphogenesis disrupted, abnormal zf106Tg + MO3-nphp4 + MO4-tp53 standard conditions Fig. 5 from Slanchev et al., 2011
pronephric duct decreased length, abnormal zf106Tg + MO3-nphp4 + MO4-tp53 standard conditions Fig. 8 from Slanchev et al., 2011
proctodeum atretic, abnormal zf106Tg + MO3-nphp4 + MO4-tp53 standard conditions Fig. 2 from Slanchev et al., 2011
posterior pronephric duct bent, abnormal zf106Tg + MO3-nphp4 + MO4-tp53 standard conditions Fig. 5 from Slanchev et al., 2011
cloaca development disrupted, abnormal zf106Tg + MO3-nphp4 + MO4-tp53 standard conditions Fig. 5 from Slanchev et al., 2011
pronephric duct opening absent, abnormal zf106Tg + MO3-nphp4 + MO4-tp53 standard conditions Fig. 5 from Slanchev et al., 2011
pronephric duct dilated, abnormal zf106Tg + MO3-nphp4 + MO4-tp53 standard conditions Fig. 2 from Slanchev et al., 2011
cloacal chamber distended, abnormal zf106Tg + MO3-nphp4 + MO4-tp53 standard conditions Fig. 2 from Slanchev et al., 2011
pronephric distal late tubule cell migration disrupted, abnormal zf106Tg + MO3-nphp4 + MO4-tp53 standard conditions Fig. 5 from Slanchev et al., 2011
proctodeum anatomical region unfused from cloacal chamber, abnormal zf106Tg + MO3-nphp4 + MO4-tp53 standard conditions Fig. 5 from Slanchev et al., 2011
neuromast increased distance neuromast, abnormal zf106Tg + MO3-rspo3 + MO4-tp53 standard conditions Fig. 1 with image from Matsuda et al., 2013
posterior lateral line primordium cell population proliferation decreased process quality, abnormal zf106Tg + MO3-rspo3 + MO4-tp53 standard conditions Fig. 2 with image from Matsuda et al., 2013
posterior lateral line neuromast primordium migration process quality, abnormal zf106Tg + MO3-rspo3 + MO4-tp53 standard conditions Fig. 3 with image from Matsuda et al., 2013
neuromast deposition process quality, abnormal zf106Tg + MO3-rspo3 + MO4-tp53 standard conditions Fig. 1 with imageFig. 3 with image from Matsuda et al., 2013
posterior lateral line primordium cell division decreased process quality, abnormal zf106Tg + MO3-rspo3 + MO4-tp53 standard conditions Fig. 2 with image from Matsuda et al., 2013
neuromast spatial pattern, abnormal zf106Tg + MO4-tp53 + MO5-insm1a standard conditions Fig. 2 with image from He et al., 2017
posterior lateral line neuromast hair cell morphogenesis disrupted, abnormal zf106Tg + MO4-tp53 + MO5-insm1a standard conditions Fig. 2 with image from He et al., 2017
posterior lateral line primordium neuromast decreased amount, abnormal zf106Tg + MO4-tp53 + MO5-insm1a standard conditions Fig. 2 with imageFig. S2 with image from He et al., 2017
lateral line primordium decreased size, abnormal zf106Tg + MO4-tp53 + MO5-yap1 standard conditions Fig. 4 with image from Loh et al., 2014
posterior lateral line development decreased process quality, abnormal zf148Tg + MO4-tp53 + MO5-prnprs3 standard conditions Fig. 1 with image from Huc-Brandt et al., 2014
posterior lateral line has fewer parts of type posterior lateral line neuromast, abnormal zf148Tg + MO4-tp53 + MO5-prnprs3 standard conditions Fig. 1 with image from Huc-Brandt et al., 2014
posterior lateral line decreased length, abnormal zf148Tg + MO4-tp53 + MO5-prnprs3 standard conditions Fig. 1 with image from Huc-Brandt et al., 2014
trigeminal ganglion axon decreased length, abnormal zf154Tg + MO1-srrm4 + MO4-tp53 standard conditions Fig. 6 with image from Calarco et al., 2009
axonogenesis disrupted, abnormal zf154Tg + MO1-srrm4 + MO4-tp53 standard conditions Fig. 6 with image from Calarco et al., 2009
pronephric glomerulus EGFP expression decreased amount, abnormal zf238Tg + MO1-srgap2 + MO4-tp53 standard conditions Fig. 6 from Pan et al., 2017
posterior lateral line neuromast decreased amount, abnormal zf551Tg + MO1-hdac3 + MO4-tp53 control Fig. 2 from He et al., 2016
posterior lateral line neuromast deposition disrupted, abnormal zf551Tg + MO1-hdac3 + MO4-tp53 control Fig. 2 from He et al., 2016
posterior lateral line neuromast decreased amount, abnormal zf551Tg + MO1-phf8 + MO4-tp53 control Fig. 2 from He et al., 2020
posterior lateral line neuromast mislocalised, abnormal zf551Tg + MO1-phf8 + MO4-tp53 control Fig. 2 from He et al., 2020
Kupffer's vesicle anatomical space decreased volume, abnormal a131Tg; sny120Tg + MO1-llgl2 + MO4-tp53 chemical treatment by environment: afimoxifene Fig. 6 with image from Dasgupta et al., 2018
Kupffer's vesicle anatomical space decreased volume, abnormal a131Tg; sny120Tg + MO2-jupa + MO4-tp53 chemical treatment by environment: afimoxifene Fig. 6 with image from Dasgupta et al., 2018
Kupffer's vesicle anatomical space decreased volume, abnormal a131Tg; sny120Tg + MO4-tp53 + MO5-cftr chemical treatment by environment: afimoxifene Fig. 3 with image from Dasgupta et al., 2018
Kupffer's vesicle cell volume, abnormal a131Tg; sny120Tg + MO4-tp53 + MO5-cftr chemical treatment by environment: afimoxifene Fig. 3 with image from Dasgupta et al., 2018
Kupffer's vesicle regulation of cell shape process quality, abnormal a131Tg; sny120Tg + MO4-tp53 + MO5-cftr chemical treatment by environment: afimoxifene Fig. 3 with image from Dasgupta et al., 2018
Kupffer's vesicle regulation of cell size process quality, abnormal a131Tg; sny120Tg + MO4-tp53 + MO5-cftr chemical treatment by environment: afimoxifene Fig. 3 with image from Dasgupta et al., 2018
heart contraction arrested, abnormal atp1a1a.1m883/m883; twu34Tg + MO1-atp1a1a.1 + MO4-tp53 standard conditions text only from Langenbacher et al., 2012
posterior lateral line increased diameter, abnormal ba4Tg; zf148Tg + MO4-tp53 + MO5-prnprs3 standard conditions Fig. 8 with image from Huc-Brandt et al., 2014
posterior lateral line myelinating Schwann cell circular, abnormal ba4Tg; zf148Tg + MO4-tp53 + MO5-prnprs3 standard conditions Fig. 8 with image from Huc-Brandt et al., 2014
posterior lateral line axon defasciculated, abnormal ba4Tg; zf148Tg + MO4-tp53 + MO5-prnprs3 standard conditions Fig. 8 with image from Huc-Brandt et al., 2014
myelination of posterior lateral line nerve axons decreased occurrence, abnormal ba4Tg; zf148Tg + MO4-tp53 + MO5-prnprs3 standard conditions Fig. 8 with image from Huc-Brandt et al., 2014
posterior lateral line development decreased process quality, abnormal ba4Tg; zf148Tg + MO4-tp53 + MO5-prnprs3 standard conditions Fig. 8 with image from Huc-Brandt et al., 2014
oligodendrocyte myelin sheath decreased length, ameliorated co18Tg; co19Tg + MO1-ptena + MO4-tp53 chemical treatment by environment: sirolimus Fig. 7 from Mathews et al., 2016
oligodendrocyte myelin sheath length, ameliorated co18Tg; co19Tg + MO1-ptena + MO4-tp53 chemical treatment by environment: U0126 Fig. 7 from Mathews et al., 2016
oligodendrocyte myelin sheath increased length, abnormal co18Tg; co19Tg + MO1-ptena + MO4-tp53 control Fig. 7 from Mathews et al., 2016
oligodendrocyte myelin sheath decreased length, abnormal co18Tg; co19Tg + MO4-tp53 chemical treatment by environment: sirolimus Fig. 7 from Mathews et al., 2016
endocrine pancreas decreased size, abnormal jh1Tg; jh2Tg + MO4-sbds + MO4-tp53 standard conditions Fig. 3 with image from Provost et al., 2012
exocrine pancreas development disrupted, abnormal jh1Tg; jh2Tg + MO4-sbds + MO4-tp53 standard conditions Fig. 3 with image from Provost et al., 2012
exocrine pancreas decreased size, abnormal jh1Tg; jh2Tg + MO4-sbds + MO4-tp53 standard conditions Fig. 3 with image from Provost et al., 2012
gastrula cell chromosome morphology, abnormal kca66Tg; kca6Tg + MO1-ncapg + MO4-tp53 standard conditions Fig. 4 with image from Seipold et al., 2009
mitotic sister chromatid segregation disrupted, abnormal kca66Tg; kca6Tg + MO1-ncapg + MO4-tp53 standard conditions Fig. 4 with image from Seipold et al., 2009
whole organism tnfrsf1a expression increased amount, abnormal li1Tg; uf1Tg + MO1-pdx1 + MO4-tp53 standard conditions Figure 7 with image from Xie et al., 2025
pronephric tubule decreased length, abnormal li1Tg; uf1Tg + MO1-pdx1 + MO4-tp53 standard conditions Figure 7 with image from Xie et al., 2025
yolk present, abnormal li1Tg; uf1Tg + MO1-pdx1 + MO4-tp53 standard conditions Figure 7 with image from Xie et al., 2025
pronephric glomerulus dilated, abnormal li1Tg; uf1Tg + MO1-pdx1 + MO4-tp53 standard conditions Figure 7 with image from Xie et al., 2025
eye anatomical region edematous, ameliorated mi1004Tg; rw0144Tg + MO4-tp53 chemical ablation: podocyte, chemical treatment by environment: metronidazole Fig. 4 from Zhai et al., 2019
extension edematous, ameliorated mi1004Tg; rw0144Tg + MO4-tp53 chemical ablation: podocyte, chemical treatment by environment: metronidazole Fig. 4 from Zhai et al., 2019
thoracic duct absent, abnormal nim5Tg; y1Tg + MO1-lamc3 + MO4-tp53 standard conditions Fig. 2 with image from Eve et al., 2017
CaP motoneuron release of sequestered calcium ion into cytosol asynchronous, abnormal nksaigff213aGt; zf415Tg + MO1-tpcn2 + MO4-tp53 standard conditions Fig. 1 with image from Kelu et al., 2018
CaP motoneuron release of sequestered calcium ion into cytosol occurrence, abnormal nksaigff213aGt; zf415Tg + MO1-tpcn2 + MO4-tp53 standard conditions Fig. 1 with image from Kelu et al., 2018
CaP motoneuron release of sequestered calcium ion into cytosol occurrence, abnormal nksaigff213aGt; zf415Tg + MO4-tp53 chemical treatment by environment: ryanodine Fig. 5 with image from Kelu et al., 2018
CaP motoneuron release of sequestered calcium ion into cytosol occurrence, abnormal nksaigff213aGt; zf415Tg + MO4-tp53 control Fig. 5 with image from Kelu et al., 2018
CaP motoneuron release of sequestered calcium ion into cytosol occurrence, ameliorated nksaigff213aGt; zf415Tg + MO4-tp53 chemical treatment by environment: D-myo-Ins(1,4,5)P3 hexakis(butyryloxymethyl) ester Fig. 5 with image from Kelu et al., 2018
CaP motoneuron release of sequestered calcium ion into cytosol occurrence, abnormal nksaigff213aGt; zf415Tg + MO4-tp53 chemical treatment by environment: caffeine Fig. 5 with image from Kelu et al., 2018
retinal inner plexiform layer decreased thickness, abnormal ptf1asa126/sa126; nns5Tg + MO1-ptf1a + MO4-ptf1a + MO4-tp53 standard conditions Fig. 2 with image from Randlett et al., 2013
retina ab1-elavl labeling absent, abnormal ptf1asa126/sa126; nns5Tg + MO1-ptf1a + MO4-ptf1a + MO4-tp53 control Fig. 5 with image from Randlett et al., 2013
amacrine cell absent, abnormal ptf1asa126/sa126; nns5Tg + MO1-ptf1a + MO4-ptf1a + MO4-tp53 control Fig. 5 with image from Randlett et al., 2013
retinal ganglion cell absent, abnormal ptf1asa126/sa126; nns5Tg + MO1-ptf1a + MO4-ptf1a + MO4-tp53 control Fig. 5 with image from Randlett et al., 2013
Muller cell absent, abnormal ptf1asa126/sa126; nns5Tg + MO1-ptf1a + MO4-ptf1a + MO4-tp53 control Fig. 5 with image from Randlett et al., 2013
peripheral olfactory organ disorganized, abnormal rw035Tg; rw037Tg + MO1-msi2b + MO4-tp53 standard conditions Fig. 7 from Hochgreb-Hägele et al., 2014
peripheral olfactory organ disorganized, abnormal rw035Tg; rw037Tg + MO2-msi2b + MO4-tp53 standard conditions Fig. 7 from Hochgreb-Hägele et al., 2014
vasculature development disrupted, abnormal s843Tg; sd2Tg + MO1-lrp1aa + MO4-tp53 standard conditions Fig. S5 from Pi et al., 2012
intersegmental vessel morphology, abnormal s843Tg; sd2Tg + MO1-lrp1aa + MO4-tp53 standard conditions Fig. S5 from Pi et al., 2012
post-vent region wholly dorsalized, abnormal s843Tg; sd2Tg + MO1-lrp1aa + MO4-tp53 standard conditions Fig. S5 from Pi et al., 2012
trunk vasculature morphology, abnormal s843Tg; sd2Tg + MO1-lrp1aa + MO4-tp53 standard conditions Fig. S5 from Pi et al., 2012
posterior cardinal vein structure, abnormal s843Tg; sd2Tg + MO1-rasip1 + MO4-tp53 standard conditions Fig. 3 from Wilson et al., 2013
dorsal aorta structure, abnormal s843Tg; sd2Tg + MO1-rasip1 + MO4-tp53 standard conditions Fig. 3 from Wilson et al., 2013
trunk vasculature broken, abnormal s843Tg; sd2Tg + MO1-rasip1 + MO4-tp53 standard conditions Fig. 3 from Wilson et al., 2013
cranial vasculature broken, abnormal s843Tg; sd2Tg + MO1-rasip1 + MO4-tp53 standard conditions Fig. 3 from Wilson et al., 2013
nucleate erythrocyte mislocalised, abnormal s843Tg; sd2Tg + MO1-rasip1 + MO4-tp53 standard conditions Fig. 3 from Wilson et al., 2013
cranial vasculature broken, abnormal s843Tg; sd2Tg + MO2-rasip1 + MO4-tp53 standard conditions Fig. S5 from Wilson et al., 2013
cranial vasculature morphology, abnormal s843Tg; sd2Tg + MO2-rasip1 + MO4-tp53 standard conditions Fig. S5 from Wilson et al., 2013
nucleate erythrocyte mislocalised, abnormal s843Tg; sd2Tg + MO2-rasip1 + MO4-tp53 standard conditions Fig. S5 from Wilson et al., 2013
swimming behavior decreased process quality, abnormal s1020tEt; s1985tTg + MO2-atp2a2a + MO4-tp53 control Fig. S6 from Malaichamy et al., 2025
eye decreased area, abnormal s1020tEt; s1985tTg + MO2-atp2a2a + MO4-tp53 control Fig. S6 from Malaichamy et al., 2025
locomotion decreased frequency, abnormal s1020tEt; s1985tTg + MO2-atp2a2a + MO4-tp53 control Fig. S6 from Malaichamy et al., 2025
whole organism decreased length, abnormal s1020tEt; s1985tTg + MO2-atp2a2a + MO4-tp53 control Fig. S6 from Malaichamy et al., 2025
trunk muscle decreased area, abnormal s1020tEt; s1985tTg + MO2-atp2a2a + MO4-tp53 control Fig. S6 from Malaichamy et al., 2025
intersegmental vessel parachordal vessel decreased amount, abnormal sd2Tg; y1Tg + MO1-lamc3 + MO4-tp53 standard conditions Fig. 2 with image from Eve et al., 2017
parachordal vessel aplastic, abnormal sd2Tg; y1Tg + MO1-lamc3 + MO4-tp53 standard conditions Fig. 2 with image from Eve et al., 2017
intersegmental vessel parachordal vessel decreased amount, abnormal sd2Tg; y1Tg + MO2-lamc3 + MO4-tp53 standard conditions Fig. 2 with image from Eve et al., 2017
parachordal vessel aplastic, abnormal sd2Tg; y1Tg + MO2-lamc3 + MO4-tp53 standard conditions Fig. 2 with image from Eve et al., 2017
posterior lateral line primordium actin filament bundle organization process quality, abnormal ui2Tg; zf106Tg + MO2-cxcl12a + MO4-tp53 standard conditions Fig. 6 with image from Xu et al., 2014
posterior lateral line primordium actin filament bundle organization process quality, abnormal ui2Tg; zf106Tg + MO4-tp53 + MO7-cxcr4b standard conditions Fig. 6 with image from Xu et al., 2014
head increased size, abnormal aldh1a2i26/i26 + MO1-rdh10a + MO2-rdh10a + MO4-tp53 standard conditions Fig. 4 with image from D'Aniello et al., 2015
