ZFIN ID: ZDB-MRPHLNO-070126-7
Morpholino Name: MO4-tp53
Target: tp53 (6)
Previous Names: MO2-tp53, p53MO (1), p53-MO ATG (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GCGCCATTGCTTTGCAAGAATTG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO4-tp53 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO4-tp53
Expressed Gene Anatomy Figures
alcama Fig. 4 with image from Smith et al., 2011
aldh1a2 Fig. 7 with image from Feng et al., 2010
arxa Fig. 4 with image from Sanek et al., 2008
axin2 Fig. 9 with image from Mahmoudi et al., 2010
baxa Fig. S3 with image from Chakraborty et al., 2009
bbc3 Fig. 6 from Rodríguez-Aznar et al., 2011
casp8 Fig. 4 with image from Espín et al., 2013
cdkn1a Fig. 3 with image from Provost et al., 2012
Fig. S3 with image from Chakraborty et al., 2009
col2a1a Fig. 4 with image from Moreno-Ayala et al., 2015
Fig. 6 from van Boxtel et al., 2011
crestin Fig. 8 with image from Xia et al., 2013
cyp26a1 Fig. 7 with image from Feng et al., 2010
dlx2a Fig. 6 from van Boxtel et al., 2011
Fig. 4 with image from Viktorin et al., 2009
Fig. 4 with image from Sanek et al., 2008
dmbx1a Fig. 2 from Liu et al., 2008
egr2b Fig. 7 with image from Feng et al., 2010
elavl3 Fig. 4 with image from Viktorin et al., 2009
elavl4 Fig. 4 with image from Viktorin et al., 2009
emx1 Fig. 4 with image from Viktorin et al., 2009
emx3 Fig. 5 with image from Viktorin et al., 2009
en2a Fig. 12 with image from Murphy et al., 2017
eomesa Fig. 3 with imageFig. 4 with image from Viktorin et al., 2009
fabp2 Fig. 8 with image from Mahmoudi et al., 2010
fezf2 Fig. 4 with image from Viktorin et al., 2009
fgf8a Fig. 4 with image from Viktorin et al., 2009
foxg1a Fig. 4 with imageFig. 5 with image from Viktorin et al., 2009
fzd8a Fig. 4 with image from Viktorin et al., 2009
gata1a Fig. 3 from Li et al., 2009
gsc Fig. 6 from van Boxtel et al., 2011
hand2 Fig. 6 from van Boxtel et al., 2011
has2 Fig. 4 with image from Smith et al., 2011
isl1 Fig. 6 with image from Calarco et al., 2009
lhx5 Fig. 4 with image from Viktorin et al., 2009
mbpa Fig. 4 from Mathews et al., 2016
mdm2 Fig. S3 with image from Chakraborty et al., 2009
mpx Fig. 3 with image from Provost et al., 2012
neurod1 Fig. 4 with image from Viktorin et al., 2009
neurod6b Fig. 4 with image from Viktorin et al., 2009
otx2b Fig. S3 with image from Schaffer et al., 2014
pax6a Fig. 4 with image from Viktorin et al., 2009
Fig. 2 from Liu et al., 2008
plp1a Fig. 4 from Mathews et al., 2016
prl Fig. 8 from Graf et al., 2015
ptch1 Fig. S5 with image from Corallo et al., 2013
reln Fig. 4 with image from Viktorin et al., 2009
scrt2 Fig. 4 from Rodríguez-Aznar et al., 2011
shha Fig. 4 with image from Moreno-Ayala et al., 2015
slc12a3 Fig. 4 with image from Naylor et al., 2017
slc17a6a Fig. 4 with image from Viktorin et al., 2009
slc17a6b Fig. 4 with image from Viktorin et al., 2009
sox9a Fig. 6 from van Boxtel et al., 2011
sox10 Fig. 6 from van Boxtel et al., 2011
tbxta Fig. 4 with image from Moreno-Ayala et al., 2015
tcf4 Fig. 4 with image from Viktorin et al., 2009
tp53 Fig. 3 with image from DeRossi et al., 2017
Fig. 3 with image from Provost et al., 2012
Fig. S3 with image from Chakraborty et al., 2009
Fig. 3Fig. 4 from Lee et al., 2008
tpcn2 Fig. 3 from Kelu et al., 2015
wnt7ba Fig. 4 with image from Viktorin et al., 2009
wnt7bb Fig. 4 with image from Viktorin et al., 2009
PHENOTYPE
Phenotype resulting from MO4-tp53
Phenotype Figures
apoptotic process decreased occurrence, abnormal Fig. S3 with image from Chakraborty et al., 2009
Fig. S4 from Zeng et al., 2007
apoptotic process decreased occurrence, abnormal Fig. 4 with image from Naylor et al., 2017
double-strand break repair via homologous recombination increased frequency, abnormal Fig. 1 from Gong et al., 2015
double-strand break repair via nonhomologous end joining increased frequency, abnormal Fig. 1 from Gong et al., 2015
double-strand break repair via single-strand annealing increased frequency, abnormal Fig. 1 from Gong et al., 2015
intestine well differentiated, abnormal Fig. 8 with image from Mahmoudi et al., 2010
nucleate erythrocyte immature, abnormal Fig. 5 with image from Imamura et al., 2008
peripheral nervous system development process quality, abnormal Fig. 4 with image from Boer et al., 2016
whole organism posterior region ab1-casp3 labeling decreased amount, abnormal Fig. 4 with image from Naylor et al., 2017

Phenotype of all Fish created by or utilizing MO4-tp53
Phenotype Fish Conditions Figures
retinal inner plexiform layer decreased thickness, abnormal ptf1asa126/sa126 + MO1-ptf1a + MO4-ptf1a + MO4-tp53 standard conditions Fig. 2 with image from Randlett et al., 2013
amacrine cell absent, abnormal ptf1asa126/sa126 + MO1-ptf1a + MO4-ptf1a + MO4-tp53 standard conditions Fig. 2 with image from Randlett et al., 2013
intrinsic apoptotic signaling pathway in response to DNA damage disrupted, abnormal tp53zdf1/zdf1 + MO4-tp53 radiation Fig. 2 with image from Sidi et al., 2008