nervous system wholly anteriorized, abnormal aldh1a2i26/i26 + MO1-rdh10a + MO2-rdh10a + MO4-tp53 standard conditions Fig. 4 with image from D'Aniello et al., 2015
whole organism decreased length, abnormal aldh1a2i26/i26 + MO1-rdh10a + MO2-rdh10a + MO4-tp53 standard conditions Fig. 4 with image from D'Aniello et al., 2015
pericardium edematous, abnormal aldh1a2i26/i26 + MO1-rdh10a + MO2-rdh10a + MO4-tp53 standard conditions Fig. 4 with image from D'Aniello et al., 2015
intestine moderately well differentiated, abnormal apchu745/hu745 + MO1-dot1l + MO4-tp53 standard conditions Fig. 8 with image from Mahmoudi et al., 2010
intestine moderately well differentiated, abnormal apchu745/hu745 + MO1-mllt10 + MO4-tp53 standard conditions Fig. 8 with image from Mahmoudi et al., 2010
intestine moderately well differentiated, abnormal apchu745/hu745 + MO2-dot1l + MO4-tp53 standard conditions Fig. 8 with image from Mahmoudi et al., 2010
intestine moderately well differentiated, abnormal apchu745/hu745 + MO2-mllt10 + MO4-tp53 standard conditions Fig. 8 with image from Mahmoudi et al., 2010
intestine well differentiated, abnormal apchu745/hu745 + MO3-tcf7l2 + MO4-tp53 standard conditions Fig. 8 with image from Mahmoudi et al., 2010
intestine poorly differentiated, abnormal apchu745/hu745 + MO4-tp53 standard conditions Fig. 8 with image from Mahmoudi et al., 2010
canonical Wnt signaling pathway decreased process quality, abnormal apchu745/hu745 + MO4-tp53 standard conditions Fig. 8 with image from Mahmoudi et al., 2010
dorsal telencephalon morphology, abnormal b1202Tg/+ + MO2-emx3 + MO3-emx3 + MO4-tp53 (AB) heat shock Fig. 6 with image from Viktorin et al., 2009
telencephalon wholly dorsalized, abnormal b1202Tg/+ + MO4-tp53 (AB) heat shock Fig. 6 with image from Viktorin et al., 2009
head ab19-h3 labeling increased amount, abnormal banprw337/rw337 + MO4-tp53 standard conditions Fig. 4 with image from Babu et al., 2022
head ab7-h2afx labeling increased amount, abnormal banprw337/rw337 + MO4-tp53 standard conditions Fig. 4 with image from Babu et al., 2022
pericyte cell population proliferation decreased occurrence, abnormal cd248acc11/cc11 + MO4-tp53 chemical treatment by environment: cobalt dichloride Fig. 7 with image from Wang et al., 2025
trunk pericyte apoptotic, ameliorated cd248acc11/cc11 + MO4-tp53 chemical treatment by environment: cobalt dichloride Fig. 7 with image from Wang et al., 2025
cerebellum has fewer parts of type cerebellar granule cell, abnormal cfdp1nub36/nub36 + MO4-tp53 standard conditions Fig. 5 from Itoh et al., 2021
cerebellum apoptotic process process quality, ameliorated cfdp1nub36/nub36 + MO4-tp53 standard conditions Fig. 5 from Itoh et al., 2021
cerebellum regulation of mitotic metaphase/anaphase transition decreased process quality, abnormal cfdp1nub36/nub36 + MO4-tp53 standard conditions Fig. 6 from Itoh et al., 2021
cerebellum ab5-casp3 labeling spatial pattern, ameliorated cfdp1nub36/nub36 + MO4-tp53 standard conditions Fig. 5 from Itoh et al., 2021
cerebellum Ab36-h3 labeling increased distribution, abnormal cfdp1nub36/nub36 + MO4-tp53 standard conditions Fig. 6 from Itoh et al., 2021
cerebellum cerebellar granule cell differentiation decreased process quality, abnormal cfdp1nub36/nub36 + MO4-tp53 standard conditions Fig. 5 from Itoh et al., 2021
cerebellum neurod1 expression decreased distribution, abnormal cfdp1nub36/nub36 + MO4-tp53 standard conditions Fig. 5Fig. 6 from Itoh et al., 2021
cerebellum regulation of cerebellar granule cell precursor proliferation decreased process quality, abnormal cfdp1nub36/nub36 + MO4-tp53 standard conditions Fig. 6 from Itoh et al., 2021
pharyngeal system development disrupted, abnormal chaf1bt24412/t24412 + MO4-tp53 (TU) standard conditions Fig. 8 from Fischer et al., 2007
pharyngeal arch 3-7 decreased size, abnormal chaf1bt24412/t24412 + MO4-tp53 (TU) standard conditions Fig. 8 from Fischer et al., 2007
retina development in camera-type eye disrupted, abnormal chaf1bt24412/t24412 + MO4-tp53 (TU) standard conditions Fig. 8 from Fischer et al., 2007
retina decreased size, abnormal chaf1bt24412/t24412 + MO4-tp53 (TU) standard conditions Fig. 8 from Fischer et al., 2007
hindbrain has fewer parts of type T interneuron, abnormal cyp26a1rw716/rw716 + MO1-dhrs3a + MO4-tp53 standard conditions Fig. 9 with image from Feng et al., 2010
hindbrain has fewer parts of type T interneuron, abnormal cyp26a1rw716/rw716 + MO4-tp53 standard conditions Fig. 9 with image from Feng et al., 2010
whole organism dead, abnormal eftud2fdu301/fdu301 + MO4-tp53 standard conditions Fig. 8 with image from Wu et al., 2019
whole organism viability, ameliorated eftud2fdu301/fdu301 + MO4-tp53 standard conditions Fig. 8 with image from Wu et al., 2019
brain apoptotic process occurrence, ameliorated eftud2fn10a/fn10a + MO4-tp53 (TL) standard conditions Fig. 7 with image from Lei et al., 2017
spinal cord apoptotic process occurrence, ameliorated eftud2fn10a/fn10a + MO4-tp53 (TL) standard conditions Fig. 7 with image from Lei et al., 2017
head morphology, ameliorated esf1ouc3/ouc3 + MO4-tp53 standard conditions Fig. 9 from Chen et al., 2018
pharyngeal arch cartilage amount, ameliorated esf1ouc3/ouc3 + MO4-tp53 standard conditions Fig. 9 from Chen et al., 2018
motor neuron axon unbranched, abnormal etfdhp6di/p6di + MO4-tp53 standard conditions Fig. S9 with image from Song et al., 2009
motor neuron axon terminus decreased amount, abnormal etfdhp6di/p6di + MO4-tp53 standard conditions Fig. S9 with image from Song et al., 2009
erythroblast gfi1b expression increased amount, abnormal gfi1aaqmc551Gt/+ + MO4-gfi1b + MO4-tp53 + MO5-gfi1b standard conditions Fig. 1 from Moore et al., 2018
erythroblast EGFP expression increased amount, abnormal gfi1aaqmc551Gt/+ + MO4-gfi1b + MO4-tp53 + MO5-gfi1b standard conditions Fig. 1 from Moore et al., 2018
erythroblast gfi1aa expression increased amount, abnormal gfi1aaqmc551Gt/+ + MO4-gfi1b + MO4-tp53 + MO5-gfi1b standard conditions Fig. 1 from Moore et al., 2018
erythroblast increased size, abnormal gfi1aaqmc551Gt/qmc551Gt + MO4-gfi1b + MO4-tp53 + MO5-gfi1b control Fig. 5 with image from Thambyrajah et al., 2016
erythrocyte maturation decreased occurrence, abnormal gfi1aaqmc551Gt/qmc551Gt + MO4-gfi1b + MO4-tp53 + MO5-gfi1b control Fig. 5 with image from Thambyrajah et al., 2016
erythroblast EGFP expression increased amount, abnormal gfi1aaqmc551Gt/qmc551Gt + MO4-gfi1b + MO4-tp53 + MO5-gfi1b standard conditions Fig. 1 from Moore et al., 2018
erythroblast gfi1aa expression amount, ameliorated gfi1aaqmc551Gt/qmc551Gt + MO4-gfi1b + MO4-tp53 + MO5-gfi1b standard conditions Fig. 1 from Moore et al., 2018
erythroblast nucleus structure, abnormal gfi1aaqmc551Gt/qmc551Gt + MO4-gfi1b + MO4-tp53 + MO5-gfi1b control Fig. 5 with image from Thambyrajah et al., 2016
brain vasculature hemorrhagic, exacerbated gmdsnfl2/nfl2 + MO1-fcsk + MO4-tp53 (AB) control Fig. 2 with image from Fowler et al., 2021
apoptotic process decreased occurrence, abnormal gnl2bw41c/bw41c + MO4-tp53 standard conditions Fig. 6 with image from Paridaen et al., 2011
retinal ganglion cell layer immature, abnormal gnl2bw41c/bw41c + MO4-tp53 standard conditions Fig. 6 with image from Paridaen et al., 2011
retinal ganglion cell layer immature, abnormal gnl3hu3259/hu3259 + MO4-tp53 standard conditions Fig. 6 with image from Paridaen et al., 2011
apoptotic process decreased occurrence, abnormal gnl3hu3259/hu3259 + MO4-tp53 standard conditions Fig. 6 with image from Paridaen et al., 2011
whole organism cytosolic ribosome decreased amount, abnormal gnl3hu3259/hu3259 + MO4-tp53 standard conditions Fig. 6 with image from Essers et al., 2014
whole organism site of double-strand break increased amount, abnormal gon4lbtu24/tu24 + MO4-tp53 standard conditions Fig. 4Fig. 5 from Lim et al., 2009
somite border morphology, ameliorated gon4lbtu24/tu24 + MO4-tp53 standard conditions Fig. 2 from Lim et al., 2009
whole organism apoptotic process occurrence, ameliorated gon4lbtu24/tu24 + MO4-tp53 standard conditions Fig. 2 from Lim et al., 2009
somite shape, ameliorated gon4lbtu24/tu24 + MO4-tp53 standard conditions Fig. 2 from Lim et al., 2009
somite posterior side myod1 expression spatial pattern, ameliorated gon4lbtu24/tu24 + MO4-tp53 standard conditions Fig. 2 from Lim et al., 2009
cardiac ventricle cardiac muscle cell amount, ameliorated hdac1nl18/nl18 + MO1-tbx1 + MO4-tp53 standard conditions Fig 8 with image from Song et al., 2019
hindbrain oligodendrocyte mbpa expression amount, ameliorated hmgcs1vu57/vu57 + MO1-ptena + MO4-tp53 chemical treatment by environment: U0126 Fig. 4 from Mathews et al., 2016
hindbrain oligodendrocyte mbpa expression amount, ameliorated hmgcs1vu57/vu57 + MO1-ptena + MO4-tp53 control Fig. 4 from Mathews et al., 2016
hindbrain oligodendrocyte development process quality, ameliorated hmgcs1vu57/vu57 + MO1-ptena + MO4-tp53 chemical treatment by environment: U0126 Fig. 4 from Mathews et al., 2016
hindbrain oligodendrocyte mbpa expression decreased amount, abnormal hmgcs1vu57/vu57 + MO1-ptena + MO4-tp53 chemical treatment by environment: sirolimus Fig. 4 from Mathews et al., 2016
hindbrain oligodendrocyte plp1a expression amount, ameliorated hmgcs1vu57/vu57 + MO1-ptena + MO4-tp53 chemical treatment by environment: U0126 Fig. 4 from Mathews et al., 2016
hindbrain oligodendrocyte plp1a expression amount, ameliorated hmgcs1vu57/vu57 + MO1-ptena + MO4-tp53 control Fig. 4 from Mathews et al., 2016
hindbrain oligodendrocyte plp1a expression decreased amount, abnormal hmgcs1vu57/vu57 + MO1-ptena + MO4-tp53 chemical treatment by environment: sirolimus Fig. 4 from Mathews et al., 2016
hindbrain oligodendrocyte development process quality, ameliorated hmgcs1vu57/vu57 + MO1-ptena + MO4-tp53 control Fig. 4 from Mathews et al., 2016
hindbrain oligodendrocyte development decreased process quality, abnormal hmgcs1vu57/vu57 + MO1-ptena + MO4-tp53 chemical treatment by environment: sirolimus Fig. 4 from Mathews et al., 2016
hindbrain oligodendrocyte plp1a expression decreased amount, abnormal hmgcs1vu57/vu57 + MO4-tp53 control Fig. 4 from Mathews et al., 2016
hindbrain oligodendrocyte plp1a expression decreased amount, abnormal hmgcs1vu57/vu57 + MO4-tp53 chemical treatment by environment: U0126 Fig. 4 from Mathews et al., 2016
hindbrain oligodendrocyte mbpa expression decreased amount, abnormal hmgcs1vu57/vu57 + MO4-tp53 chemical treatment by environment: U0126 Fig. 4 from Mathews et al., 2016
hindbrain oligodendrocyte development decreased process quality, abnormal hmgcs1vu57/vu57 + MO4-tp53 chemical treatment by environment: U0126 Fig. 4 from Mathews et al., 2016
hindbrain oligodendrocyte mbpa expression decreased amount, abnormal hmgcs1vu57/vu57 + MO4-tp53 chemical treatment by environment: sirolimus Fig. 4 from Mathews et al., 2016
hindbrain oligodendrocyte mbpa expression decreased amount, abnormal hmgcs1vu57/vu57 + MO4-tp53 control Fig. 4 from Mathews et al., 2016
hindbrain oligodendrocyte plp1a expression decreased amount, abnormal hmgcs1vu57/vu57 + MO4-tp53 chemical treatment by environment: sirolimus Fig. 4 from Mathews et al., 2016
hindbrain oligodendrocyte development decreased process quality, abnormal hmgcs1vu57/vu57 + MO4-tp53 control Fig. 4 from Mathews et al., 2016
hindbrain oligodendrocyte development decreased process quality, abnormal hmgcs1vu57/vu57 + MO4-tp53 chemical treatment by environment: sirolimus Fig. 4 from Mathews et al., 2016
trunk apoptotic process occurrence, ameliorated kars1omf1/omf1 + MO4-tp53 (NHGRI-1) standard conditions Fig. 4 with image from Lin et al., 2021
brain apoptotic process occurrence, ameliorated kars1omf1/omf1 + MO4-tp53 (NHGRI-1) standard conditions Fig. 4 with image from Lin et al., 2021
whole organism casp8 expression amount, ameliorated kars1omf1/omf1 + MO4-tp53 (NHGRI-1) standard conditions Fig. 4 with image from Lin et al., 2021
whole organism gnb3b expression amount, ameliorated kars1omf1/omf1 + MO4-tp53 (NHGRI-1) standard conditions Fig. 4 with image from Lin et al., 2021
whole organism mbpa expression amount, ameliorated kars1omf1/omf1 + MO4-tp53 (NHGRI-1) standard conditions Fig. 4 with image from Lin et al., 2021
whole organism casp9 expression amount, ameliorated kars1omf1/omf1 + MO4-tp53 (NHGRI-1) standard conditions Fig. 4 with image from Lin et al., 2021
eye apoptotic process occurrence, ameliorated kars1omf1/omf1 + MO4-tp53 (NHGRI-1) standard conditions Fig. 4 with image from Lin et al., 2021
inner ear apoptotic process occurrence, ameliorated kars1omf1/omf1 + MO4-tp53 (NHGRI-1) standard conditions Fig. 4 with image from Lin et al., 2021
whole organism neurod1 expression amount, ameliorated kars1omf1/omf1 + MO4-tp53 (NHGRI-1) standard conditions Fig. 4 with image from Lin et al., 2021
whole organism grk7a expression amount, ameliorated kars1omf1/omf1 + MO4-tp53 (NHGRI-1) standard conditions Fig. 4 with image from Lin et al., 2021
eye size, ameliorated kars1omf1/omf1 + MO4-tp53 (NHGRI-1) standard conditions Fig. 4 with image from Lin et al., 2021
epidermis somatic stem cell amount, ameliorated klf4as32/+ + MO4-tp53 standard conditions Fig. S6 from Chen et al., 2019
ventricular endocardium lamb1b expression decreased amount, abnormal lamb1ash590/+ + MO1-tnnt2a + MO4-tp53 standard conditions Fig. 5 with image from Derrick et al., 2021
atrial endocardium lamb1b expression decreased amount, abnormal lamb1ash590/+ + MO1-tnnt2a + MO4-tp53 standard conditions Fig. 5 with image from Derrick et al., 2021
endocardium klf2a expression decreased amount, abnormal lamb1ash590/+ + MO1-tnnt2a + MO4-tp53 standard conditions Fig. 5 with image from Derrick et al., 2021
ventricular endocardium lamb1b expression decreased amount, abnormal lamb1ash590/sh590 + MO1-tnnt2a + MO4-tp53 standard conditions Fig. 5 with image from Derrick et al., 2021
endocardium aldh1a2 expression amount, ameliorated lamb1ash590/sh590 + MO1-tnnt2a + MO4-tp53 standard conditions Fig. 7 with image from Derrick et al., 2021
endocardium klf2a expression amount, ameliorated lamb1ash590/sh590 + MO1-tnnt2a + MO4-tp53 standard conditions Fig. 5 with image from Derrick et al., 2021
heart myl7 expression amount, ameliorated lamb1ash590/sh590 + MO1-tnnt2a + MO4-tp53 standard conditions Fig. 6 with image from Derrick et al., 2021