whole organism decreased sensitivity to irradiation, abnormal tp53zdf1/zdf1 + MO4-tp53 radiation Fig. 2 with image from Sidi et al., 2008
skeletal muscle sarcomere disorganized, abnormal ttn.2sfc11/sfc11 + MO4-tp53 + MO5-ttn.2(EKW) standard conditions Fig. 3 with image from Zou et al., 2015
eye edematous, abnormal AB + MO1-arhgdia + MO4-tp53 standard conditions Fig. 5Fig. S8 from Gee et al., 2013
whole organism edematous, abnormal AB + MO1-arhgdia + MO4-tp53 standard conditions Fig. 5Fig. S8 from Gee et al., 2013
neural crest cell migration involved in autonomic nervous system development disrupted, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 7 with image from Tu et al., 2012
mandibular arch skeleton decreased size, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 1 with image from Tu et al., 2012
enteric neuron decreased amount, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 3 with image from Tu et al., 2012
Kupffer's vesicle cilium decreased amount, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. S6 with image from Tu et al., 2012
apoptotic process decreased occurrence, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 8 with image from Tu et al., 2012
enteric nervous system development disrupted, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 7 with image from Tu et al., 2012
iridophore decreased amount, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 1 with image from Tu et al., 2012
trunk neural crest cell migration delayed, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 6 with image from Tu et al., 2012
epibranchial ganglion neuron decreased amount, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 3 with image from Tu et al., 2012
enteric neuron mislocalised, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 7 with image from Tu et al., 2012
pharyngeal arch cartilage absent, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 2 with image from Tu et al., 2012
melanocyte migration disrupted, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 1 with image from Tu et al., 2012
neurocranial trabecula decreased size, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 2 with image from Tu et al., 2012
cranial neural crest cell mislocalised, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 6 with image from Tu et al., 2012
trunk neural crest cell mislocalised, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 6 with image from Tu et al., 2012
pectoral fin absent, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 2 with image from Tu et al., 2012
vagal neural crest decreased size, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 7 with image from Tu et al., 2012
neural crest cell migration process quality, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 6 with image from Tu et al., 2012
melanocyte decreased amount, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 1 with image from Tu et al., 2012
regulation of smoothened signaling pathway disrupted, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. S5 with image from Tu et al., 2012
cranial neural crest decreased size, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 5 with imageFig. 6 with image from Tu et al., 2012
head decreased size, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 1 with image from Tu et al., 2012
ethmoid cartilage absent, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 2 with image from Tu et al., 2012
dorsal root ganglion neuron decreased amount, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 3 with image from Tu et al., 2012
determination of left/right symmetry disrupted, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. S6 with image from Tu et al., 2012
Kupffer's vesicle cilium decreased length, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. S6 with image from Tu et al., 2012
cilium assembly disrupted, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. S6 with image from Tu et al., 2012
enteric neuron decreased length, abnormal AB + MO1-arl6ip1 + MO4-tp53 standard conditions Fig. 7 with image from Tu et al., 2012
embryo development disrupted, abnormal AB + MO1-atp13a2 + MO4-tp53 standard conditions text only from Lopes da Fonseca et al., 2013
whole organism increased curvature, abnormal AB + MO1-atp13a2 + MO4-tp53 standard conditions Fig. 5 from Lopes da Fonseca et al., 2013
whole organism dead, abnormal AB + MO1-atp13a2 + MO4-tp53 standard conditions text only from Lopes da Fonseca et al., 2013
trunk morphology, abnormal AB + MO1-bcl11ab + MO4-tp53 standard conditions Fig. 6 from Bagheri et al., 2016
eye decreased size, abnormal AB + MO1-bcl11ab + MO4-tp53 standard conditions Fig. 7 from Bagheri et al., 2016
brain decreased volume, abnormal AB + MO1-bcl11ab + MO4-tp53 standard conditions Fig. 8 from Bagheri et al., 2016
head decreased size, abnormal AB + MO1-bcl11ab + MO4-tp53 standard conditions Fig. 7 from Bagheri et al., 2016
head morphology, abnormal AB + MO1-bcl11ab + MO4-tp53 standard conditions Fig. 6 from Bagheri et al., 2016
brain development disrupted, abnormal AB + MO1-bcl11ab + MO4-tp53 standard conditions Fig. 8 from Bagheri et al., 2016
fin decreased size, abnormal AB + MO1-bcl11ab + MO4-tp53 standard conditions Fig. 7 from Bagheri et al., 2016
otic vesicle decreased size, abnormal AB + MO1-bcl11ab + MO4-tp53 standard conditions Fig. 7 from Bagheri et al., 2016
neuron apoptotic, abnormal AB + MO1-ca8 + MO4-tp53 standard conditions Fig. 6 from Aspatwar et al., 2013
whole organism dead, abnormal AB + MO1-ca8 + MO4-tp53 standard conditions Fig. 5 from Aspatwar et al., 2013
determination of heart left/right asymmetry disrupted, abnormal AB + MO1-ccsapb + MO4-tp53 standard conditions Fig. 6 from Backer et al., 2012
brain development disrupted, abnormal AB + MO1-ccsapb + MO4-tp53 standard conditions Fig. 4 from Backer et al., 2012
ventricular zone cell apoptotic, abnormal AB + MO1-ccsapb + MO4-tp53 standard conditions Fig. 4 from Backer et al., 2012
Mauthner neuron decreased amount, abnormal AB + MO1-ccsapb + MO4-tp53 standard conditions Fig. 5 from Backer et al., 2012
axonal fasciculation disrupted, abnormal AB + MO1-ccsapb + MO4-tp53 standard conditions Fig. 5 from Backer et al., 2012
central nervous system projection neuron axonogenesis disrupted, abnormal AB + MO1-ccsapb + MO4-tp53 standard conditions Fig. 5 from Backer et al., 2012
thigmotaxis disrupted, abnormal AB + MO1-ccsapb + MO4-tp53 standard conditions Fig. 4 from Backer et al., 2012
induction of programmed cell death increased occurrence, abnormal AB + MO1-ccsapb + MO4-tp53 standard conditions Fig. 5 from Backer et al., 2012
heart displaced to whole organism right side, abnormal AB + MO1-ccsapb + MO4-tp53 standard conditions Fig. 6 from Backer et al., 2012
somite border disorganized, abnormal AB + MO1-ccsapb + MO4-tp53 standard conditions Fig. 4 from Backer et al., 2012
heart displaced to whole organism medial side, abnormal AB + MO1-ccsapb + MO4-tp53 standard conditions Fig. 6 from Backer et al., 2012
hindbrain neuroepithelial cell decreased amount, abnormal AB + MO1-ccsapb + MO4-tp53 standard conditions Fig. 5 from Backer et al., 2012
brain decreased object quality, abnormal AB + MO1-ccsapb + MO4-tp53 standard conditions Fig. 4 from Backer et al., 2012
eye decreased size, abnormal AB + MO1-ccsapb + MO4-tp53 standard conditions Fig. 4 from Backer et al., 2012
heart edematous, abnormal AB + MO1-ccsapb + MO4-tp53 standard conditions Fig. 4 from Backer et al., 2012
muscle cell apoptotic, abnormal AB + MO1-col6a1 + MO4-tp53 chemical treatment: cyclosporin A Fig. 7 from Telfer et al., 2010
musculoskeletal movement disrupted, abnormal AB + MO1-col6a1 + MO4-tp53 standard conditions Fig. 8 from Telfer et al., 2010
muscle cell apoptotic, abnormal AB + MO1-col6a1 + MO4-tp53 standard conditions Fig. 7 from Telfer et al., 2010
whole organism edematous, abnormal AB + MO1-coq8b + MO4-tp53 standard conditions Fig. 2 from Ashraf et al., 2013
orbit edematous, abnormal AB + MO1-coq8b + MO4-tp53 standard conditions Fig. 2 from Ashraf et al., 2013
podocyte cell projection disorganized, abnormal AB + MO1-coq8b + MO4-tp53 standard conditions Fig. 2 from Ashraf et al., 2013
glomerular basement membrane disorganized, abnormal AB + MO1-coq8b + MO4-tp53 standard conditions Fig. 2 from Ashraf et al., 2013
glomerular visceral epithelial cell development disrupted, abnormal AB + MO1-coq8b + MO4-tp53 standard conditions Fig. 2 from Ashraf et al., 2013
hydrogen peroxide biosynthetic process disrupted, abnormal AB + MO1-duox + MO4-tp53 physical alteration: caudal fin Fig. 3 from Niethammer et al., 2009
leukocyte migration disrupted, abnormal AB + MO1-duox + MO4-tp53 physical alteration: caudal fin Fig. 3 from Niethammer et al., 2009
response to wounding disrupted, abnormal AB + MO1-duox + MO4-tp53 physical alteration: caudal fin Fig. 3 from Niethammer et al., 2009
retina apoptotic process process quality, ameliorated AB + MO1-ehmt2 + MO4-tp53 standard conditions Fig. 5 with image from Olsen et al., 2016
lens protruding, abnormal AB + MO1-gdf6a + MO4-tp53 standard conditions Fig. 4Fig. 5 from Asai-Coakwell et al., 2007
post-vent region kinked, abnormal AB + MO1-gdf6a + MO4-tp53 standard conditions Fig. 3 from Asai-Coakwell et al., 2009
retina malformed, abnormal AB + MO1-gdf6a + MO4-tp53 standard conditions Fig. 5 from Asai-Coakwell et al., 2007
retina disorganized, abnormal AB + MO1-gdf6a + MO4-tp53 standard conditions Fig. 4 from Asai-Coakwell et al., 2007
cranial nerve II hypoplastic, abnormal AB + MO1-gdf6a + MO4-tp53 standard conditions Fig. 4 from Asai-Coakwell et al., 2007
optic fissure closure incomplete, abnormal AB + MO1-gdf6a + MO4-tp53 standard conditions Fig. 3 from Asai-Coakwell et al., 2009
Fig. 4Fig. 5 from Asai-Coakwell et al., 2007
lens vacuolated, abnormal AB + MO1-gdf6a + MO4-tp53 standard conditions Fig. 4 from Asai-Coakwell et al., 2007
eye decreased size, abnormal AB + MO1-gdf6a + MO4-tp53 standard conditions Fig. 3 from Asai-Coakwell et al., 2009
Fig. 4Fig. 5 from Asai-Coakwell et al., 2007