atrial endocardium lamb1b expression decreased amount, abnormal lamb1ash590/sh590 + MO1-tnnt2a + MO4-tp53 standard conditions Fig. 5 with image from Derrick et al., 2021
endocardium lamb1b expression mislocalised, abnormal lamb1ash590/sh590 + MO4-tp53 standard conditions Fig. 5 with image from Derrick et al., 2021
endocardium aldh1a2 expression mislocalised, abnormal lamb1ash590/sh590 + MO4-tp53 standard conditions Fig. 7 with image from Derrick et al., 2021
heart myl7 expression increased amount, abnormal lamb1ash590/sh590 + MO4-tp53 standard conditions Fig. 6 with image from Derrick et al., 2021
endocardium lamb1b expression increased distribution, abnormal lamb1ash590/sh590 + MO4-tp53 standard conditions Fig. 5 with image from Derrick et al., 2021
endocardium aldh1a2 expression increased distribution, abnormal lamb1ash590/sh590 + MO4-tp53 standard conditions Fig. 7 with image from Derrick et al., 2021
ventricular endocardium klf2a expression increased amount, abnormal lamb1ash590/sh590 + MO4-tp53 standard conditions Fig. 5 with image from Derrick et al., 2021
atrial endocardium klf2a expression increased amount, abnormal lamb1ash590/sh590 + MO4-tp53 standard conditions Fig. 5 with image from Derrick et al., 2021
median fin fold decreased size, abnormal lef1nl2/nl2 + MO1-tcf7 + MO4-tp53 (WIK/AB) standard conditions Fig. 4 with image from McGraw et al., 2011
posterior lateral line truncated, abnormal lef1nl2/nl2 + MO1-tcf7 + MO4-tp53 (WIK/AB) standard conditions Fig. 4 with image from McGraw et al., 2011
pectoral fin hypoplastic, abnormal lef1nl2/nl2 + MO1-tcf7 + MO4-tp53 (WIK/AB) standard conditions Fig. S5 with image from McGraw et al., 2011
whole organism cdkn1a expression amount, ameliorated ltv1swu54/swu54 + MO4-tp53 (TU) standard conditions FIGURE 7 with image from Zhang et al., 2021
cardiac muscle cell decreased size, abnormal mat2aaxu0364Gt/xu0364Gt + MO4-tp53 (WIK) standard conditions Fig. 4 from Ding et al., 2013
cardiac muscle cell cell population proliferation decreased process quality, abnormal mat2aaxu0364Gt/xu0364Gt + MO4-tp53 (WIK) standard conditions Fig. 4 from Ding et al., 2013
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell amount, ameliorated mir142aioz13/ioz13 + MO1-irf7 + MO4-tp53 standard conditions Fig. 8 with image from Lu et al., 2015
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell runx1 expression amount, ameliorated mir142aioz13/ioz13 + MO1-irf7 + MO4-tp53 standard conditions Fig. 8 with image from Lu et al., 2015
trunk irf7 expression increased amount, abnormal mir142aioz13/ioz13 + MO4-tp53 standard conditions Fig. 8 with image from Lu et al., 2015
trunk runx1 expression amount, ameliorated mir142aioz13/ioz13 + MO4-tp53 standard conditions Fig. 7 with image from Lu et al., 2015
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell amount, ameliorated mir142aioz13/ioz13 + MO4-tp53 standard conditions Fig. 7 with image from Lu et al., 2015
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell runx1 expression amount, ameliorated mir142aioz13/ioz13 + MO4-tp53 standard conditions Fig. 7 with image from Lu et al., 2015
caudal hematopoietic tissue myb expression decreased amount, abnormal mtorcq69/cq69 + MO4-tp53 standard conditions Fig. 6 with image from Huang et al., 2024
retina cell decreased amount, abnormal ncapgs105/s105 + MO4-tp53 (TL) standard conditions Fig. 3 with image from Seipold et al., 2009
exocrine pancreas decreased size, abnormal nom1zf591/zf591 + MO4-tp53 standard conditions Fig. 8 with image from Qin et al., 2014
exocrine pancreas development decreased process quality, abnormal nom1zf591/zf591 + MO4-tp53 standard conditions Fig. 8 with image from Qin et al., 2014
head tp53 expression amount, ameliorated nop56sa12582/sa12582 + MO4-tp53 control Fig. 9 with image from Quelle-Regaldie et al., 2022
ceratobranchial 4 cartilage chondrocyte organization quality, ameliorated nup62lzf3224/zf3224 + MO4-tp53 (AB) control Figure 6 with image from Yang et al., 2019
pharyngeal arch length, ameliorated nup62lzf3224/zf3224 + MO4-tp53 (AB) control Figure 6 with image from Yang et al., 2019
pharyngeal arch apoptotic process process quality, ameliorated nup62lzf3224/zf3224 + MO4-tp53 (AB) control Figure 6 with image from Yang et al., 2019
ceratobranchial 3 cartilage chondrocyte organization quality, ameliorated nup62lzf3224/zf3224 + MO4-tp53 (AB) control Figure 6 with image from Yang et al., 2019
whole organism tp53i11a expression amount, ameliorated nup62lzf3224/zf3224 + MO4-tp53 (AB) control Figure 6 with image from Yang et al., 2019
eye apoptotic process process quality, ameliorated nup62lzf3224/zf3224 + MO4-tp53 (AB) control Figure 6 with image from Yang et al., 2019
optic tectum apoptotic process process quality, ameliorated nup62lzf3224/zf3224 + MO4-tp53 (AB) control Figure 6 with image from Yang et al., 2019
whole organism tp53i11b expression amount, ameliorated nup62lzf3224/zf3224 + MO4-tp53 (AB) control Figure 6 with image from Yang et al., 2019
whole organism tp53bp1 expression amount, ameliorated nup62lzf3224/zf3224 + MO4-tp53 (AB) control Figure 6 with image from Yang et al., 2019
pharyngeal arch thickness, ameliorated nup62lzf3224/zf3224 + MO4-tp53 (AB) control Figure 6 with image from Yang et al., 2019
ceratobranchial 2 cartilage chondrocyte organization quality, ameliorated nup62lzf3224/zf3224 + MO4-tp53 (AB) control Figure 6 with image from Yang et al., 2019
eye morphology, ameliorated prim1rw255/rw255 + MO4-tp53 (RW) standard conditions Fig. 7 with image from Yamaguchi et al., 2008
optokinetic behavior decreased occurrence, abnormal prim1rw255/rw255 + MO4-tp53 (RW) standard conditions text only from Yamaguchi et al., 2008
retinal neural layer apoptotic process occurrence, ameliorated prim1rw255/rw255 + MO4-tp53 (RW) standard conditions Fig. 7 with image from Yamaguchi et al., 2008
retinal ganglion cell zn-5 labeling amount, ameliorated prim1rw255/rw255 + MO4-tp53 (RW) standard conditions Fig. 7 with image from Yamaguchi et al., 2008
retinal cone cell zpr-1 labeling amount, ameliorated prim1rw255/rw255 + MO4-tp53 (RW) standard conditions Fig. 7 with image from Yamaguchi et al., 2008
retina apoptotic, ameliorated rbbp4is60/is60 + MO4-tp53 standard conditions Fig. 9 from Schultz-Rogers et al., 2022
midbrain apoptotic, ameliorated rbbp4is60/is60 + MO4-tp53 standard conditions Fig. 9 from Schultz-Rogers et al., 2022
nucleate erythrocyte decreased amount, abnormal rpl11hi3820bTg/hi3820bTg + MO4-tp53 standard conditions Fig. 2 from Chakraborty et al., 2017
regulation of glucose metabolic process disrupted, abnormal rpl11hi3820bTg/hi3820bTg + MO4-tp53 standard conditions Fig. 4 from Danilova et al., 2011
whole organism hemoglobin increased amount, ameliorated rpl18zf3219/zf3219 + MO4-tp53 (TU) standard conditions Fig. 5 with image from Chen et al., 2020
nucleate erythrocyte decreased amount, abnormal rps7hi1034bTg/hi1034bTg + MO4-tp53 standard conditions Fig. 1 from Antunes et al., 2015
hemopoiesis decreased process quality, abnormal rps7hi1034bTg/hi1034bTg + MO4-tp53 standard conditions Fig. 1 from Antunes et al., 2015
pericardium edematous, abnormal rps7hi1034bTg/hi1034bTg + MO4-tp53 standard conditions Fig. S2 from Antunes et al., 2015
whole organism mdm2 expression increased amount, abnormal rps9la490/la490 + MO4-tp53 (AB) control Figure 5 with image from Chen et al., 2019
whole organism tp53 expression increased amount, abnormal rps9la490/la490 + MO4-tp53 (AB) control Figure 5 with image from Chen et al., 2019
whole organism cdkn1a expression increased amount, abnormal rps9la490/la490 + MO4-tp53 (AB) control Figure 5 with image from Chen et al., 2019
pericardium morphology, ameliorated rps9la490/la490 + MO4-tp53 (AB) control Figure 5 with image from Chen et al., 2019
whole organism hemoglobin amount, ameliorated rps9la490/la490 + MO4-tp53 (AB) control Figure 5 with image from Chen et al., 2019
trunk length, ameliorated rps9la490/la490 + MO4-tp53 (AB) control Figure 5 with image from Chen et al., 2019
whole organism mdm2 expression increased amount, abnormal rps9la491/la491 + MO4-tp53 (AB) control Figure 5 with image from Chen et al., 2019
whole organism tp53 expression increased amount, abnormal rps9la491/la491 + MO4-tp53 (AB) control Figure 5 with image from Chen et al., 2019
whole organism cdkn1a expression increased amount, abnormal rps9la491/la491 + MO4-tp53 (AB) control Figure 5 with image from Chen et al., 2019
pericardium morphology, ameliorated rps9la491/la491 + MO4-tp53 (AB) control Figure 5 with image from Chen et al., 2019
whole organism hemoglobin amount, ameliorated rps9la491/la491 + MO4-tp53 (AB) control Figure 5 with image from Chen et al., 2019
trunk length, ameliorated rps9la491/la491 + MO4-tp53 (AB) control Figure 5 with image from Chen et al., 2019
erythroid lineage cell amount, ameliorated rps14zf626/zf626 + MO4-tp53 standard conditions Fig. 6 from Ear et al., 2016
head size, ameliorated rps14zf626/zf626 + MO4-tp53 standard conditions Fig. 6 from Ear et al., 2016
caudal hematopoietic tissue myb expression decreased amount, abnormal rptorcq70/cq70 + MO4-tp53 standard conditions Fig. 6 with image from Huang et al., 2024
retina mitotic cell cycle increased occurrence, abnormal stilcz65/cz65 + MO4-tp53 standard conditions Fig. 6 with image from Novorol et al., 2013
brain apoptotic process process quality, ameliorated supt16hkan1/kan1 + MO4-tp53 (AB) control Fig. 4 with image from Lee et al., 2026
trunk decreased length, abnormal supt16hkan1/kan1 + MO4-tp53 (AB) control Fig. 4 with image from Lee et al., 2026
pharyngeal arch apoptotic process process quality, ameliorated supt16hkan1/kan1 + MO4-tp53 (AB) control Fig. 4 with image from Lee et al., 2026
head length, ameliorated supt16hkan1/kan1 + MO4-tp53 (AB) control Fig. 4 with image from Lee et al., 2026
spinal cord apoptotic process process quality, ameliorated supt16hkan1/kan1 + MO4-tp53 (AB) control Fig. 4 with image from Lee et al., 2026
dorsal aorta runx1 expression amount, ameliorated supt16hsd45/sd45 + MO4-tp53 standard conditions Fig. 3 from Espanola et al., 2020
axonogenesis disrupted, abnormal tardbpbfh301/fh301 + MO1-tardbpa + MO4-tp53 (AB) standard conditions Fig. 4 from Hewamadduma et al., 2013
post-vent region curved, abnormal tardbpbfh301/fh301 + MO1-tardbpa + MO4-tp53 (AB) standard conditions Fig. 3 from Hewamadduma et al., 2013
axonogenesis arrested, abnormal tardbpbfh301/fh301 + MO1-tardbpa + MO4-tp53 (AB) standard conditions Fig. 4 from Hewamadduma et al., 2013
whole organism dead, abnormal tardbpbfh301/fh301 + MO1-tardbpa + MO4-tp53 (AB) standard conditions Fig. 3 from Hewamadduma et al., 2013
swimming behavior disrupted, abnormal tardbpbfh301/fh301 + MO1-tardbpa + MO4-tp53 (AB) standard conditions Fig. 3 from Hewamadduma et al., 2013
somite morphology, abnormal tbxtab195/b195 + MO1-tbxtb + MO4-tp53 standard conditions Fig. 2 with image from Martin et al., 2008
somite decreased amount, abnormal tbxtab195/b195 + MO1-tbxtb + MO4-tp53 standard conditions Fig. 2 with image from Martin et al., 2008
post-vent region decreased length, abnormal tbxtab195/b195 + MO1-tbxtb + MO4-tp53 standard conditions Fig. 2 with image from Martin et al., 2008
somite decreased size, abnormal tbxtab195/b195 + MO1-tbxtb + MO4-tp53 standard conditions Fig. 2 with image from Martin et al., 2008
caudal fin truncated, abnormal tbxtaw181/w181 + MO2-tbxtb + MO4-tp53 cold exposure Fig. 5 with image from Kimelman, 2016
caudal fin kinked, abnormal tbxtaw181/w181 + MO2-tbxtb + MO4-tp53 cold exposure Fig. 5 with image from Kimelman, 2016
caudal fin morphology, abnormal tbxtaw181/w181 + MO2-tbxtb + MO4-tp53 cold exposure Fig. 5 with image from Kimelman, 2016
melanocyte differentiation disrupted, abnormal tfap2ats213/ts213 + MO2-tfap2e + MO4-tp53 standard conditions Fig. 3 with imageFig. 5 with image from Van Otterloo et al., 2010
melanocyte decreased amount, abnormal tfap2ats213/ts213 + MO2-tfap2e + MO4-tp53 standard conditions Fig. 3 with imageFig. 5 with image from Van Otterloo et al., 2010
pigment cell decreased amount, abnormal tfap2ats213/ts213 + MO2-tfap2e + MO4-tp53 standard conditions Fig. 4 with image from Van Otterloo et al., 2010
whole organism apoptotic, abnormal tp53zdf1/zdf1 + MO2-chek1 + MO4-tp53 radiation Fig. 2 with image from Sidi et al., 2008
melanocyte decreased amount, abnormal trpm7b722/b722 + MO4-tp53 standard conditions Fig. 1 from McNeill et al., 2007
melanocyte low saturation, abnormal trpm7b722/b722 + MO4-tp53 standard conditions Fig. 1 from McNeill et al., 2007
melanocyte decreased size, abnormal trpm7b722/b722 + MO4-tp53 standard conditions Fig. 1 from McNeill et al., 2007
skeletal muscle sarcomere disorganized, abnormal ttn.2sfc11/sfc11 + MO4-tp53 (EKW) standard conditions Fig. 3 with image from Zou et al., 2015
thymus rag1 expression amount, ameliorated urb2cq42/cq42 + MO4-tp53 standard conditions Fig. 4 from Cai et al., 2018
caudal hematopoietic tissue myb expression amount, ameliorated urb2cq42/cq42 + MO4-tp53 standard conditions Fig. 4 from Cai et al., 2018
somite condensed, abnormal wnt5bhi1780bTg/hi1780bTg + MO4-tp53 standard conditions Fig. 1 with image from Robu et al., 2007
whole organism decreased length, abnormal wnt5bhi1780bTg/hi1780bTg + MO4-tp53 standard conditions Fig. 1 with image from Robu et al., 2007
post-vent region decreased length, abnormal wnt5bhi1780bTg/hi1780bTg + MO4-tp53 standard conditions Fig. 1 with image from Robu et al., 2007
ectoderm pax8 expression mislocalised, abnormal x17Tg/+ + MO3-sox3 + MO4-tp53 (AB) heat shock Fig. 10 with image from Gou et al., 2018
otic placode pax8 expression increased distribution, abnormal x17Tg/+ + MO3-sox3 + MO4-tp53 (AB) heat shock Fig. 10 with image from Gou et al., 2018
otic placode pax8 expression increased amount, abnormal x17Tg/+ + MO3-sox3 + MO4-tp53 (AB) heat shock Fig. 10 with image from Gou et al., 2018
otic placode pax8 expression spatial pattern, abnormal x17Tg/+ + MO3-sox3 + MO4-tp53 (AB) heat shock Fig. 10 with image from Gou et al., 2018
ventricular system morphology, abnormal AB + MO1-asphd1 + MO1-hirip3 + MO4-tp53 standard conditions Fig. S1 with imageTable S2 from McCammon et al., 2017
skeletal muscle cell disorganized, abnormal AB + MO1-asphd1 + MO1-hirip3 + MO4-tp53 standard conditions Table S2 from McCammon et al., 2017
brain morphology, abnormal AB + MO1-asphd1 + MO1-hirip3 + MO4-tp53 standard conditions Fig. S1 with imageTable S2 from McCammon et al., 2017
skeletal muscle cell morphology, abnormal AB + MO1-asphd1 + MO1-hirip3 + MO4-tp53 standard conditions Table S2 from McCammon et al., 2017
brain morphology, abnormal AB + MO1-asphd1 + MO1-ino80e + MO4-tp53 standard conditions Table S2 from McCammon et al., 2017
ventricular system morphology, abnormal AB + MO1-asphd1 + MO1-ino80e + MO4-tp53 standard conditions Table S2 from McCammon et al., 2017
enteric neuron decreased amount, abnormal AB + MO1-asphd1 + MO4-tp53 + MO5-ppp4ca standard conditions Table S2 from McCammon et al., 2017
skeletal muscle cell disorganized, abnormal AB + MO1-asphd1 + MO4-tp53 + MO5-ppp4ca standard conditions Table S2 from McCammon et al., 2017
skeletal muscle cell morphology, abnormal AB + MO1-asphd1 + MO4-tp53 + MO5-ppp4ca standard conditions Table S2 from McCammon et al., 2017
brain morphology, abnormal AB + MO1-asphd1 + MO4-tp53 + MO5-ppp4ca standard conditions Table S2 from McCammon et al., 2017
ventricular system morphology, abnormal AB + MO1-asphd1 + MO4-tp53 + MO5-ppp4ca standard conditions Table S2 from McCammon et al., 2017
ventricular system morphology, abnormal AB + MO1-doc2a + MO1-kif22 + MO4-tp53 standard conditions Fig. S1 with imageTable S2 from McCammon et al., 2017
brain morphology, abnormal AB + MO1-doc2a + MO1-kif22 + MO4-tp53 standard conditions Fig. S1 with imageTable S2 from McCammon et al., 2017
presumptive mesoderm tbxta expression amount, ameliorated AB + MO1-eaf1 + MO1-eaf2 + MO4-tp53 standard conditions Fig. 6 from Liu et al., 2017
renal absorption decreased process quality, abnormal AB + MO1-ehd1b + MO2-ehd1a + MO4-tp53 control Fig. S4 from Issler et al., 2022
whole organism Ab1-ehd1 labeling decreased amount, abnormal AB + MO1-ehd1b + MO2-ehd1a + MO4-tp53 control Fig. S4 from Issler et al., 2022
apoptotic process decreased occurrence, abnormal AB + MO1-fas + MO1-faslg + MO4-tp53 standard conditions Fig. S3 from Ferrari et al., 2014
brain morphology, abnormal AB + MO1-gdpd3a + MO1-sez6l2 + MO4-tp53 standard conditions Table S2 from McCammon et al., 2017
ventricular system morphology, abnormal AB + MO1-gdpd3a + MO1-sez6l2 + MO4-tp53 standard conditions Table S2 from McCammon et al., 2017
enteric neuron decreased amount, abnormal AB + MO1-hirip3 + MO1-kif22 + MO4-tp53 standard conditions Table S2 from McCammon et al., 2017
brain morphology, abnormal AB + MO1-hirip3 + MO1-kif22 + MO4-tp53 standard conditions Table S2 from McCammon et al., 2017
ventricular system morphology, abnormal AB + MO1-hirip3 + MO1-kif22 + MO4-tp53 standard conditions Table S2 from McCammon et al., 2017
brain morphology, abnormal AB + MO1-hirip3 + MO1-tlcd3ba + MO4-tp53 standard conditions Table S2 from McCammon et al., 2017
ventricular system morphology, abnormal AB + MO1-hirip3 + MO1-tlcd3ba + MO4-tp53 standard conditions Table S2 from McCammon et al., 2017
brain morphology, abnormal AB + MO1-ino80e + MO1-kif22 + MO4-tp53 standard conditions Table S2 from McCammon et al., 2017
ventricular system morphology, abnormal AB + MO1-ino80e + MO1-kif22 + MO4-tp53 standard conditions Table S2 from McCammon et al., 2017
ventricular system morphology, abnormal AB + MO1-kif22 + MO1-taok2b + MO4-tp53 standard conditions Fig. S1 with imageTable S2 from McCammon et al., 2017
enteric neuron decreased amount, abnormal AB + MO1-kif22 + MO1-taok2b + MO4-tp53 standard conditions Table S2 from McCammon et al., 2017
skeletal muscle cell disorganized, abnormal AB + MO1-kif22 + MO1-taok2b + MO4-tp53 standard conditions Fig. S3 with imageTable S2 from McCammon et al., 2017
brain morphology, abnormal AB + MO1-kif22 + MO1-taok2b + MO4-tp53 standard conditions Fig. S1 with imageTable S2 from McCammon et al., 2017
skeletal muscle cell morphology, abnormal AB + MO1-kif22 + MO1-taok2b + MO4-tp53 standard conditions Fig. S3 with imageTable S2 from McCammon et al., 2017
extension morphology, ameliorated AB + MO1-rnasel2, rnasel5 + MO4-tp53 standard conditions Fig. 5 from Zhai et al., 2015
extension decreased area, ameliorated AB + MO1-rnasel2, rnasel5 + MO4-tp53 standard conditions Fig. 5 from Zhai et al., 2015
hatching delayed, ameliorated AB + MO1-rnasel2, rnasel5 + MO4-tp53 standard conditions text only from Zhai et al., 2015
ventricular system morphology, abnormal AB + MO1-sez6l2 + MO1-taok2b + MO4-tp53 standard conditions Table S2 from McCammon et al., 2017
enteric neuron decreased amount, abnormal AB + MO1-sez6l2 + MO1-taok2b + MO4-tp53 standard conditions Fig. S3 with imageTable S2 from McCammon et al., 2017
skeletal muscle cell disorganized, abnormal AB + MO1-sez6l2 + MO1-taok2b + MO4-tp53 standard conditions Table S2 from McCammon et al., 2017
brain morphology, abnormal AB + MO1-sez6l2 + MO1-taok2b + MO4-tp53 standard conditions Table S2 from McCammon et al., 2017
skeletal muscle cell morphology, abnormal AB + MO1-sez6l2 + MO1-taok2b + MO4-tp53 standard conditions Table S2 from McCammon et al., 2017
brain morphology, abnormal AB + MO1-sez6l2 + MO4-mapk3 + MO4-tp53 standard conditions Table S2 from McCammon et al., 2017
ventricular system morphology, abnormal AB + MO1-sez6l2 + MO4-mapk3 + MO4-tp53 standard conditions Table S2 from McCammon et al., 2017
heart looping process quality, abnormal AB + MO1-vdra + MO2-vdrb + MO4-tp53 standard conditions Fig. 3 from Kwon, 2016
Meckel's cartilage absent, abnormal AB + MO1-vdra + MO2-vdrb + MO4-tp53 standard conditions Fig. 1 with image from Kwon, 2019
palatoquadrate cartilage absent, abnormal AB + MO1-vdra + MO2-vdrb + MO4-tp53 standard conditions Fig. 1 with image from Kwon, 2019
spinal cord fsta expression increased amount, abnormal AB + MO1-vdra + MO2-vdrb + MO4-tp53 standard conditions Fig. 2 with image from Kwon, 2019
pharyngeal arch fsta expression increased amount, abnormal AB + MO1-vdra + MO2-vdrb + MO4-tp53 standard conditions Fig. 2 with image from Kwon, 2019
heart jogging process quality, abnormal AB + MO1-vdra + MO2-vdrb + MO4-tp53 standard conditions Fig. 3 from Kwon, 2016
cardiac ventricle bmp4 expression increased distribution, abnormal AB + MO1-vdra + MO2-vdrb + MO4-tp53 standard conditions Fig. 4 from Kwon, 2016
heart lateralized, abnormal AB + MO1-vdra + MO2-vdrb + MO4-tp53 standard conditions Fig. 3 from Kwon, 2016
heart decreased functionality, abnormal AB + MO1-vdra + MO2-vdrb + MO4-tp53 standard conditions Fig. 2 from Kwon, 2016
brain fsta expression increased amount, abnormal AB + MO1-vdra + MO2-vdrb + MO4-tp53 standard conditions Fig. 2 with image from Kwon, 2019
cranial cartilage morphology, abnormal AB + MO1-vdra + MO2-vdrb + MO4-tp53 standard conditions Fig. 1 with image from Kwon, 2019
eye fsta expression increased amount, abnormal AB + MO1-vdra + MO2-vdrb + MO4-tp53 standard conditions Fig. 2 with image from Kwon, 2019
pericardium edematous, abnormal AB + MO1-vdra + MO2-vdrb + MO4-tp53 standard conditions Fig. 1 from Kwon, 2016
cranial cartilage hypoplastic, abnormal AB + MO1-vdra + MO2-vdrb + MO4-tp53 standard conditions Fig. 1 with image from Kwon, 2019
ceratobranchial cartilage decreased size, abnormal AB + MO1-vdra + MO2-vdrb + MO4-tp53 standard conditions Fig. 1 with image from Kwon, 2019
enteric neuron decreased amount, abnormal AB + MO2-kctd13 + MO4-tp53 + MO5-ppp4ca standard conditions Table S2 from McCammon et al., 2017
brain morphology, abnormal AB + MO2-kctd13 + MO4-tp53 + MO5-ppp4ca standard conditions Table S2 from McCammon et al., 2017
ventricular system morphology, abnormal AB + MO2-kctd13 + MO4-tp53 + MO5-ppp4ca standard conditions Table S2 from McCammon et al., 2017
liver development process quality, abnormal AB + MO2-tbxta + MO2-tbxtb + MO4-tp53 standard conditions Fig. S3 with image from Nelson et al., 2017
determination of liver left/right asymmetry decreased occurrence, abnormal AB + MO2-tbxta + MO2-tbxtb + MO4-tp53 standard conditions Fig. S3 with image from Nelson et al., 2017
determination of pancreatic left/right asymmetry decreased occurrence, abnormal AB + MO2-tbxta + MO2-tbxtb + MO4-tp53 standard conditions Fig. S3 with image from Nelson et al., 2017
determination of digestive tract left/right asymmetry decreased occurrence, abnormal AB + MO2-tbxta + MO2-tbxtb + MO4-tp53 standard conditions Fig. S3 with image from Nelson et al., 2017
digestive tract development process quality, abnormal AB + MO2-tbxta + MO2-tbxtb + MO4-tp53 standard conditions Fig. S3 with image from Nelson et al., 2017
pancreas development process quality, abnormal AB + MO2-tbxta + MO2-tbxtb + MO4-tp53 standard conditions Fig. S3 with image from Nelson et al., 2017
whole organism Ab1-gmppa labeling decreased amount, abnormal AB/TU + MO1-gmppaa + MO1-gmppab + MO4-tp53 standard conditions Fig. Extended Data Fig. 9 from Zheng et al., 2021
somite specification disrupted, abnormal AB/TU + MO1-igf2a + MO1-igf2b + MO2-igf2a + MO2-igf2b + MO4-tp53 standard conditions Fig. 4 from White et al., 2009
whole organism curved ventral, abnormal AB/TU + MO1-igf2a + MO1-igf2b + MO2-igf2a + MO2-igf2b + MO4-tp53 standard conditions text only from White et al., 2009
notochord undulate, abnormal AB/TU + MO1-igf2a + MO1-igf2b + MO2-igf2a + MO2-igf2b + MO4-tp53 standard conditions text only from White et al., 2009
trunk has fewer parts of type somite, abnormal AB/TU + MO1-igf2a + MO1-igf2b + MO2-igf2a + MO2-igf2b + MO4-tp53 standard conditions Fig. 4 from White et al., 2009
cardiac conduction disrupted, abnormal TU + MO1-rap1aa + MO2-rap1b + MO4-tp53 standard conditions Fig. 4 with image from Dong et al., 2012
cardiac muscle cardiac myofibril morphology, abnormal TU + MO1-rap1aa + MO2-rap1b + MO4-tp53 standard conditions Fig. 3 with image from Dong et al., 2012
cardiac muscle sarcomere morphology, abnormal TU + MO1-rap1aa + MO2-rap1b + MO4-tp53 standard conditions Fig. 3 with image from Dong et al., 2012
cardiac muscle gap junction decreased amount, abnormal TU + MO1-rap1aa + MO2-rap1b + MO4-tp53 standard conditions Fig. 3 with image from Dong et al., 2012
pericardium edematous, abnormal TU + MO1-rap1aa + MO2-rap1b + MO4-tp53 standard conditions Fig. 1 with image from Dong et al., 2012
caudal fin blistered, abnormal TU + MO1-rap1aa + MO2-rap1b + MO4-tp53 standard conditions Fig. 1 with image from Dong et al., 2012
cardiac muscle adherens junction decreased amount, abnormal TU + MO1-rap1aa + MO2-rap1b + MO4-tp53 standard conditions Fig. 3 with image from Dong et al., 2012
cardiac muscle striated muscle thin filament decreased amount, abnormal TU + MO1-rap1aa + MO2-rap1b + MO4-tp53 standard conditions Fig. 3 with image from Dong et al., 2012
trunk increased curvature, abnormal TU + MO1-rap1aa + MO2-rap1b + MO4-tp53 standard conditions Fig. 1 with image from Dong et al., 2012
heart physical object quality, abnormal WT + MO1-arglu1a + MO1-arglu1b + MO4-tp53 standard conditions Fig. 5 with image from Magomedova et al., 2019
brain development process quality, abnormal WT + MO1-arglu1a + MO1-arglu1b + MO4-tp53 standard conditions Fig. 5 with image from Magomedova et al., 2019
whole organism decreased life span, abnormal WT + MO1-arglu1a + MO1-arglu1b + MO4-tp53 standard conditions text only from Magomedova et al., 2019
pericardium edematous, abnormal WT + MO1-arglu1a + MO1-arglu1b + MO4-tp53 standard conditions Fig. 5 with image from Magomedova et al., 2019
whole organism anterior-posterior axis increased curvature, abnormal WT + MO1-arglu1a + MO1-arglu1b + MO4-tp53 standard conditions Fig. 5 with image from Magomedova et al., 2019
whole organism dorsalized, abnormal WT + MO1-bmpr1aa + MO1-bmpr1ab + MO2-bmpr1ab + MO4-tp53 standard conditions Fig. 3 with image from Demal et al., 2019
whole organism wholly ventralized, abnormal WT + MO1-chrd + MO1-zmiz2 + MO4-tp53 standard conditions Fig. S6 with image from Moreno-Ayala et al., 2015
dorsal/ventral pattern formation disrupted, abnormal WT + MO1-chrd + MO2-chrdl2 + MO4-tp53 standard conditions Fig. 8 with image from Branam et al., 2010
whole organism wholly ventralized, abnormal WT + MO1-chrd + MO2-chrdl2 + MO4-tp53 standard conditions Fig. 8 with image from Branam et al., 2010
rhombomere 2 egr2b expression mislocalised, abnormal WT + MO1-cyp26b1 + MO1-cyp26c1 + MO4-tp53 standard conditions Fig. 6 with image from Addison et al., 2018
rhombomere 6 egr2b expression mislocalised, abnormal WT + MO1-cyp26b1 + MO1-cyp26c1 + MO4-tp53 standard conditions Fig. 6 with image from Addison et al., 2018
rhombomere 4 egr2b expression mislocalised, abnormal WT + MO1-cyp26b1 + MO1-cyp26c1 + MO4-tp53 standard conditions Fig. 6 with image from Addison et al., 2018
presumptive rhombomere 3 cyp26c1 expression increased amount, abnormal WT + MO1-egr2a + MO1-egr2b + MO4-tp53 standard conditions Fig. 5 with image from Addison et al., 2018
rhombomere 3 cyp26c1 expression increased amount, abnormal WT + MO1-egr2a + MO1-egr2b + MO4-tp53 standard conditions Fig. 5 with image from Addison et al., 2018
rhombomere 3 cyp26b1 expression increased amount, abnormal WT + MO1-egr2a + MO1-egr2b + MO4-tp53 standard conditions Fig. 5 with image from Addison et al., 2018
rhombomere 5 cyp26c1 expression increased amount, abnormal WT + MO1-egr2a + MO1-egr2b + MO4-tp53 standard conditions Fig. 5 with image from Addison et al., 2018
presumptive rhombomere 5 cyp26c1 expression increased amount, abnormal WT + MO1-egr2a + MO1-egr2b + MO4-tp53 standard conditions Fig. 5 with image from Addison et al., 2018
presumptive rhombomere 3 cyp26b1 expression increased amount, abnormal WT + MO1-egr2a + MO1-egr2b + MO4-tp53 standard conditions Fig. 5 with image from Addison et al., 2018
rhombomere 2 egr2b expression mislocalised, abnormal WT + MO1-hoxb1a + MO1-hoxb1b + MO4-tp53 standard conditions Fig. 6 with image from Addison et al., 2018
rhombomere 4 egr2b expression mislocalised, abnormal WT + MO1-hoxb1a + MO1-hoxb1b + MO4-tp53 standard conditions Fig. 6 with image from Addison et al., 2018
growth decreased process quality, abnormal WT + MO1-itcha + MO2-itcha + MO2-itchb + MO4-tp53 standard conditions Fig. 3 with image from Angers et al., 2014
whole organism decreased length, abnormal WT + MO1-itcha + MO2-itcha + MO2-itchb + MO4-tp53 standard conditions Fig. 3 with image from Angers et al., 2014
brain hemorrhagic, abnormal WT + MO1-itgb8 + MO4-tp53 + MO8-nrp1a control Fig. 4 with image from Hirota et al., 2015
brain vasculature broken, abnormal WT + MO1-itgb8 + MO4-tp53 + MO8-nrp1a control Fig. 4 with image from Hirota et al., 2015