otic vesicle decreased size, abnormal AB + MO1-hmx4 + MO2-hmx4 + MO4-tp53 standard conditions Fig. 2 with image from Gongal et al., 2011
eye adjacent to eye, abnormal AB + MO1-hmx4 + MO2-hmx4 + MO4-tp53 standard conditions Fig. 2 with imageFig. 5 with image from Gongal et al., 2011
pectoral fin absent, abnormal AB + MO1-hmx4 + MO2-hmx4 + MO4-tp53 standard conditions Fig. 2 with image from Gongal et al., 2011
neural tube closure incomplete, abnormal AB + MO1-hmx4 + MO2-hmx4 + MO4-tp53 standard conditions Fig. 2 with imageFig. 5 with image from Gongal et al., 2011
swim bladder bud hypoplastic, abnormal AB + MO1-ihha + MO4-tp53 standard conditions Fig. S3 with image from Winata et al., 2009
swim bladder morphogenesis disrupted, abnormal AB + MO1-ihha + MO4-tp53 standard conditions Fig. S3 with image from Winata et al., 2009
swim bladder hypoplastic, abnormal AB + MO1-ihha + MO4-tp53 standard conditions Fig. S3 with image from Winata et al., 2009
posterior lateral line neuromast decreased amount, abnormal AB + MO1-ildr1b + MO4-tp53 control Fig. S6 from Sang et al., 2014
whole organism edematous, abnormal AB + MO1-kank2 + MO4-tp53 standard conditions Fig. 4 from Gee et al., 2015
eye edematous, abnormal AB + MO1-kank2 + MO4-tp53 standard conditions Fig. 4 from Gee et al., 2015
podocyte cell projection absent, abnormal AB + MO1-kank2 + MO4-tp53 standard conditions Fig. 4 from Gee et al., 2015
glomerular basement membrane disorganized, abnormal AB + MO1-kank2 + MO4-tp53 standard conditions Fig. 4 from Gee et al., 2015
podocyte disorganized, abnormal AB + MO1-kank2 + MO4-tp53 standard conditions Fig. 4 from Gee et al., 2015
heart tube symmetry, abnormal AB + MO1-kif7 + MO4-tp53 standard conditions Fig. 3 from Wilson et al., 2009
determination of left/right symmetry disrupted, abnormal AB + MO1-kif7 + MO4-tp53 standard conditions Fig. 3 from Wilson et al., 2009
heart looping disrupted, abnormal AB + MO1-kif7 + MO4-tp53 standard conditions Fig. 3 from Wilson et al., 2009
heart tube inverted, abnormal AB + MO1-kif7 + MO4-tp53 standard conditions Fig. 3 from Wilson et al., 2009
trunk Ab1-ntn1 labeling increased distribution, abnormal AB + MO1-lamc3 + MO4-tp53 standard conditions Fig. 4 with image from Eve et al., 2017
muscle pioneer ntn1a expression increased distribution, abnormal AB + MO1-lamc3 + MO4-tp53 standard conditions Fig. 4 with image from Eve et al., 2017
trunk Ab1-ntn1 labeling spatial pattern, abnormal AB + MO1-lamc3 + MO4-tp53 standard conditions Fig. 4 with image from Eve et al., 2017
somite actin filament disorganized, abnormal AB + MO1-mkxa + MO4-tp53 standard conditions Fig. 1 from Chuang et al., 2014
whole organism curved, abnormal AB + MO1-mkxa + MO4-tp53 standard conditions Fig. 1 from Chuang et al., 2014
somite focal adhesion decreased amount, abnormal AB + MO1-mkxa + MO4-tp53 standard conditions Fig. 1 from Chuang et al., 2014
skeletal muscle cell irregular spatial pattern, abnormal AB + MO1-mkxa + MO4-tp53 standard conditions Fig. 1 from Chuang et al., 2014
whole organism anterior-posterior axis decreased length, abnormal AB + MO1-mkxa + MO4-tp53 standard conditions Fig. 1 from Chuang et al., 2014
thigmotaxis disrupted, abnormal AB + MO1-mkxa + MO4-tp53 standard conditions Fig. 1 from Chuang et al., 2014
somite actin filament decondensed, abnormal AB + MO1-mkxa + MO4-tp53 standard conditions Fig. 1 from Chuang et al., 2014
eye size, ameliorated AB + MO1-mpi + MO4-tp53 standard conditions Fig. 3 with image from DeRossi et al., 2017
pericardium edematous, ameliorated AB + MO1-mpi + MO4-tp53 standard conditions Fig. 3 with image from DeRossi et al., 2017
head size, ameliorated AB + MO1-mpi + MO4-tp53 standard conditions Fig. 3 with image from DeRossi et al., 2017
liver size, ameliorated AB + MO1-mpi + MO4-tp53 standard conditions Fig. 3 with image from DeRossi et al., 2017
mandibular arch skeleton morphology, ameliorated AB + MO1-mpi + MO4-tp53 standard conditions Fig. 3 with image from DeRossi et al., 2017
whole organism life span, ameliorated AB + MO1-mpi + MO4-tp53 standard conditions Fig. 3 with image from DeRossi et al., 2017
apoptotic process process quality, ameliorated AB + MO1-mpi + MO4-tp53 standard conditions Fig. 3 with image from DeRossi et al., 2017
anatomical structure tp53 expression amount, ameliorated AB + MO1-mpi + MO4-tp53 standard conditions Fig. 3 with image from DeRossi et al., 2017
apoptotic process increased process quality, abnormal AB + MO1-msrb3 + MO4-tp53 control Fig. 5 with image from Shen et al., 2015
brain development disrupted, abnormal AB + MO1-pcsk7 + MO4-tp53 standard conditions Fig. 4 from Turpeinen et al., 2013
otolith decreased amount, abnormal AB + MO1-pcsk7 + MO4-tp53 standard conditions Fig. 8 from Turpeinen et al., 2013
whole organism dead, abnormal AB + MO1-pcsk7 + MO4-tp53 standard conditions Fig. 4 from Turpeinen et al., 2013
heart development disrupted, abnormal AB + MO1-pcsk7 + MO4-tp53 standard conditions Fig. 4 from Turpeinen et al., 2013