brain vasculature development process quality, abnormal WT + MO1-itgb8 + MO4-tp53 + MO8-nrp1a control Fig. 4 with image from Hirota et al., 2015
trunk central region has fewer parts of type dermomyotome, abnormal WT + MO1-mespba + MO1-mespbb + MO4-tp53 control Fig. 2 with image from Windner et al., 2015
somite myod1 expression increased distribution, abnormal WT + MO1-mespba + MO1-mespbb + MO4-tp53 control Fig. 2 with image from Windner et al., 2015
somite ripply1 expression decreased amount, abnormal WT + MO1-mespba + MO1-mespbb + MO4-tp53 control Fig. 2 with image from Windner et al., 2015
somite meox1 expression decreased amount, abnormal WT + MO1-mespba + MO1-mespbb + MO4-tp53 control Fig. 2 with image from Windner et al., 2015
somite lateral region meox1 expression decreased amount, abnormal WT + MO1-mespba + MO1-mespbb + MO4-tp53 control Fig. 2 with image from Windner et al., 2015
somite lateral region myod1 expression decreased amount, abnormal WT + MO1-mespba + MO1-mespbb + MO4-tp53 control Fig. 2 with image from Windner et al., 2015
post-vent region deformed, abnormal WT + MO1-mkxa + MO4-tp53 + MO6-myod1 standard conditions Fig. 11 from Chuang et al., 2014
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-mkxa + MO4-tp53 + MO6-myod1 standard conditions Fig. 11 from Chuang et al., 2014
skeletal muscle cell morphology, abnormal WT + MO1-mkxa + MO4-tp53 + MO6-myod1 standard conditions Fig. 11 from Chuang et al., 2014
whole organism curved, abnormal WT + MO1-mkxa + MO4-tp53 + MO6-myod1 standard conditions Fig. 11 from Chuang et al., 2014
atrioventricular valve decreased functionality, abnormal WT + MO1-nf1a + MO1-nf1b + MO4-tp53 standard conditions Fig. 3 from Padmanabhan et al., 2009
pericardium edematous, abnormal WT + MO1-nf1a + MO1-nf1b + MO4-tp53 standard conditions Fig. 3 from Padmanabhan et al., 2009
blood circulation disrupted, abnormal WT + MO1-nf1a + MO1-nf1b + MO4-tp53 standard conditions Fig. 3 from Padmanabhan et al., 2009
cardiac muscle cell proliferation decreased process quality, abnormal WT + MO1-scn5lab + MO1-tnnt2a + MO4-tp53 standard conditions Fig. 8 from Bennett et al., 2013
mesoderm development process quality, abnormal WT + MO1-siah1 + MO1-siah2l + MO4-tp53 standard conditions Fig. 8 from Kang et al., 2014
somite shape, abnormal WT + MO1-siah1 + MO1-siah2l + MO4-tp53 standard conditions Fig. 8 from Kang et al., 2014
whole organism shortened, abnormal WT + MO1-siah1 + MO1-siah2l + MO4-tp53 standard conditions Fig. 8 from Kang et al., 2014
whole organism morphology, abnormal WT + MO1-siah1 + MO1-siah2l + MO4-tp53 standard conditions Fig. 8 from Kang et al., 2014
whole organism physical object quality, abnormal WT + MO1-tdgf1 + MO1-zmiz2 + MO4-tp53 standard conditions Fig. S6 with image from Moreno-Ayala et al., 2015
somite shape, abnormal WT + MO2-emilin3a + MO2-emilin3b + MO4-tp53 standard conditions Fig. S1 with image from Corallo et al., 2013
notochord deformed, abnormal WT + MO2-emilin3a + MO2-emilin3b + MO4-tp53 standard conditions Fig. S1 with image from Corallo et al., 2013
posterior lateral line neuromast development disrupted, abnormal WT + MO2-llgl1 + MO3-llgl2 + MO4-tp53 standard conditions Fig. 5 from Hava et al., 2009
pectoral fin decreased size, abnormal WT + MO2-mir92a + MO4-tp53 standard conditions Fig. S1 with image from Ning et al., 2013
Meckel's cartilage absent, abnormal WT + MO2-mir92a + MO4-tp53 standard conditions Fig. 1 with image from Ning et al., 2013
ethmoid cartilage absent, abnormal WT + MO2-mir92a + MO4-tp53 standard conditions Fig. 1 with image from Ning et al., 2013
head decreased size, abnormal WT + MO2-mir92a + MO4-tp53 standard conditions Fig. 1 with image from Ning et al., 2013
pectoral fin morphology, abnormal WT + MO2-mir92a + MO4-tp53 standard conditions Fig. S1 with image from Ning et al., 2013
cleithrum absent, abnormal WT + MO2-mir92a + MO4-tp53 standard conditions Fig. S1 with image from Ning et al., 2013
pharyngeal arch decreased size, abnormal WT + MO2-mir92a + MO4-tp53 standard conditions Fig. 1 with image from Ning et al., 2013
occipital region absent, abnormal WT + MO2-mir92a + MO4-tp53 standard conditions Fig. 1 with image from Ning et al., 2013
pharyngeal arch absent, abnormal WT + MO2-mir92a + MO4-tp53 standard conditions Fig. 1 with image from Ning et al., 2013
scapulocoracoid absent, abnormal WT + MO2-mir92a + MO4-tp53 standard conditions Fig. S1 with image from Ning et al., 2013
pectoral fin endoskeletal disc decreased size, abnormal WT + MO2-mir92a + MO4-tp53 standard conditions Fig. S1 with image from Ning et al., 2013
eye decreased size, abnormal WT + MO2-mir92a + MO4-tp53 standard conditions Fig. 1 with image from Ning et al., 2013
palatoquadrate cartilage absent, abnormal WT + MO2-mir92a + MO4-tp53 standard conditions Fig. 1 with image from Ning et al., 2013
ceratohyal cartilage absent, abnormal WT + MO2-mir92a + MO4-tp53 standard conditions Fig. 1 with image from Ning et al., 2013
convergent extension involved in gastrulation disrupted, abnormal WT + MO2-mmp14b + MO4-mmp14a + MO4-tp53 standard conditions Fig. 3 from Coyle et al., 2008
extension decreased length, abnormal WT + MO2-mmp14b + MO4-mmp14a + MO4-tp53 standard conditions Fig. 3 from Coyle et al., 2008
whole organism decreased length, abnormal WT + MO2-mmp14b + MO4-mmp14a + MO4-tp53 standard conditions Fig. 3 from Coyle et al., 2008
brain hemorrhagic, abnormal WT + MO2-nrp1a + MO3-itgb8 + MO4-tp53 control Fig. 4 with image from Hirota et al., 2015
brain vasculature broken, abnormal WT + MO2-nrp1a + MO3-itgb8 + MO4-tp53 control Fig. 4 with image from Hirota et al., 2015
brain vasculature development process quality, abnormal WT + MO2-nrp1a + MO3-itgb8 + MO4-tp53 control Fig. 4 with image from Hirota et al., 2015
caudal fin shortened, abnormal WT + MO2-rarab + MO4-cyp26a1 + MO4-tp53 + MO5-cyp26a1 standard conditions Fig. 5 with image from D'Aniello et al., 2013
midbrain hindbrain boundary absent, abnormal WT + MO2-rarab + MO4-cyp26a1 + MO4-tp53 + MO5-cyp26a1 standard conditions Fig. 5 with imageFig. 6 with image from D'Aniello et al., 2013
retina apoptotic process increased process quality, abnormal WT + MO2-sox4a + MO3-sox4b + MO4-tp53 standard conditions Fig. 4 with image from Wen et al., 2015
retina protruding into brain, abnormal WT + MO2-sox4a + MO3-sox4b + MO4-tp53 standard conditions Fig. 2 with image from Wen et al., 2015
optic fissure closure incomplete, abnormal WT + MO2-sox4a + MO3-sox4b + MO4-tp53 standard conditions Fig. 2 with imageFig. 3 with imageFig. 5 with imageFig. 9 with image from Wen et al., 2015
closure of optic fissure decreased process quality, abnormal WT + MO2-sox4a + MO3-sox4b + MO4-tp53 standard conditions Fig. 2 with imageFig. 3 with imageFig. 5 with imageFig. 9 with image from Wen et al., 2015
retina cell population proliferation decreased process quality, abnormal WT + MO2-sox4a + MO3-sox4b + MO4-tp53 standard conditions Fig. 4 with image from Wen et al., 2015
retinal pigmented epithelium broken, abnormal WT + MO2-sox4a + MO3-sox4b + MO4-tp53 standard conditions Fig. 2 with image from Wen et al., 2015
optic fissure morphology, abnormal WT + MO2-sox4a + MO3-sox4b + MO4-tp53 standard conditions Fig. 2 with image from Wen et al., 2015
retinal ganglion cell layer cell population proliferation increased occurrence, abnormal WT + MO2-sox4a + MO3-sox4b + MO4-tp53 standard conditions Fig. 4 with image from Wen et al., 2015
smoothened signaling pathway increased process quality, abnormal WT + MO2-sox4a + MO3-sox4b + MO4-tp53 standard conditions Fig. 6 with image from Wen et al., 2015
hindbrain commissure disorganized, abnormal WT + MO2-sox11b + MO3-sox11a + MO4-tp53 standard conditions Fig. S7 from Tsurusaki et al., 2014
head decreased size, abnormal WT + MO2-sox11b + MO3-sox11a + MO4-tp53 standard conditions Fig. 4 from Tsurusaki et al., 2014
diencephalon neuron decreased amount, abnormal WT + MO2-sox11b + MO3-sox11a + MO4-tp53 standard conditions Fig. S7 from Tsurusaki et al., 2014
central nervous system apoptotic, abnormal WT + MO2-sox11b + MO3-sox11a + MO4-tp53 standard conditions Fig. 4 from Tsurusaki et al., 2014
telencephalon neuron decreased amount, abnormal WT + MO2-sox11b + MO3-sox11a + MO4-tp53 standard conditions Fig. S7 from Tsurusaki et al., 2014
whole organism lethal (sensu genetics), abnormal WT + MO2-sox11b + MO3-sox11a + MO4-tp53 standard conditions Fig. 4 from Tsurusaki et al., 2014
hindbrain axon decreased amount, abnormal WT + MO2-sox11b + MO3-sox11a + MO4-tp53 standard conditions Fig. S7 from Tsurusaki et al., 2014
melanocyte differentiation disrupted, abnormal WT + MO2-tfap2a + MO2-tfap2e + MO4-tp53 standard conditions Fig. 6 with imageFig. 7 with imageFig. 8 with image from Van Otterloo et al., 2010
melanocyte decreased amount, abnormal WT + MO2-tfap2a + MO2-tfap2e + MO4-tp53 standard conditions Fig. 7 with image from Van Otterloo et al., 2010
melanocyte pigment granule decreased amount, abnormal WT + MO2-tfap2a + MO2-tfap2e + MO4-tp53 standard conditions Fig. 7 with imageFig. 8 with image from Van Otterloo et al., 2010
spinal cord glutamatergic neuron decreased amount, abnormal WT + MO4-hmx2 + MO4-hmx3a + MO4-tp53 standard conditions Figure 3 with image from England et al., 2020
spinal cord inhibitory interneuron slc32a1 expression increased amount, abnormal WT + MO4-hmx2 + MO4-hmx3a + MO4-tp53 standard conditions Figure 3 with image from England et al., 2020
spinal cord inhibitory interneuron increased amount, abnormal WT + MO4-hmx2 + MO4-hmx3a + MO4-tp53 standard conditions Figure 3 with image from England et al., 2020
otolith fused with otolith, abnormal WT + MO4-hmx2 + MO4-hmx3a + MO4-tp53 standard conditions Figure 3 with image from England et al., 2020
rhombomere 4 Citrine expression increased distribution, abnormal fci3Tg/fci3Tg + MO1-cyp26b1 + MO1-cyp26c1 + MO1-epha4a + MO4-tp53 standard conditions Fig. 6 with image from Addison et al., 2018
rhombomere 4 egr2b expression mislocalised, abnormal fci3Tg/fci3Tg + MO1-cyp26b1 + MO1-cyp26c1 + MO1-epha4a + MO4-tp53 standard conditions Fig. 6 with image from Addison et al., 2018
rhombomere 4 Citrine expression increased distribution, abnormal fci3Tg/fci3Tg + MO1-epha4a + MO1-hoxb1a + MO1-hoxb1b + MO4-tp53 standard conditions Fig. 6 with image from Addison et al., 2018
rhombomere 4 egr2b expression mislocalised, abnormal fci3Tg/fci3Tg + MO1-epha4a + MO1-hoxb1a + MO1-hoxb1b + MO4-tp53 standard conditions Fig. 6 with image from Addison et al., 2018
larval locomotory behavior process quality, abnormal slc24a5b1/+ + MO1-myo9aa + MO1-myo9ab + MO4-tp53 standard conditions Fig. SVideo from O'Connor et al., 2016
thigmotaxis disrupted, abnormal slc24a5b1/+ + MO1-myo9aa + MO1-myo9ab + MO4-tp53 standard conditions Fig. SVideo10 from O'Connor et al., 2016
motor neuron axon shortened, abnormal slc24a5b1/+ + MO1-myo9aa + MO1-myo9ab + MO4-tp53 standard conditions Fig. 5 with image from O'Connor et al., 2016
motor neuron axon increased branchiness, abnormal slc24a5b1/+ + MO1-myo9aa + MO1-myo9ab + MO4-tp53 standard conditions Fig. 5 with image from O'Connor et al., 2016
post-vent region curved, abnormal slc24a5b1/+ + MO1-myo9aa + MO1-myo9ab + MO4-tp53 standard conditions Fig. 4 with image from O'Connor et al., 2016
heart edematous, abnormal slc24a5b1/+ + MO1-myo9aa + MO1-myo9ab + MO4-tp53 standard conditions Fig. 4 with image from O'Connor et al., 2016
swimming behavior process quality, abnormal slc24a5b1/+ + MO1-myo9aa + MO1-myo9ab + MO4-tp53 standard conditions Fig. SVideo10 from O'Connor et al., 2016
thigmotaxis disrupted, abnormal slc24a5b1/+ + MO1-slc25a1b + MO2-slc25a1a + MO4-tp53 standard conditions Fig. S6 from Chaouch et al., 2014
heart edematous, abnormal slc24a5b1/+ + MO1-slc25a1b + MO2-slc25a1a + MO4-tp53 standard conditions Fig. S7 from Chaouch et al., 2014
post-vent region decreased length, abnormal slc24a5b1/+ + MO1-slc25a1b + MO2-slc25a1a + MO4-tp53 standard conditions Fig. S7 from Chaouch et al., 2014
motor neuron axon decreased length, abnormal slc24a5b1/+ + MO1-slc25a1b + MO2-slc25a1a + MO4-tp53 standard conditions Fig. S8 from Chaouch et al., 2014
muscle neuromuscular junction morphology, abnormal slc24a5b1/+ + MO1-slc25a1b + MO2-slc25a1a + MO4-tp53 standard conditions Fig. S8 from Chaouch et al., 2014
yolk syncytial layer edematous, abnormal slc24a5b1/+ + MO1-slc25a1b + MO2-slc25a1a + MO4-tp53 standard conditions Fig. S7 from Chaouch et al., 2014
whole organism decreased life span, abnormal slc24a5b1/+ + MO1-slc25a1b + MO2-slc25a1a + MO4-tp53 standard conditions Fig. S6 from Chaouch et al., 2014
hindbrain edematous, abnormal slc24a5b1/+ + MO1-slc25a1b + MO2-slc25a1a + MO4-tp53 standard conditions Fig. S7 from Chaouch et al., 2014
motor neuron axon arborization process quality, abnormal slc24a5b1/+ + MO1-slc25a1b + MO2-slc25a1a + MO4-tp53 standard conditions Fig. S8 from Chaouch et al., 2014
presynapse assembly disrupted, abnormal slc24a5b1/+ + MO1-slc25a1b + MO2-slc25a1a + MO4-tp53 standard conditions Fig. S8 from Chaouch et al., 2014
post-vent region curved, abnormal slc24a5b1/+ + MO1-slc25a1b + MO2-slc25a1a + MO4-tp53 standard conditions Fig. S7 from Chaouch et al., 2014
rhombomere 2 egr2b expression mislocalised, abnormal WT + MO1-cyp26b1 + MO1-cyp26c1 + MO1-epha4a + MO4-tp53 standard conditions Fig. 6 with image from Addison et al., 2018
rhombomere 6 egr2b expression mislocalised, abnormal WT + MO1-cyp26b1 + MO1-cyp26c1 + MO1-epha4a + MO4-tp53 standard conditions Fig. 6 with image from Addison et al., 2018
rhombomere 4 egr2b expression mislocalised, abnormal WT + MO1-cyp26b1 + MO1-cyp26c1 + MO1-epha4a + MO4-tp53 standard conditions Fig. 6 with image from Addison et al., 2018
dorsal telencephalon morphology, abnormal WT + MO1-emx1 + MO1-emx2 + MO2-emx1 + MO2-emx2 + MO2-emx3 + MO3-emx3 + MO4-tp53 standard conditions Fig. 3 with image from Viktorin et al., 2009
somite morphology, ameliorated WT + MO1-mir125b-1 + MO1-mir125b-2 + MO1-mir125b-3 + MO2-mir125b-1 + MO4-tp53 standard conditions Fig. S6 from Le et al., 2011
brain cell death occurrence, ameliorated WT + MO1-mir125b-1 + MO1-mir125b-2 + MO1-mir125b-3 + MO2-mir125b-1 + MO4-tp53 standard conditions Fig. S6 from Le et al., 2011
eye size, ameliorated WT + MO1-mir125b-1 + MO1-mir125b-2 + MO1-mir125b-3 + MO2-mir125b-1 + MO4-tp53 standard conditions Fig. S6 from Le et al., 2011
midbrain hindbrain boundary present, ameliorated WT + MO1-mir125b-1 + MO1-mir125b-2 + MO1-mir125b-3 + MO2-mir125b-1 + MO4-tp53 standard conditions Fig. S6 from Le et al., 2011
swim bladder inflation decreased process quality, abnormal WT + MO1-nkx2-1 + MO1-nkx2.4a + MO1-nkx2.4b + MO4-tp53 standard conditions Fig. 3 from Manoli et al., 2014
preoptic area morphology, abnormal WT + MO1-nkx2-1 + MO1-nkx2.4a + MO1-nkx2.4b + MO4-tp53 standard conditions Fig. 3 from Manoli et al., 2014
hypothalamus apoptotic process increased process quality, abnormal WT + MO1-nkx2-1 + MO1-nkx2.4a + MO1-nkx2.4b + MO4-tp53 standard conditions Fig. 3 from Manoli et al., 2014
hypothalamus absent, abnormal WT + MO1-nkx2-1 + MO1-nkx2.4a + MO1-nkx2.4b + MO4-tp53 standard conditions Fig. 3 from Manoli et al., 2014
forebrain ventral region absent, abnormal WT + MO1-nkx2-1 + MO1-nkx2.4a + MO1-nkx2.4b + MO4-tp53 standard conditions Fig. 3 from Manoli et al., 2014
heart edematous, abnormal WT + MO1-stmn2a + MO1-stmn2b + MO2-kifbp + MO4-tp53 standard conditions Fig. 4 from Alves et al., 2010
head decreased size, abnormal WT + MO1-stmn2a + MO1-stmn2b + MO2-kifbp + MO4-tp53 standard conditions Fig. 4 from Alves et al., 2010
eye decreased size, abnormal WT + MO1-stmn2a + MO1-stmn2b + MO2-kifbp + MO4-tp53 standard conditions Fig. 4 from Alves et al., 2010
post-vent region malformed, abnormal WT + MO1-stmn2a + MO1-stmn2b + MO2-kifbp + MO4-tp53 standard conditions Fig. 4 from Alves et al., 2010
primordial germ cell cell motility decreased speed, abnormal WT + MO1-anxa5b + MO1-dnd1 + MO1-zeb1b + MO3-mylka + MO4-mylka + MO4-tp53 + MO5-mylka standard conditions Fig. 4 with image from Goudarzi et al., 2012
lens malformed, abnormal WT + MO1-sox11b + MO2-sox11a + MO2-sox4a + MO3-sox4b + MO4-tp53 standard conditions Fig. 9 with image from Wen et al., 2015
optic fissure closure incomplete, abnormal WT + MO1-sox11b + MO2-sox11a + MO2-sox4a + MO3-sox4b + MO4-tp53 standard conditions Fig. 9 with image from Wen et al., 2015
closure of optic fissure decreased process quality, abnormal WT + MO1-sox11b + MO2-sox11a + MO2-sox4a + MO3-sox4b + MO4-tp53 standard conditions Fig. 9 with image from Wen et al., 2015
central nervous system neuron apoptotic, abnormal WT + MO1-pcdh1a + MO4-tp53 standard conditions Fig. 7 with image from Emond et al., 2008
apoptotic process increased rate, abnormal WT + MO1-pcdh1a + MO4-tp53 standard conditions Fig. 7 with image from Emond et al., 2008
central nervous system neuron apoptotic, abnormal WT + MO2-pcdh1a + MO4-tp53 standard conditions Fig. 7 with image from Emond et al., 2008
apoptotic process increased rate, abnormal WT + MO2-pcdh1a + MO4-tp53 standard conditions Fig. 7 with image from Emond et al., 2008
neutrophil GFP expression spatial pattern, abnormal e114Tg + MO1-gnb1a + MO2-gnb1b + MO4-tp53 amputation: caudal fin Fig. 7 with image from Ke et al., 2017
neutrophil GFP expression spatial pattern, abnormal e116Tg + MO1-gnb1a + MO2-gnb1b + MO4-tp53 amputation: caudal fin Fig. 8 with image from Ke et al., 2017
intestine distal region lacks all parts of type enteric neuron, abnormal em2Tg + MO1-dennd3a + MO1-dennd3b + MO4-tp53 standard conditions Fig. 1 with image from Gui et al., 2017
cardiac ventricle has extra parts of type cardiac muscle cell, abnormal f2Tg + MO1-tcf7l1a + MO1-tcf7l1b + MO4-tp53 standard conditions Fig. 1 with image from Sorrell et al., 2013
heart increased size, abnormal f2Tg + MO1-tcf7l1a + MO1-tcf7l1b + MO4-tp53 standard conditions Fig. 1 with image from Sorrell et al., 2013
heart linear, abnormal f2Tg + MO1-tcf7l1a + MO1-tcf7l1b + MO4-tp53 standard conditions Fig. 1 with image from Sorrell et al., 2013
atrium has extra parts of type cardiac muscle cell, abnormal f2Tg + MO1-tcf7l1a + MO1-tcf7l1b + MO4-tp53 standard conditions Fig. 1 with image from Sorrell et al., 2013
heart has extra parts of type cardiac muscle cell, abnormal f2Tg + MO1-tcf7l1a + MO1-tcf7l1b + MO4-tp53 standard conditions Fig. 1 with image from Sorrell et al., 2013
cardiac ventricle has fewer parts of type cardiac muscle cell, abnormal f2Tg + MO2-rarab + MO4-cyp26a1 + MO4-tp53 + MO5-cyp26a1 standard conditions Fig. 5 with image from D'Aniello et al., 2013
heart has fewer parts of type cardiac muscle cell, abnormal f2Tg + MO2-rarab + MO4-cyp26a1 + MO4-tp53 + MO5-cyp26a1 standard conditions Fig. 5 with image from D'Aniello et al., 2013
presumptive bulbus arteriosus ripply3 expression increased amount, abnormal fb7Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO4-tp53 + MO5-cyp26a1 standard conditions Fig 7 with image from Song et al., 2019
endoderm increased width, abnormal ha01Tg + MO1-fn1a + MO1-lamb1a + MO4-tp53 standard conditions Fig. 6 with imageFig. S6 with image from Hu et al., 2018
endoderm increased width, abnormal ha01Tg + MO1-fn1a + MO4-tp53 + MO5-lama1 standard conditions Fig. S6 with image from Hu et al., 2018
endoderm convergent extension involved in gastrulation process quality, abnormal ha01Tg + MO2-mmp14b + MO4-mmp14a + MO4-tp53 standard conditions Fig. 7 with image from Hu et al., 2018
endoderm convergent extension involved in gastrulation decreased efficacy, abnormal ha01Tg + MO2-mmp14b + MO4-mmp14a + MO4-tp53 standard conditions Fig. 7 with image from Hu et al., 2018
endoderm cell migration involved in gastrulation process quality, abnormal ha01Tg + MO2-mmp14b + MO4-mmp14a + MO4-tp53 standard conditions Fig. 7 with image from Hu et al., 2018
endoderm increased width, abnormal ha01Tg + MO2-mmp14b + MO4-mmp14a + MO4-tp53 standard conditions Fig. S7 with imageFig. S8 with image from Hu et al., 2018
endoderm cell migration involved in gastrulation decreased efficacy, abnormal ha01Tg + MO2-mmp14b + MO4-mmp14a + MO4-tp53 standard conditions Fig. 7 with image from Hu et al., 2018
anatomical line ab2-fn labeling increased amount, abnormal ha01Tg + MO2-mmp14b + MO4-mmp14a + MO4-tp53 standard conditions Fig. S7 with image from Hu et al., 2018
neutrophil chemotaxis decreased occurrence, abnormal i114Tg + MO1-gnb1a + MO2-gnb1b + MO4-tp53 amputation: caudal fin Fig. 3 with image from Ke et al., 2017
neutrophil activation decreased occurrence, abnormal i114Tg + MO1-gnb1a + MO2-gnb1b + MO4-tp53 control Fig. 5 with image from Ke et al., 2017
neutrophil migration decreased occurrence, abnormal i114Tg + MO1-gnb1a + MO2-gnb1b + MO4-tp53 amputation: caudal fin Fig. 3 with image from Ke et al., 2017
neutrophil migration decreased process quality, abnormal i114Tg + MO1-gnb1a + MO2-gnb1b + MO4-tp53 amputation: caudal fin Fig. 3 with image from Ke et al., 2017
neutrophil migration process quality, abnormal i114Tg + MO1-gnb1a + MO2-gnb1b + MO4-tp53 control Fig. 5 with image from Ke et al., 2017
neutrophil migration decreased process quality, abnormal i114Tg + MO1-gnb1a + MO2-gnb1b + MO4-tp53 control Fig. 5 with image from Ke et al., 2017
neutrophil chemotaxis decreased occurrence, abnormal i114Tg + MO1-gnb1a + MO2-gnb1b + MO4-tp53 control Fig. 5 with image from Ke et al., 2017
neutrophil ab1-gnb labeling decreased amount, abnormal i114Tg + MO1-gnb1a + MO2-gnb1b + MO4-tp53 control Fig. 2 with image from Ke et al., 2017
neutrophil chemotaxis decreased process quality, abnormal i114Tg + MO1-gnb1a + MO2-gnb1b + MO4-tp53 amputation: caudal fin Fig. 3 with image from Ke et al., 2017
neutrophil activation decreased process quality, abnormal i114Tg + MO1-gnb1a + MO2-gnb1b + MO4-tp53 control Fig. 5 with image from Ke et al., 2017
neutrophil migration process quality, abnormal i114Tg + MO1-gnb1a + MO2-gnb1b + MO4-tp53 amputation: caudal fin Fig. 3 with image from Ke et al., 2017
neutrophil ab1-gnb1a labeling decreased amount, abnormal i114Tg + MO1-gnb1a + MO2-gnb1b + MO4-tp53 control Fig. 2 with image from Ke et al., 2017
neutrophil morphology, abnormal i114Tg + MO1-gnb1a + MO2-gnb1b + MO4-tp53 control Fig. 5 with image from Ke et al., 2017
neutrophil chemotaxis decreased process quality, abnormal i114Tg + MO1-gnb1a + MO2-gnb1b + MO4-tp53 control Fig. 5 with image from Ke et al., 2017
neutrophil ab1-gnb labeling decreased amount, abnormal i114Tg + MO1-gnb4a + MO1-gnb4b + MO4-tp53 control Fig. 2 with image from Ke et al., 2017
neutrophil chemotaxis decreased occurrence, abnormal i114Tg + MO2-gnb1a + MO3-gnb1b + MO4-tp53 amputation: caudal fin Fig. 3 with image from Ke et al., 2017
neutrophil migration decreased occurrence, abnormal i114Tg + MO2-gnb1a + MO3-gnb1b + MO4-tp53 amputation: caudal fin Fig. 3 with image from Ke et al., 2017
neutrophil migration decreased process quality, abnormal i114Tg + MO2-gnb1a + MO3-gnb1b + MO4-tp53 amputation: caudal fin Fig. 3 with image from Ke et al., 2017
neutrophil chemotaxis decreased process quality, abnormal i114Tg + MO2-gnb1a + MO3-gnb1b + MO4-tp53 amputation: caudal fin Fig. 3 with image from Ke et al., 2017
fast muscle cell decreased amount, abnormal i135Tg + MO1-six1a + MO4-six1b + MO4-tp53 standard conditions Fig. 2 with image from Nord et al., 2013
fast muscle cell muscle cell development decreased process quality, abnormal i135Tg + MO1-six1a + MO4-six1b + MO4-tp53 standard conditions Fig. 2 with image from Nord et al., 2013
cell population proliferation increased occurrence, abnormal io3Tg + MO4-tp53 heat shock Fig. 8 from Santoriello et al., 2009
pronephric duct cystic, abnormal li1Tg + MO1-glis2b + MO1-trim32 + MO4-tp53 standard conditions Fig. 3 from Ramachandran et al., 2014
heart tube centered, abnormal li1Tg + MO1-nphp1 + MO3-nphp4 + MO4-tp53 standard conditions Fig. 6 from Slanchev et al., 2011
pericardium edematous, abnormal li1Tg + MO1-nphp1 + MO3-nphp4 + MO4-tp53 standard conditions Fig. 6 from Slanchev et al., 2011
pronephros cystic, abnormal li1Tg + MO1-nphp1 + MO3-nphp4 + MO4-tp53 standard conditions Fig. 6 from Slanchev et al., 2011
whole organism curved ventral, abnormal li1Tg + MO1-nphp1 + MO3-nphp4 + MO4-tp53 standard conditions Fig. 6 from Slanchev et al., 2011
pronephric duct dilated, abnormal li1Tg + MO1-nphp1 + MO3-nphp4 + MO4-tp53 standard conditions Fig. 6 from Slanchev et al., 2011
pronephric duct cilium disoriented, abnormal li1Tg + MO1-nphp1 + MO3-nphp4 + MO4-tp53 standard conditions Fig. 6 from Slanchev et al., 2011
heart tube left side of axis, abnormal li1Tg + MO1-nphp1 + MO3-nphp4 + MO4-tp53 standard conditions Fig. 6 from Slanchev et al., 2011
pronephros cystic, exacerbated li1Tg + MO1-nphp1 + MO3-stk11 + MO4-tp53 standard conditions Fig. 2 with image from Viau et al., 2018
heart looping decreased process quality, abnormal li1Tg + MO1-nphp4 + MO1-tmem218 + MO4-tp53 (AB/TL) control Fig. 5 from Epting et al., 2022
pronephros cystic, abnormal li1Tg + MO1-nphp4 + MO1-tmem218 + MO4-tp53 (AB/TL) control Fig. 5 from Epting et al., 2022
pronephric glomerulus swollen, abnormal li1Tg + MO1-nphp4 + MO1-tmem218 + MO4-tp53 (AB/TL) control Fig. 5 from Epting et al., 2022
heart structure, abnormal li1Tg + MO1-nphp4 + MO1-tmem218 + MO4-tp53 (AB/TL) control Fig. 5 from Epting et al., 2022
heart looping decreased process quality, abnormal li1Tg + MO1-nphp4 + MO2-tmem218 + MO4-tp53 (AB/TL) control Fig. 5 from Epting et al., 2022
pronephros cystic, abnormal li1Tg + MO1-nphp4 + MO2-tmem218 + MO4-tp53 (AB/TL) control Fig. 5 from Epting et al., 2022
pronephric glomerulus swollen, abnormal li1Tg + MO1-nphp4 + MO2-tmem218 + MO4-tp53 (AB/TL) control Fig. 5 from Epting et al., 2022
heart structure, abnormal li1Tg + MO1-nphp4 + MO2-tmem218 + MO4-tp53 (AB/TL) control Fig. 5 from Epting et al., 2022
glomerular filtration disrupted, abnormal mi1000Tg + MO1-arhgdia + MO4-tp53 standard conditions Fig. 5 from Gee et al., 2013
glomerular filtration disrupted, abnormal mi1000Tg + MO1-kank2 + MO4-tp53 standard conditions Fig. 4 from Gee et al., 2015
podocyte non-functional, abnormal mi1000Tg + MO1-kank2 + MO4-tp53 standard conditions Fig. 4 from Gee et al., 2015
glomerular filtration disrupted, abnormal mi1000Tg + MO2-kank2 + MO4-tp53 standard conditions Fig. 4 from Gee et al., 2015
podocyte non-functional, abnormal mi1000Tg + MO2-kank2 + MO4-tp53 standard conditions Fig. 4 from Gee et al., 2015
glomerular filtration disrupted, abnormal mi1000Tg + MO3-coq8b + MO4-tp53 standard conditions Fig. 2 from Ashraf et al., 2013
CaP motoneuron axon decreased length, abnormal ml2Tg + MO1-gmppaa + MO1-gmppab + MO4-tp53 standard conditions Fig. 7 from Zheng et al., 2021
CaP motoneuron axon decreased length, abnormal ml2Tg + MO1-gmppaa + MO1-gmppab + MO4-tp53 chemical treatment by injection: GDP-mannose Fig. 7 from Zheng et al., 2021
central nervous system neuron differentiation process quality, abnormal nl1Tg + MO1-gdpd3a + MO1-sez6l2 + MO4-tp53 standard conditions Table S2 from McCammon et al., 2017
central nervous system neuron differentiation process quality, abnormal nl1Tg + MO1-hirip3 + MO1-kif22 + MO4-tp53 standard conditions Table S2 from McCammon et al., 2017
central nervous system neuron differentiation process quality, abnormal nl1Tg + MO1-hirip3 + MO1-tlcd3ba + MO4-tp53 standard conditions Table S2 from McCammon et al., 2017
central nervous system neuron differentiation process quality, abnormal nl1Tg + MO1-ino80e + MO1-kif22 + MO4-tp53 standard conditions Table S2 from McCammon et al., 2017
central nervous system neuron differentiation process quality, abnormal nl1Tg + MO1-kif22 + MO1-taok2b + MO4-tp53 standard conditions Table S2 from McCammon et al., 2017
central nervous system neuron differentiation process quality, abnormal nl1Tg + MO1-sez6l2 + MO1-taok2b + MO4-tp53 standard conditions Table S2 from McCammon et al., 2017
pericardium edematous, abnormal pku5Et + MO1-rap1aa + MO2-rap1b + MO4-tp53 standard conditions Fig. 1 with image from Dong et al., 2012
heart malformed, abnormal pku5Et + MO1-rap1aa + MO2-rap1b + MO4-tp53 standard conditions Fig. 1 with image from Dong et al., 2012
heart development disrupted, abnormal pku5Et + MO1-rap1aa + MO2-rap1b + MO4-tp53 standard conditions Fig. 1 with imageFig. 2 with image from Dong et al., 2012
heart looping disrupted, abnormal pku5Et + MO1-rap1aa + MO2-rap1b + MO4-tp53 standard conditions Fig. 1 with image from Dong et al., 2012
cranial nerve development process quality, abnormal rw0Tg + MO1-asphd1 + MO1-hirip3 + MO4-tp53 standard conditions Table S2 from McCammon et al., 2017
midbrain morphology, abnormal rw0Tg + MO1-exosc8 + MO1-mbpa + MO4-tp53 standard conditions Fig. 8 with image from Boczonadi et al., 2014