otolith development disrupted, abnormal AB + MO1-pcsk7 + MO4-tp53 standard conditions Fig. 4 from Turpeinen et al., 2013
eye development disrupted, abnormal AB + MO1-pcsk7 + MO4-tp53 standard conditions Fig. 4 from Turpeinen et al., 2013
pronephros cystic, abnormal AB + MO1-pik3r4 + MO4-tp53 standard conditions Fig. 3 with image from Stoetzel et al., 2016
whole organism anterior-posterior axis curved, abnormal AB + MO1-pik3r4 + MO4-tp53 standard conditions Fig. 3 with image from Stoetzel et al., 2016
brain hydrocephalic, abnormal AB + MO1-pik3r4 + MO4-tp53 standard conditions Fig. 3 with image from Stoetzel et al., 2016
epiboly process quality, abnormal AB + MO1-prmt6 + MO4-tp53 standard conditions Fig. 2 from Zhao et al., 2016
anatomical structure gadd45aa expression increased amount, abnormal AB + MO1-prmt6 + MO4-tp53 standard conditions Fig. 4 from Zhao et al., 2016
anatomical structure tp53 expression increased amount, abnormal AB + MO1-prmt6 + MO4-tp53 standard conditions Fig. 4 from Zhao et al., 2016
apoptotic process process quality, abnormal AB + MO1-prmt6 + MO4-tp53 standard conditions Fig. 4 from Zhao et al., 2016
anatomical structure ab12-tp53 labeling amount, ameliorated AB + MO1-prmt6 + MO4-tp53 standard conditions Fig. 2 from Zhao et al., 2016
anatomical structure cdkn1a expression increased amount, abnormal AB + MO1-prmt6 + MO4-tp53 standard conditions Fig. 4 from Zhao et al., 2016
anatomical structure jun expression increased amount, abnormal AB + MO1-prmt6 + MO4-tp53 standard conditions Fig. 4 from Zhao et al., 2016
brain decreased volume, abnormal AB + MO1-rel + MO4-tp53 standard conditions Fig. 8 from Bagheri et al., 2016
fourth ventricle morphology, abnormal AB + MO1-rel + MO4-tp53 standard conditions Fig. 8 from Bagheri et al., 2016
common myeloid progenitor spi1b expression amount, ameliorated AB + MO1-rpl5a + MO4-tp53 standard conditions Fig. 2 with image from Wan et al., 2016
angioblastic mesenchymal cell tal1 expression amount, ameliorated AB + MO1-rpl5a + MO4-tp53 standard conditions Fig. 2 with image from Wan et al., 2016
hematopoietic stem cell myb expression amount, ameliorated AB + MO1-rpl5a + MO4-tp53 standard conditions Fig. 2 with image from Wan et al., 2016
hematopoietic stem cell runx1 expression amount, ameliorated AB + MO1-rpl5a + MO4-tp53 standard conditions Fig. 2 with image from Wan et al., 2016
heart nucleate erythrocyte amount, ameliorated AB + MO1-rpl5a + MO4-tp53 standard conditions Fig. 1 with image from Wan et al., 2016
erythroid progenitor cell gata1a expression amount, ameliorated AB + MO1-rpl5a + MO4-tp53 standard conditions Fig. 2 with image from Wan et al., 2016
heart morphology, abnormal AB + MO1-sap30l + MO4-tp53 standard conditions text only from Teittinen et al., 2012
heart contraction decreased efficiency, abnormal AB + MO1-sap30l + MO4-tp53 standard conditions text only from Teittinen et al., 2012
heart contraction decreased rate, abnormal AB + MO1-sap30l + MO4-tp53 standard conditions text only from Teittinen et al., 2012
heart looping disrupted, abnormal AB + MO1-sap30l + MO4-tp53 standard conditions text only from Teittinen et al., 2012
anterior lateral line neuromast hair cell apoptotic, abnormal AB + MO1-slc26a2 + MO4-tp53 standard conditions Fig. 6 with image from Liu et al., 2015
posterior lateral line neuromast hair cell apoptotic, abnormal AB + MO1-slc26a2 + MO4-tp53 standard conditions Fig. 6 with image from Liu et al., 2015
neural tube apoptotic process increased occurrence, abnormal AB + MO1-smc1a + MO4-tp53 standard conditions Fig. 4 from Fazio et al., 2016
determination of left/right symmetry disrupted, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. 3Fig. S11 from Wilson et al., 2009
lateral floor plate aplastic, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. 2Fig. S5 from Wilson et al., 2009
Kupffer's vesicle altered number of ciliated cell axonemal microtubule, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. 3 from Wilson et al., 2009
heart tube symmetry, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. 3 from Wilson et al., 2009
liver inverted, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. S11 from Wilson et al., 2009
floor plate formation disrupted, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. 2Fig. S5 from Wilson et al., 2009
medial floor plate morphology, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. S5 from Wilson et al., 2009
smoothened signaling pathway disrupted, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. 2 from Wilson et al., 2009
Kupffer's vesicle axoneme disorganized, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. 3 from Wilson et al., 2009
heart tube inverted, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. 3 from Wilson et al., 2009
atrium inverted, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. S11 from Wilson et al., 2009
liver position, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. S11 from Wilson et al., 2009
somite muscle pioneer absent, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. 2 from Wilson et al., 2009