hindbrain morphology, abnormal rw0Tg + MO1-exosc8 + MO1-mbpa + MO4-tp53 standard conditions Fig. 8 with image from Boczonadi et al., 2014
brain development disrupted, abnormal rw0Tg + MO1-exosc8 + MO1-mbpa + MO4-tp53 standard conditions Fig. 8 with image from Boczonadi et al., 2014
cranial nerve V decreased size, abnormal rw0Tg + MO1-hirip3 + MO1-tlcd3ba + MO4-tp53 standard conditions Fig. S3 with image from McCammon et al., 2017
cranial nerve development process quality, abnormal rw0Tg + MO1-hirip3 + MO1-tlcd3ba + MO4-tp53 standard conditions Fig. S3 with imageTable S2 from McCammon et al., 2017
cranial nerve VII shape, abnormal rw0Tg + MO1-hirip3 + MO1-tlcd3ba + MO4-tp53 standard conditions Fig. S3 with image from McCammon et al., 2017
cranial nerve development process quality, abnormal rw0Tg + MO1-kif22 + MO1-taok2b + MO4-tp53 standard conditions Table S2 from McCammon et al., 2017
cranial nerve development process quality, abnormal rw0Tg + MO2-kctd13 + MO4-tp53 + MO5-ppp4ca standard conditions Table S2 from McCammon et al., 2017
motor nucleus of vagal nerve anatomical region decreased size, abnormal rw0Tg + MO2-zic2b + MO3-zic2a + MO4-tp53 standard conditions Fig. 10 with image from Drummond et al., 2013
optic tectum neuron decreased amount, abnormal rw0130aTg + MO1-kdm7aa + MO1-kdm7ab + MO4-tp53 standard conditions Fig. S7 from Tsukada et al., 2010
post-vent region increased curvature, abnormal rw0130aTg + MO1-kdm7aa + MO1-kdm7ab + MO4-tp53 standard conditions Fig. S7 from Tsukada et al., 2010
optic tectum decreased size, abnormal rw0130aTg + MO1-kdm7aa + MO1-kdm7ab + MO4-tp53 standard conditions Fig. S7 from Tsukada et al., 2010
post-vent region increased curvature, abnormal rw0130aTg + MO2-kdm7aa + MO2-kdm7ab + MO4-tp53 standard conditions Fig. S7 from Tsukada et al., 2010
optic tectum decreased size, abnormal rw0130aTg + MO2-kdm7aa + MO2-kdm7ab + MO4-tp53 standard conditions Fig. S7 from Tsukada et al., 2010
optic tectum neuron decreased amount, abnormal rw0130aTg + MO2-kdm7aa + MO2-kdm7ab + MO4-tp53 standard conditions Fig. S7 from Tsukada et al., 2010
cranial vasculature anterior region absent, abnormal s843Tg + MO1-tcf7l1a + MO1-tcf7l1b + MO4-tp53 standard conditions Fig. 9 with image from Sorrell et al., 2013
retinoic acid receptor signaling pathway decreased process quality, abnormal sk71Tg + MO2-zic2b + MO3-zic2a + MO4-tp53 standard conditions Fig. 8 with image from Drummond et al., 2013
endothelial cell apoptotic process increased occurrence, ameliorated ubs1Tg + MO1-pdcd2l + MO1-tnnt2a + MO4-tp53 control Fig. 6 from Serbanovic-Canic et al., 2017
endothelial cell apoptotic process increased occurrence, ameliorated ubs1Tg + MO1-tnnt2a + MO2-perp + MO4-tp53 control Fig. 6 from Serbanovic-Canic et al., 2017
urine protein increased amount, abnormal umc407Tg + MO1-lrp2a + MO4-tp53 standard conditions Fig. 2 with imageFig. 3 with image from Naylor et al., 2022
pronephric duct proximal region decreased functionality, abnormal umc407Tg + MO1-lrp2a + MO4-tp53 standard conditions Fig. 2 with imageFig. 3 with image from Naylor et al., 2022
urine protein increased amount, abnormal umc407Tg + MO1-ocrl + MO4-tp53 standard conditions Fig. 2 with image from Naylor et al., 2022
pronephric duct proximal region decreased functionality, abnormal umc407Tg + MO1-ocrl + MO4-tp53 standard conditions Fig. 2 with image from Naylor et al., 2022
smoothened signaling pathway increased process quality, abnormal umz24Tg + MO2-sox4a + MO3-sox4b + MO4-tp53 standard conditions Fig. 5 with image from Wen et al., 2015
whole organism decreased length, abnormal w143Tg + MO4-tp53 heat shock Fig. 3 from Bouldin et al., 2014
muscle decreased mass, abnormal w143Tg + MO4-tp53 heat shock Fig. 3 from Bouldin et al., 2014
axis bent, abnormal w143Tg + MO4-tp53 heat shock Fig. 3 from Bouldin et al., 2014
head decreased size, abnormal w143Tg + MO4-tp53 heat shock Fig. 3 from Bouldin et al., 2014
whole organism has fewer parts of type somite, abnormal w143Tg + MO4-tp53 heat shock Fig. 3 from Bouldin et al., 2014
somite decreased width, abnormal w143Tg + MO4-tp53 heat shock Fig. 3 from Bouldin et al., 2014
somite slow muscle cell undulate, abnormal w143Tg + MO4-tp53 heat shock Fig. 3 from Bouldin et al., 2014
somite fast muscle cell morphology, abnormal w143Tg + MO4-tp53 heat shock Fig. 3 from Bouldin et al., 2014
myotome decreased size, abnormal w143Tg + MO4-tp53 heat shock Fig. 3 from Bouldin et al., 2014
tail bud mitotic cell cycle increased occurrence, abnormal w143Tg + MO4-tp53 heat shock Fig. 3 from Bouldin et al., 2014
somite slow muscle cell morphology, abnormal w143Tg + MO4-tp53 heat shock Fig. 3 from Bouldin et al., 2014
lymph vessel development occurrence, ameliorated y1Tg + MO1-foxo1a + MO3-dre-mir-182 + MO4-tp53 control Fig. 7 from Kiesow et al., 2015
vascular lymphangioblast absent, ameliorated y1Tg + MO1-foxo1a + MO3-dre-mir-182 + MO4-tp53 control Fig. 7 from Kiesow et al., 2015
lymph vessel development occurrence, ameliorated y1Tg + MO1-foxo1b + MO3-dre-mir-182 + MO4-tp53 control Fig. 7 from Kiesow et al., 2015
vascular lymphangioblast absent, ameliorated y1Tg + MO1-foxo1b + MO3-dre-mir-182 + MO4-tp53 control Fig. 7 from Kiesow et al., 2015
dorsal longitudinal anastomotic vessel incomplete structure, abnormal y1Tg + MO1-iqsec1a + MO2-iqsec1b + MO4-tp53 standard conditions Fig. 6 from Manavski et al., 2014
post-vent vasculature edematous, abnormal y1Tg + MO1-iqsec1a + MO2-iqsec1b + MO4-tp53 standard conditions Fig. S5 from Manavski et al., 2014
common cardinal vein malformed, abnormal y1Tg + MO1-iqsec1a + MO2-iqsec1b + MO4-tp53 standard conditions Fig. 6 from Manavski et al., 2014
vascular lymphangioblast absent, abnormal y1Tg + MO1-iqsec1a + MO2-iqsec1b + MO4-tp53 standard conditions Fig. 6 from Manavski et al., 2014
dorsal longitudinal anastomotic vessel malformed, abnormal y1Tg + MO1-iqsec1a + MO2-iqsec1b + MO4-tp53 standard conditions Fig. 6 from Manavski et al., 2014
vasculature development disrupted, abnormal y1Tg + MO1-iqsec1a + MO2-iqsec1b + MO4-tp53 standard conditions Fig. 6 from Manavski et al., 2014
angiogenesis disrupted, abnormal y1Tg + MO1-iqsec1a + MO2-iqsec1b + MO4-tp53 standard conditions Fig. 6 from Manavski et al., 2014
parachordal vessel aplastic, abnormal y1Tg + MO1-iqsec1a + MO2-iqsec1b + MO4-tp53 standard conditions Fig. 6 from Manavski et al., 2014
brain hydrocephalic, abnormal y1Tg + MO1-iqsec1a + MO2-iqsec1b + MO4-tp53 standard conditions Fig. S5 from Manavski et al., 2014
vascular lymphangioblast decreased amount, abnormal y1Tg + MO1-iqsec1a + MO2-iqsec1b + MO4-tp53 standard conditions Fig. 6 from Manavski et al., 2014
intersegmental vessel malformed, abnormal y1Tg + MO1-iqsec1a + MO2-iqsec1b + MO4-tp53 standard conditions Fig. 6 from Manavski et al., 2014
intersegmental vessel malformed, abnormal y1Tg + MO1-npas4b + MO2-npas4a + MO4-tp53 standard conditions Fig. S4 from Esser et al., 2017
sprouting angiogenesis disrupted, abnormal y1Tg + MO1-npas4b + MO2-npas4a + MO4-tp53 standard conditions Fig. S4 from Esser et al., 2017
intersegmental vessel absent, abnormal y1Tg + MO1-stab2 + MO3-has2 + MO4-stab2 + MO4-tp53 standard conditions Fig. 6 with image from Rost et al., 2014
intersegmental vessel decreased size, abnormal y1Tg + MO1-stab2 + MO3-has2 + MO4-stab2 + MO4-tp53 standard conditions Fig. 6 with image from Rost et al., 2014
dorsal longitudinal anastomotic vessel incomplete structure, abnormal y1Tg + MO2-iqsec1a + MO2-iqsec1b + MO4-tp53 standard conditions Fig. 6 from Manavski et al., 2014
common cardinal vein malformed, abnormal y1Tg + MO2-iqsec1a + MO2-iqsec1b + MO4-tp53 standard conditions Fig. 6 from Manavski et al., 2014
vascular lymphangioblast absent, abnormal y1Tg + MO2-iqsec1a + MO2-iqsec1b + MO4-tp53 standard conditions Fig. 6 from Manavski et al., 2014
dorsal longitudinal anastomotic vessel malformed, abnormal y1Tg + MO2-iqsec1a + MO2-iqsec1b + MO4-tp53 standard conditions Fig. 6 from Manavski et al., 2014
vasculature development disrupted, abnormal y1Tg + MO2-iqsec1a + MO2-iqsec1b + MO4-tp53 standard conditions Fig. 6 from Manavski et al., 2014
angiogenesis disrupted, abnormal y1Tg + MO2-iqsec1a + MO2-iqsec1b + MO4-tp53 standard conditions Fig. 6 from Manavski et al., 2014
parachordal vessel aplastic, abnormal y1Tg + MO2-iqsec1a + MO2-iqsec1b + MO4-tp53 standard conditions Fig. 6 from Manavski et al., 2014
brain hydrocephalic, abnormal y1Tg + MO2-iqsec1a + MO2-iqsec1b + MO4-tp53 standard conditions Fig. 6 from Manavski et al., 2014
vascular lymphangioblast decreased amount, abnormal y1Tg + MO2-iqsec1a + MO2-iqsec1b + MO4-tp53 standard conditions Fig. 6 from Manavski et al., 2014
intersegmental vessel malformed, abnormal y1Tg + MO2-iqsec1a + MO2-iqsec1b + MO4-tp53 standard conditions Fig. 6 from Manavski et al., 2014
lymph vessel development arrested, abnormal y1Tg + MO2-junba + MO3-junbb + MO4-tp53 control Fig. 6 with image from Kiesow et al., 2015
thoracic duct absent, abnormal y1Tg + MO2-junba + MO3-junbb + MO4-tp53 control Fig. 6 with image from Kiesow et al., 2015
lymph vessel development delayed, abnormal y1Tg + MO2-junba + MO3-junbb + MO4-tp53 control Fig. 2 with image from Kiesow et al., 2015
vascular lymphangioblast absent, abnormal y1Tg + MO2-junba + MO3-junbb + MO4-tp53 control Fig. 2 with imageFig. 5 with image from Kiesow et al., 2015
vein increased amount, abnormal y1Tg + MO2-junba + MO3-junbb + MO4-tp53 control Fig. 2 with image from Kiesow et al., 2015
pharyngeal arch apoptotic process increased process quality, abnormal y1Tg + MO2-mir92a + MO4-tp53 standard conditions Fig. 3 with image from Ning et al., 2013
lymph vessel development delayed, abnormal y1Tg + MO3-junba + MO4-junbb + MO4-tp53 control Fig. 2 with image from Kiesow et al., 2015
vascular lymphangioblast absent, abnormal y1Tg + MO3-junba + MO4-junbb + MO4-tp53 control Fig. 2 with imageFig. 5 with image from Kiesow et al., 2015
intersegmental vessel immature, abnormal y1Tg + MO3-mir1-1,mir1-2 + MO4-tp53 standard conditions Fig. S5 from Lin et al., 2013
parachordal vessel immature, abnormal y1Tg + MO3-mir1-1,mir1-2 + MO4-tp53 standard conditions Fig. S5 from Lin et al., 2013
dorsal longitudinal anastomotic vessel immature, abnormal y1Tg + MO3-mir1-1,mir1-2 + MO4-tp53 standard conditions Fig. S5 from Lin et al., 2013
intersegmental vessel decreased length, abnormal y1Tg + MO3-mir1-1,mir1-2 + MO4-tp53 standard conditions Fig. S5 from Lin et al., 2013
cranial nerve VIII axon guidance process quality, abnormal zc7Tg + MO1-slit1a + MO1-slit1b + MO4-tp53 control Fig. 8 from Zecca et al., 2015
cranial nerve VIII axon mislocalised, abnormal zc7Tg + MO1-slit1a + MO1-slit1b + MO4-tp53 control Fig. 8 from Zecca et al., 2015
cranial nerve VIII defasciculated, abnormal zc7Tg + MO1-slit1a + MO1-slit1b + MO4-tp53 control Fig. 8 from Zecca et al., 2015
whole organism curved ventral, abnormal zf106Tg + MO1-gnb4a + MO1-gnb4b + MO4-tp53 standard conditions Fig. 2 with image from Xu et al., 2014
posterior lateral line neuromast deposition decreased process quality, abnormal zf106Tg + MO2-gnb1a + MO2-gnb1b + MO4-tp53 standard conditions Fig. 2 with image from Xu et al., 2014
posterior lateral line primordium filopodium decreased length, abnormal zf106Tg + MO2-gnb1a + MO2-gnb1b + MO4-tp53 standard conditions Fig. 5 with image from Xu et al., 2014
posterior lateral line neuromast primordium migration process quality, abnormal zf106Tg + MO2-gnb1a + MO2-gnb1b + MO4-tp53 standard conditions Fig. 2 with imageFig. 3 with imageFig. 7 with image from Xu et al., 2014
posterior lateral line neuromast primordium migration disrupted, abnormal zf106Tg + MO2-gnb1a + MO2-gnb1b + MO4-tp53 standard conditions Fig. 2 with imageFig. 3 with imageFig. 7 with image from Xu et al., 2014
neuromast decreased amount, abnormal zf106Tg + MO2-gnb1a + MO2-gnb1b + MO4-tp53 standard conditions Fig. 2 with image from Xu et al., 2014
posterior lateral line primordium has fewer parts of type cell cell projection, abnormal zf106Tg + MO2-gnb1a + MO2-gnb1b + MO4-tp53 standard conditions Fig. 5 with image from Xu et al., 2014
cloaca development disrupted, abnormal zf106Tg + MO2-pard6gb + MO3-nphp4 + MO4-tp53 standard conditions Fig. 8 from Slanchev et al., 2011
distal tubule morphogenesis disrupted, abnormal zf106Tg + MO2-pard6gb + MO3-nphp4 + MO4-tp53 standard conditions Fig. 8 from Slanchev et al., 2011
proctodeum anatomical region unfused from cloacal chamber, abnormal zf106Tg + MO2-pard6gb + MO3-nphp4 + MO4-tp53 standard conditions Fig. 8 from Slanchev et al., 2011
pronephric distal late tubule cell migration disrupted, abnormal zf106Tg + MO2-pard6gb + MO3-nphp4 + MO4-tp53 standard conditions Fig. 8 from Slanchev et al., 2011
pronephric duct decreased length, abnormal zf106Tg + MO2-pard6gb + MO3-nphp4 + MO4-tp53 standard conditions Fig. 8 from Slanchev et al., 2011
cloacal chamber distended, abnormal zf106Tg + MO2-pard6gb + MO3-nphp4 + MO4-tp53 standard conditions Fig. 8 from Slanchev et al., 2011
cellular senescence increased process quality, abnormal zf155Tg + MO1-spns1 + MO4-tp53 standard conditions Fig. 4 with image from Sasaki et al., 2014
cell autolysosome accumulation cell perinuclear region of cytoplasm, abnormal zf155Tg + MO1-spns1 + MO4-tp53 standard conditions Fig. 4 with image from Sasaki et al., 2014
cell autophagosome accumulation cell perinuclear region of cytoplasm, abnormal zf155Tg + MO1-spns1 + MO4-tp53 standard conditions Fig. 4 with image from Sasaki et al., 2014
neutrophil ab1-gnb labeling decreased amount, abnormal i114Tg + MO1-gnb1a + MO1-gnb4a + MO1-gnb4b + MO2-gnb1b + MO4-tp53 control Fig. 2 with image from Ke et al., 2017
neutrophil ab1-gnb1a labeling decreased amount, abnormal i114Tg + MO1-gnb1a + MO1-gnb4a + MO1-gnb4b + MO2-gnb1b + MO4-tp53 control Fig. 2 with image from Ke et al., 2017
bipolar neuron postsynaptic density absent, abnormal atoh7th241/th241; ptf1asa126/sa126; cu2Tg + MO1-ptf1a + MO4-ptf1a + MO4-tp53 standard conditions Fig. 3 with image from Randlett et al., 2013
retina ab1-elavl labeling absent, abnormal atoh7th241/th241; ptf1asa126/sa126; cu2Tg + MO1-ptf1a + MO4-ptf1a + MO4-tp53 standard conditions Fig. 3 with image from Randlett et al., 2013
amacrine cell absent, abnormal atoh7th241/th241; ptf1asa126/sa126; cu2Tg + MO1-ptf1a + MO4-ptf1a + MO4-tp53 standard conditions Fig. 3 with image from Randlett et al., 2013