axoneme assembly disrupted, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. 3 from Wilson et al., 2009
heart tube straight, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. S11 from Wilson et al., 2009
eye fused with eye, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions text only from Wilson et al., 2009
heart looping disrupted, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. 3Fig. S11 from Wilson et al., 2009
somite U-shaped, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. 2 from Wilson et al., 2009
cilium or flagellum-dependent cell motility disrupted, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. 3 from Wilson et al., 2009
gut position, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. S11 from Wilson et al., 2009
pancreas inverted, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. S11 from Wilson et al., 2009
pancreas position, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. S11 from Wilson et al., 2009
midbrain hindbrain boundary malformed, abnormal AB + MO1-tfpi2 + MO4-tp53 standard conditions Fig. 4 with image from Zhang et al., 2013
third ventricle decreased size, abnormal AB + MO1-tfpi2 + MO4-tp53 standard conditions Fig. 4 with image from Zhang et al., 2013
fourth ventricle decreased size, abnormal AB + MO1-tfpi2 + MO4-tp53 standard conditions Fig. 4 with image from Zhang et al., 2013
slow muscle cell tpcn2 expression decreased amount, abnormal AB + MO1-tpcn2 + MO4-tp53 standard conditions Fig. 3 from Kelu et al., 2015
slow muscle cell ab-f59 labeling decreased amount, abnormal AB + MO1-tpcn2 + MO4-tp53 standard conditions Fig. 3 from Kelu et al., 2015
eye decreased size, abnormal AB + MO1-xpo1a + MO4-tp53 standard conditions Fig. 7 from Bagheri et al., 2016
brain decreased volume, abnormal AB + MO1-xpo1a + MO4-tp53 standard conditions Fig. 8 from Bagheri et al., 2016
trunk morphology, abnormal AB + MO1-xpo1a + MO4-tp53 standard conditions Fig. 6Fig. 7 from Bagheri et al., 2016
head decreased size, abnormal AB + MO1-xpo1a + MO4-tp53 standard conditions Fig. 7 from Bagheri et al., 2016
head morphology, abnormal AB + MO1-xpo1a + MO4-tp53 standard conditions Fig. 6 from Bagheri et al., 2016
fin decreased size, abnormal AB + MO1-xpo1a + MO4-tp53 standard conditions Fig. 7 from Bagheri et al., 2016
fourth ventricle morphology, abnormal AB + MO1-xpo1a + MO4-tp53 standard conditions Fig. 8 from Bagheri et al., 2016
trunk curved, abnormal AB + MO1-xpo1a + MO4-tp53 standard conditions Fig. 7 from Bagheri et al., 2016
otic vesicle decreased size, abnormal AB + MO1-xpo1a + MO4-tp53 standard conditions Fig. 7 from Bagheri et al., 2016
retina apoptotic process process quality, ameliorated AB + MO1-znf644b + MO4-tp53 standard conditions Fig. 5 with image from Olsen et al., 2016
post-vent region decreased size, abnormal AB + MO2-bcl11aa + MO4-tp53 standard conditions Fig. 7 from Bagheri et al., 2016
trunk morphology, abnormal AB + MO2-bcl11aa + MO4-tp53 standard conditions Fig. 6 from Bagheri et al., 2016
eye decreased size, abnormal AB + MO2-bcl11aa + MO4-tp53 standard conditions Fig. 7 from Bagheri et al., 2016
brain decreased volume, abnormal AB + MO2-bcl11aa + MO4-tp53 standard conditions Fig. 8 from Bagheri et al., 2016
head morphology, abnormal AB + MO2-bcl11aa + MO4-tp53 standard conditions Fig. 6 from Bagheri et al., 2016
brain development disrupted, abnormal AB + MO2-bcl11aa + MO4-tp53 standard conditions Fig. 8 from Bagheri et al., 2016
fin decreased size, abnormal AB + MO2-bcl11aa + MO4-tp53 standard conditions Fig. 7 from Bagheri et al., 2016
otic vesicle decreased size, abnormal AB + MO2-bcl11aa + MO4-tp53 standard conditions Fig. 7 from Bagheri et al., 2016
ventricular system lumenized, abnormal AB + MO2-cldn5a + MO4-tp53 standard conditions Fig. 3 with image from Zhang et al., 2010
fourth ventricle decreased volume, abnormal AB + MO2-cldn5a + MO4-tp53 standard conditions Fig. 3 with image from Zhang et al., 2010
ventricular system development disrupted, abnormal AB + MO2-cldn5a + MO4-tp53 standard conditions Fig. 3 with image from Zhang et al., 2010
tectal ventricle decreased volume, abnormal AB + MO2-cldn5a + MO4-tp53 standard conditions Fig. 3 with image from Zhang et al., 2010
orbit edematous, abnormal AB + MO2-coq8b + MO4-tp53 standard conditions Fig. S1 from Ashraf et al., 2013
whole organism edematous, abnormal AB + MO2-coq8b + MO4-tp53 standard conditions Fig. S1 from Ashraf et al., 2013
dorsal telencephalon morphology, abnormal AB + MO2-emx3 + MO3-emx3 + MO4-tp53 heat shock Fig. 6 with image from Viktorin et al., 2009
epibranchial ganglion decreased amount, abnormal AB + MO2-fgf24 + MO4-tp53 standard conditions Fig. 7 with image from Padanad et al., 2011
podocyte cell projection absent, abnormal AB + MO2-kank2 + MO4-tp53 standard conditions Fig. S5 from Gee et al., 2015
whole organism edematous, abnormal AB + MO2-kank2 + MO4-tp53 standard conditions Fig. 4 from Gee et al., 2015
glomerular basement membrane disorganized, abnormal AB + MO2-kank2 + MO4-tp53 standard conditions Fig. S5 from Gee et al., 2015
podocyte disorganized, abnormal AB + MO2-kank2 + MO4-tp53 standard conditions Fig. S5 from Gee et al., 2015
eye edematous, abnormal AB + MO2-kank2 + MO4-tp53 standard conditions Fig. 4 from Gee et al., 2015
apoptotic process increased process quality, abnormal AB + MO2-msrb3 + MO4-tp53 control Fig. 5 with image from Shen et al., 2015
epiboly process quality, abnormal AB + MO2-prmt6 + MO4-tp53 standard conditions Fig. 2 from Zhao et al., 2016
anatomical structure gadd45aa expression increased amount, abnormal AB + MO2-prmt6 + MO4-tp53 standard conditions Fig. 4 from Zhao et al., 2016
anatomical structure tp53 expression increased amount, abnormal AB + MO2-prmt6 + MO4-tp53 standard conditions Fig. 4 from Zhao et al., 2016
apoptotic process process quality, abnormal AB + MO2-prmt6 + MO4-tp53 standard conditions Fig. 4 from Zhao et al., 2016
anatomical structure ab12-tp53 labeling amount, ameliorated AB + MO2-prmt6 + MO4-tp53 standard conditions Fig. 2 from Zhao et al., 2016
anatomical structure cdkn1a expression increased amount, abnormal AB + MO2-prmt6 + MO4-tp53 standard conditions Fig. 4 from Zhao et al., 2016
anatomical structure jun expression increased amount, abnormal AB + MO2-prmt6 + MO4-tp53 standard conditions Fig. 4 from Zhao et al., 2016
heart morphology, abnormal AB + MO2-sap30l + MO4-tp53 standard conditions text only from Teittinen et al., 2012
heart contraction decreased efficiency, abnormal AB + MO2-sap30l + MO4-tp53 standard conditions text only from Teittinen et al., 2012
heart contraction decreased rate, abnormal AB + MO2-sap30l + MO4-tp53 standard conditions text only from Teittinen et al., 2012
heart looping disrupted, abnormal AB + MO2-sap30l + MO4-tp53 standard conditions text only from Teittinen et al., 2012
intermediate cell mass of mesoderm gata1a expression decreased amount, abnormal AB + MO2-sparc + MO4-tp53 control Fig. 6 from Ceinos et al., 2013
otolith decreased amount, abnormal AB + MO2-tgfb1a + MO4-tp53 standard conditions Fig. 10 from Turpeinen et al., 2013
heart decreased functionality, abnormal AB + MO2-vdrb + MO4-tp53 standard conditions Fig. 2 from Kwon, 2016
pericardium edematous, abnormal AB + MO2-vdrb + MO4-tp53 standard conditions Fig. 1 from Kwon, 2016
brain apoptotic process increased occurrence, abnormal AB + MO3-brd2a + MO4-tp53 standard conditions Fig. 12 with image from Murphy et al., 2017
brain cell death increased occurrence, abnormal AB + MO3-brd2a + MO4-tp53 standard conditions Fig. 6 with image from Murphy et al., 2017
brain structure, abnormal AB + MO3-brd2a + MO4-tp53 standard conditions Fig. 6 with image from Murphy et al., 2017
midbrain hindbrain boundary posterior region en2a expression decreased distribution, abnormal AB + MO3-brd2a + MO4-tp53 standard conditions Fig. 12 with image from Murphy et al., 2017
central nervous system cell death increased occurrence, abnormal AB + MO3-brd2a + MO4-tp53 standard conditions Fig. 6 with image from Murphy et al., 2017
whole organism decreased mobility, abnormal AB + MO3-ca8 + MO4-tp53 standard conditions Fig. 9 from Huang et al., 2014
thigmotaxis disrupted, abnormal AB + MO3-ca8 + MO4-tp53 standard conditions Fig. 9 from Huang et al., 2014
whole organism edematous, abnormal AB + MO3-coq8b + MO4-tp53 standard conditions Fig. 2 from Ashraf et al., 2013
orbit edematous, abnormal AB + MO3-coq8b + MO4-tp53 standard conditions Fig. 2 from Ashraf et al., 2013
eye edematous, abnormal AB + MO3-lrrk2 + MO4-tp53 standard conditions Fig. 3 with image from Prabhudesai et al., 2016
post-vent region bent, abnormal AB + MO3-lrrk2 + MO4-tp53 standard conditions Fig. 3 with image from Prabhudesai et al., 2016
presumptive cephalic mesoderm gene expression disrupted, abnormal AB + MO3-myf5 + MO4-tp53 standard conditions Fig. 4 from Lin et al., 2013
pharyngeal arch 3-7 skeleton absent, abnormal AB + MO3-myf5 + MO4-tp53 standard conditions Fig. 5 from Lin et al., 2013
pharyngeal arch 5 has fewer parts of type chondroblast, abnormal AB + MO3-myf5 + MO4-tp53 standard conditions Fig. 5 from Lin et al., 2013
Meckel's cartilage malformed, abnormal AB + MO3-myf5 + MO4-tp53 standard conditions Fig. 5 from Lin et al., 2013
pharyngeal arch 6 absent, abnormal AB + MO3-myf5 + MO4-tp53 standard conditions Fig. 2 from Lin et al., 2013
pharyngeal arch 6 has fewer parts of type chondroblast, abnormal AB + MO3-myf5 + MO4-tp53 standard conditions Fig. 5 from Lin et al., 2013
palatoquadrate cartilage malformed, abnormal AB + MO3-myf5 + MO4-tp53 standard conditions Fig. 5 from Lin et al., 2013
ceratobranchial cartilage absent, abnormal AB + MO3-myf5 + MO4-tp53 standard conditions Fig. 5 from Lin et al., 2013
neuroectoderm neural crest cell decreased amount, abnormal AB + MO3-myf5 + MO4-tp53 standard conditions Fig. 4 from Lin et al., 2013
pharyngeal arch 6 has fewer parts of type cranial neural crest, abnormal AB + MO3-myf5 + MO4-tp53 standard conditions Fig. 5 from Lin et al., 2013