retinal ganglion cell absent, abnormal atoh7th241/th241; ptf1asa126/sa126; cu2Tg + MO1-ptf1a + MO4-ptf1a + MO4-tp53 standard conditions Fig. 3 with image from Randlett et al., 2013
retinal inner plexiform layer decreased thickness, abnormal atoh7th241/th241; ptf1asa126/sa126; nns5Tg + MO1-ptf1a + MO4-ptf1a + MO4-tp53 standard conditions Fig. 2 with image from Randlett et al., 2013
retinal inner plexiform layer position, abnormal atoh7th241/th241; ptf1asa126/sa126; nns5Tg + MO1-ptf1a + MO4-ptf1a + MO4-tp53 standard conditions Fig. 2 with image from Randlett et al., 2013
amacrine cell absent, abnormal atoh7th241/th241; ptf1asa126/sa126; nns5Tg + MO1-ptf1a + MO4-ptf1a + MO4-tp53 standard conditions Fig. 2 with image from Randlett et al., 2013
retinal ganglion cell absent, abnormal atoh7th241/th241; ptf1asa126/sa126; nns5Tg + MO1-ptf1a + MO4-ptf1a + MO4-tp53 standard conditions Fig. 2 with image from Randlett et al., 2013
atrioventricular canal distended, abnormal cemip2hu4800/hu4800; la116Tg + MO4-tp53 (AB/TL) standard conditions Fig. 4 with image from Smith et al., 2011
endocardial cushion formation disrupted, abnormal cemip2hu4800/hu4800; la116Tg + MO4-tp53 (AB/TL) standard conditions Fig. 4 with image from Smith et al., 2011
endocardial cushion formation disrupted, abnormal cemip2hu5935/hu5935; la116Tg + MO4-tp53 (AB/TL) standard conditions Fig. 4 with image from Smith et al., 2011
atrioventricular canal distended, abnormal cemip2hu5935/hu5935; la116Tg + MO4-tp53 (AB/TL) standard conditions Fig. 4 with image from Smith et al., 2011
apoptotic process decreased occurrence, abnormal dnmt1s872/s872; jh1Tg; m1018Tg + MO4-tp53 standard conditions Fig. 4 with image from Anderson et al., 2009
exocrine pancreas decreased size, abnormal dnmt1s872/s872; jh1Tg; m1018Tg + MO4-tp53 standard conditions Fig. 4 with image from Anderson et al., 2009
spinal cord oligodendrocyte ab1-rps6 labeling amount, ameliorated hmgcs1vu57/vu57; vu12Tg + MO1-ptena + MO4-tp53 standard conditions Fig. 3 from Mathews et al., 2016
oligodendrocyte TOR signaling occurrence, ameliorated hmgcs1vu57/vu57; vu12Tg + MO1-ptena + MO4-tp53 standard conditions Fig. 3 from Mathews et al., 2016
oligodendrocyte MAPK cascade decreased occurrence, abnormal hmgcs1vu57/vu57; vu12Tg + MO1-ptena + MO4-tp53 standard conditions Fig. 3 from Mathews et al., 2016
spinal cord oligodendrocyte ab20-mapk labeling increased amount, abnormal hmgcs1vu57/vu57; vu12Tg + MO1-ptena + MO4-tp53 standard conditions Fig. 3 from Mathews et al., 2016
oligodendrocyte TOR signaling decreased occurrence, abnormal hmgcs1vu57/vu57; vu12Tg + MO4-tp53 standard conditions Fig. 3 from Mathews et al., 2016
spinal cord oligodendrocyte ab1-rps6 labeling decreased amount, abnormal hmgcs1vu57/vu57; vu12Tg + MO4-tp53 standard conditions Fig. 3 from Mathews et al., 2016
spinal cord oligodendrocyte ab20-mapk labeling decreased amount, abnormal hmgcs1vu57/vu57; vu12Tg + MO4-tp53 standard conditions Fig. 3 from Mathews et al., 2016
oligodendrocyte MAPK cascade decreased occurrence, abnormal hmgcs1vu57/vu57; vu12Tg + MO4-tp53 standard conditions Fig. 3 from Mathews et al., 2016
spinal cord central nervous system myelination occurrence, ameliorated hmgcs1vu57/vu57; vu16Tg + MO1-ptena + MO4-tp53 standard conditions Fig. 5Fig. 6 from Mathews et al., 2016
spinal cord central nervous system myelination occurrence, ameliorated hmgcs1vu57/vu57; vu16Tg + MO1-ptena + MO4-tp53 chemical treatment by environment: U0126 Fig. 6 from Mathews et al., 2016
spinal cord central nervous system myelination occurrence, ameliorated hmgcs1vu57/vu57; vu16Tg + MO1-ptena + MO4-tp53 chemical treatment by environment: sirolimus Fig. 6 from Mathews et al., 2016
spinal cord central nervous system myelination decreased occurrence, abnormal hmgcs1vu57/vu57; vu16Tg + MO4-tp53 chemical treatment by environment: sirolimus Fig. 6 from Mathews et al., 2016
spinal cord central nervous system myelination decreased occurrence, abnormal hmgcs1vu57/vu57; vu16Tg + MO4-tp53 control Fig. 5Fig. 6 from Mathews et al., 2016
spinal cord central nervous system myelination decreased occurrence, abnormal hmgcs1vu57/vu57; vu16Tg + MO4-tp53 chemical treatment by environment: U0126 Fig. 6 from Mathews et al., 2016
atrial endocardium EGFP expression amount, ameliorated lamb1ash590/sh590; f2Tg; twu34Tg + MO1-tnnt2a + MO4-tp53 standard conditions Fig. 6 with image from Derrick et al., 2021
regulation of secondary heart field cardioblast proliferation normal process quality, ameliorated lamb1ash590/sh590; f2Tg; twu34Tg + MO1-tnnt2a + MO4-tp53 standard conditions Fig. 6 with image from Derrick et al., 2021
atrial endocardium DsRed2 expression amount, ameliorated lamb1ash590/sh590; f2Tg; twu34Tg + MO1-tnnt2a + MO4-tp53 standard conditions Fig. 6 with image from Derrick et al., 2021
atrial endocardium DsRed2 expression increased amount, abnormal lamb1ash590/sh590; f2Tg; twu34Tg + MO4-tp53 standard conditions Fig. 6 with image from Derrick et al., 2021
regulation of secondary heart field cardioblast proliferation increased process quality, abnormal lamb1ash590/sh590; f2Tg; twu34Tg + MO4-tp53 standard conditions Fig. 6 with image from Derrick et al., 2021
atrial endocardium EGFP expression increased amount, abnormal lamb1ash590/sh590; f2Tg; twu34Tg + MO4-tp53 standard conditions Fig. 6 with image from Derrick et al., 2021
eye anatomical region edematous, ameliorated mi1004Tg; mi1005Tg; rw0144Tg + MO4-tp53 chemical ablation: podocyte, chemical treatment by environment: metronidazole Fig. 4 from Zhai et al., 2019
extension edematous, ameliorated mi1004Tg; mi1005Tg; rw0144Tg + MO4-tp53 chemical ablation: podocyte, chemical treatment by environment: metronidazole Fig. 4 from Zhai et al., 2019
mandibular arch skeleton malformed, abnormal mpv17a9/a9; ba2Tg + MO1-aldh1a2 + MO4-tp53 standard conditions Fig. 9 from Bohnsack et al., 2012
pharyngeal arch 3-7 skeleton absent, abnormal mpv17a9/a9; ba2Tg + MO1-aldh1a2 + MO4-tp53 standard conditions Fig. 9 from Bohnsack et al., 2012
ceratohyal cartilage malformed, abnormal mpv17a9/a9; ba2Tg + MO2-thraa + MO4-tp53 standard conditions Fig. S3 with image from Bohnsack et al., 2013
Meckel's cartilage malformed, abnormal mpv17a9/a9; ba2Tg + MO2-thraa + MO4-tp53 standard conditions Fig. S3 with image from Bohnsack et al., 2013
mandibular muscle morphology, abnormal mpv17a9/a9; zf13Tg + MO1-aldh1a2 + MO4-tp53 standard conditions Fig. 9 from Bohnsack et al., 2012
branchial muscle malformed, abnormal mpv17a9/a9; zf13Tg + MO1-aldh1a2 + MO4-tp53 standard conditions Fig. 9 from Bohnsack et al., 2012
exocrine pancreas development disrupted, abnormal pes1hi2Tg/hi2Tg; jh1Tg; jh2Tg + MO4-tp53 standard conditions Fig. 6 with image from Provost et al., 2012
exocrine pancreas decreased size, abnormal pes1hi2Tg/hi2Tg; jh1Tg; jh2Tg + MO4-tp53 standard conditions Fig. 6 with image from Provost et al., 2012
post-vent region curved, abnormal pes1hi2Tg/hi2Tg; jh1Tg; jh2Tg + MO4-tp53 standard conditions Fig. 6 with image from Provost et al., 2012
statoacoustic (VIII) ganglion has fewer parts of type neuron, abnormal pgk1x40/x40; zc7Tg + MO1-plg + MO4-tp53 control Figure 4 - figure supplement 6 from Kantarci et al., 2020
statoacoustic (VIII) ganglion has fewer parts of type neuron, abnormal pgk1x55/x55; zc7Tg + MO1-plg + MO4-tp53 control Figure 4 - figure supplement 6 from Kantarci et al., 2020
statoacoustic (VIII) ganglion has fewer parts of type neuron, abnormal pgk1x55/x55; zc7Tg + MO2-plg + MO4-tp53 control Figure 4 - figure supplement 6 from Kantarci et al., 2020
cardiac ventricle decreased size, abnormal pku5Et; pku6Tg + MO1-rap1aa + MO2-rap1b + MO4-tp53 standard conditions text only from Dong et al., 2012
pericardium edematous, abnormal pku5Et; pku6Tg + MO1-rap1aa + MO2-rap1b + MO4-tp53 standard conditions text only from Dong et al., 2012
heart morphology, abnormal pku5Et; pku6Tg + MO1-rap1aa + MO2-rap1b + MO4-tp53 standard conditions Fig. S2 with image from Dong et al., 2012
heart dilated, abnormal pku5Et; pku6Tg + MO1-rap1aa + MO2-rap1b + MO4-tp53 standard conditions text only from Dong et al., 2012
heart looping disrupted, abnormal pku5Et; pku6Tg + MO1-rap1aa + MO2-rap1b + MO4-tp53 standard conditions Fig. S2 with image from Dong et al., 2012
heart development disrupted, abnormal pku5Et; pku6Tg + MO1-rap1aa + MO2-rap1b + MO4-tp53 standard conditions Fig. 2 with image from Dong et al., 2012
retinal inner plexiform layer YFP expression spatial pattern, abnormal q16aTg; q16bTg; q19Tg + MO1-atoh7 + MO1-ptf1a + MO4-ptf1a + MO4-tp53 standard conditions Fig. 2 with image from Randlett et al., 2013
retinal inner plexiform layer Cerulean expression spatial pattern, abnormal q16aTg; q16bTg; q19Tg + MO1-atoh7 + MO1-ptf1a + MO4-ptf1a + MO4-tp53 standard conditions Fig. 2 with image from Randlett et al., 2013
exocrine pancreas decreased size, abnormal rpl3hi2437Tg/+; jh1Tg; jh2Tg + MO4-tp53 standard conditions Fig. 5 with image from Provost et al., 2012
exocrine pancreas development disrupted, abnormal rpl3hi2437Tg/+; jh1Tg; jh2Tg + MO4-tp53 standard conditions Fig. 5 with image from Provost et al., 2012
exocrine pancreas decreased size, abnormal rpl3hi2437Tg/hi2437Tg; jh1Tg; jh2Tg + MO4-tp53 standard conditions Fig. 5 with image from Provost et al., 2012
exocrine pancreas development disrupted, abnormal rpl3hi2437Tg/hi2437Tg; jh1Tg; jh2Tg + MO4-tp53 standard conditions Fig. 5 with image from Provost et al., 2012
pancreas hypoplastic, abnormal rpl6hi3655bTg/+; jh1Tg; jh2Tg + MO4-tp53 standard conditions Fig. 4 with image from Provost et al., 2013
pancreas hypoplastic, abnormal rpl6hi3655bTg/hi3655bTg; jh1Tg; jh2Tg + MO4-tp53 standard conditions Fig. 4 with image from Provost et al., 2013
pancreas hypoplastic, abnormal rpl23ahi2582Tg/+; jh1Tg; jh2Tg + MO4-tp53 standard conditions Fig. 4 with image from Provost et al., 2013
pancreas hypoplastic, abnormal rpl23ahi2582Tg/hi2582Tg; jh1Tg; jh2Tg + MO4-tp53 standard conditions Fig. 4 with image from Provost et al., 2013
caudal hematopoietic tissue hematopoietic stem cell myb expression spatial pattern, ameliorated sart3sm471/sm471; la2Tg + MO4-tp53 control Fig. 4 with image from Zhao et al., 2021
caudal hematopoietic tissue hematopoietic multipotent progenitor cell myb expression spatial pattern, ameliorated sart3sm471/sm471; la2Tg + MO4-tp53 control Fig. 4 with image from Zhao et al., 2021
thymus rag1 expression spatial pattern, ameliorated sart3sm471/sm471; la2Tg + MO4-tp53 control Fig. 4 with image from Zhao et al., 2021
heart morphology, abnormal smarca4aa8/a8; twu34Tg + MO4-tp53 standard conditions Fig. S3 from Takeuchi et al., 2011
heart looping disrupted, abnormal smarca4aa8/a8; twu34Tg + MO4-tp53 standard conditions Fig. S3 from Takeuchi et al., 2011
dorsal aorta EGFP expression amount, ameliorated supt16hsd45/sd45; um14Tg + MO4-tp53 standard conditions Fig. 4 from Espanola et al., 2020
pronephric glomerulus swollen, abnormal tmem218zf3603/zf3603; li1Tg + MO1-nphp4 + MO4-tp53 (AB/TL) control Fig. 6 from Epting et al., 2022
heart looping decreased process quality, abnormal tmem218zf3603/zf3603; li1Tg + MO1-nphp4 + MO4-tp53 (AB/TL) control Fig. 6 from Epting et al., 2022
pronephros cystic, abnormal tmem218zf3603/zf3603; li1Tg + MO1-nphp4 + MO4-tp53 (AB/TL) control Fig. 6 from Epting et al., 2022
posterior lateral line primordium actin filament bundle organization process quality, abnormal ui2Tg; zf106Tg + MO2-gnb1a + MO2-gnb1b + MO4-tp53 standard conditions Fig. 6 with image from Xu et al., 2014
rhombomere cell population proliferation decreased occurrence, abnormal wwtr1fu55/+; mw50Tg + MO1-yap1 + MO4-tp53 control Fig. 5 from Voltes et al., 2019
statoacoustic (VIII) ganglion has normal numbers of parts of type neuron, ameliorated x66Tg; zc7Tg + MO4-pgk1 + MO4-tp53 heat shock Figure 4 - figure supplement 4 from Kantarci et al., 2020
neutrophil amount, ameliorated zbtb11gl11/gl11; nz50Tg + MO4-tp53 control Fig. 4 with image from Keightley et al., 2017
posterior lateral line neuromast primordium migration process quality, abnormal cxcr4bt26035/+; zf106Tg + MO2-gnb1a + MO2-gnb1b + MO4-tp53 standard conditions Fig. 7 with image from Xu et al., 2014
posterior lateral line neuromast primordium migration disrupted, abnormal cxcr4bt26035/+; zf106Tg + MO2-gnb1a + MO2-gnb1b + MO4-tp53 standard conditions Fig. 7 with image from Xu et al., 2014
endoderm increased width, ameliorated gpc4fr6/fr6; ha01Tg + MO1-fn1a + MO1-lamb1a + MO4-tp53 standard conditions Fig. 6 with image from Hu et al., 2018
endoderm increased width, exacerbated gpc4fr6/fr6; ha01Tg + MO2-mmp14b + MO4-mmp14a + MO4-tp53 standard conditions Fig. S8 with image from Hu et al., 2018
pericardium morphology, ameliorated mitfaw2/w2; mpv17a9/a9; lri500Tg + MO3-mdm2 + MO4-tp53 standard conditions Fig. 2 with image from Thomasova et al., 2016
glomerular filtration process quality, ameliorated mitfaw2/w2; mpv17a9/a9; lri500Tg + MO3-mdm2 + MO4-tp53 standard conditions Fig. 2 with image from Thomasova et al., 2016
endodermal cell lamellipodium decreased length, abnormal s944Tg; ui10Tg + MO2-mmp14b + MO4-mmp14a + MO4-tp53 standard conditions Fig. 7 with image from Hu et al., 2018
endodermal cell lamellipodium decreased life span, abnormal s944Tg; ui10Tg + MO2-mmp14b + MO4-mmp14a + MO4-tp53 standard conditions Fig. 7 with image from Hu et al., 2018
endodermal cell lamellipodium decreased amount, abnormal s944Tg; ui10Tg + MO2-mmp14b + MO4-mmp14a + MO4-tp53 standard conditions Fig. 7 with image from Hu et al., 2018
endodermal cell plasma membrane bounded cell projection increased amount, abnormal s944Tg; ui10Tg + MO2-mmp14b + MO4-mmp14a + MO4-tp53 standard conditions Fig. 7 with image from Hu et al., 2018
whole organism lacks all parts of type pharyngeal arch cartilage, abnormal tfap2am610/m610; foxd3m188/m188 + MO4-tp53 standard conditions Fig. 2 with image from Wang et al., 2011
whole organism lacks all parts of type dorsal root ganglion, abnormal tfap2am610/m610; foxd3m188/m188 + MO4-tp53 standard conditions Fig. 2 with image from Wang et al., 2011
whole organism lacks all parts of type enteric nervous system neuron, abnormal tfap2am610/m610; foxd3m188/m188 + MO4-tp53 standard conditions Fig. 2 with image from Wang et al., 2011
central nervous system apoptotic process occurrence, ameliorated zbtb11gl11/gl11; mq8Tg + MO4-tp53 control Fig. 4 with image from Keightley et al., 2017
Citations