pharyngeal arch 3 has fewer parts of type chondroblast, abnormal AB + MO3-myf5 + MO4-tp53 standard conditions Fig. 2 from Lin et al., 2013
pharyngeal arch 5 has fewer parts of type cranial neural crest, abnormal AB + MO3-myf5 + MO4-tp53 standard conditions Fig. 5 from Lin et al., 2013
ceratohyal cartilage malformed, abnormal AB + MO3-myf5 + MO4-tp53 standard conditions Fig. 5 from Lin et al., 2013
pharyngeal arch 5 absent, abnormal AB + MO3-myf5 + MO4-tp53 standard conditions Fig. 2 from Lin et al., 2013
blood vessel endothelial cell adherens junction immature, abnormal AB + MO3-ptprb + MO4-tp53 standard conditions Fig. S5 with image from Carra et al., 2012
blood vessel endothelial cell has fewer parts of type blood vessel endothelial cell cell-cell junction, abnormal AB + MO3-ptprb + MO4-tp53 standard conditions Fig. S5 with image from Carra et al., 2012
adherens junction assembly disrupted, abnormal AB + MO3-ptprb + MO4-tp53 standard conditions Fig. S5 with image from Carra et al., 2012
eye decreased size, abnormal AB + MO3-rel + MO4-tp53 standard conditions Fig. 7 from Bagheri et al., 2016
trunk morphology, abnormal AB + MO3-rel + MO4-tp53 standard conditions Fig. 6Fig. 7 from Bagheri et al., 2016
fin decreased size, abnormal AB + MO3-rel + MO4-tp53 standard conditions Fig. 7 from Bagheri et al., 2016
trunk curved, abnormal AB + MO3-rel + MO4-tp53 standard conditions Fig. 7 from Bagheri et al., 2016
head decreased size, abnormal AB + MO3-rel + MO4-tp53 standard conditions Fig. 7 from Bagheri et al., 2016
head morphology, abnormal AB + MO3-rel + MO4-tp53 standard conditions Fig. 6 from Bagheri et al., 2016
whole organism increased curvature, abnormal AB + MO4-masp1 + MO4-tp53 standard conditions Fig. 2 from Mortensen et al., 2017
pectoral fin development disrupted, abnormal AB + MO4-masp1 + MO4-tp53 standard conditions Fig. 2 from Mortensen et al., 2017
pigmentation process quality, abnormal AB + MO4-masp1 + MO4-tp53 standard conditions Fig. 2 from Mortensen et al., 2017
embryo development ending in birth or egg hatching delayed, abnormal AB + MO4-masp1 + MO4-tp53 standard conditions Fig. 2 from Mortensen et al., 2017
pericardium edematous, abnormal AB + MO4-masp1 + MO4-tp53 standard conditions Fig. 2 from Mortensen et al., 2017
brain edematous, abnormal AB + MO4-masp1 + MO4-tp53 standard conditions Fig. 2 from Mortensen et al., 2017
post-vent region decreased length, abnormal AB + MO4-tp53 + MO5-cav1 standard conditions Fig. 2 with image from Mo et al., 2010
notochord deformed, abnormal AB + MO4-tp53 + MO5-cav1 standard conditions Fig. 2 with image from Mo et al., 2010
trunk curved, abnormal AB + MO4-tp53 + MO5-cav1 standard conditions Fig. 2 with image from Mo et al., 2010
somite deformed, abnormal AB + MO4-tp53 + MO5-cav1 standard conditions Fig. 2 with image from Mo et al., 2010
optic fissure closure incomplete, abnormal AB + MO4-tp53 + MO5-gdf6a standard conditions Fig. 3 from Asai-Coakwell et al., 2009
eye decreased size, abnormal AB + MO4-tp53 + MO5-gdf6a standard conditions Fig. 3 from Asai-Coakwell et al., 2009
post-vent region kinked, abnormal AB + MO4-tp53 + MO5-gdf6a standard conditions Fig. 3 from Asai-Coakwell et al., 2009
trigeminal ganglion axon arborization disrupted, abnormal AB + MO4-tp53 + MO5-mecp2 standard conditions Fig. 2 with image from Leong et al., 2015
trigeminal ganglion axon branchiness, abnormal AB + MO4-tp53 + MO5-mecp2 standard conditions Fig. 2 with image from Leong et al., 2015
trunk curved lateral, abnormal AB + MO4-tp53 + MO5-slc16a2 standard conditions Fig. 3 from Campinho et al., 2014
brain development disrupted, abnormal AB + MO4-tp53 + MO5-slc16a2 standard conditions Fig. 3 from Campinho et al., 2014
apoptotic process increased occurrence, abnormal AB + MO4-tp53 + MO5-slc16a2 standard conditions Fig. 3 from Campinho et al., 2014
notochord deformed, abnormal AB + MO4-tp53 + MO6-cav1 standard conditions Fig. 2 with image from Mo et al., 2010
somite deformed, abnormal AB + MO4-tp53 + MO6-cav1 standard conditions Fig. 2 with image from Mo et al., 2010
trunk curved, abnormal AB + MO4-tp53 + MO6-cav1 standard conditions Fig. 2 with image from Mo et al., 2010
post-vent region decreased length, abnormal AB + MO4-tp53 + MO6-cav1 standard conditions Fig. 2 with image from Mo et al., 2010
eye edematous, abnormal AB + MO4-tp53 + MO7-lrrk2 standard conditions Fig. 3 with image from Prabhudesai et al., 2016
post-vent region bent, abnormal AB + MO4-tp53 + MO7-lrrk2 standard conditions Fig. 3 with image from Prabhudesai et al., 2016
cranial cartilage decreased size, abnormal AB/TL + MO1-fto + MO4-tp53 standard conditions Fig. 1 with image from Osborn et al., 2014
whole organism curved ventral, abnormal AB/TL + MO1-srrm4 + MO4-tp53 standard conditions Fig. 6 with image from Calarco et al., 2009
ventricular system increased volume, abnormal AB/TL + MO1-srrm4 + MO4-tp53 standard conditions Fig. 6 with image from Calarco et al., 2009
larval locomotory behavior process quality, abnormal AB/TU + MO1-cables1 + MO4-tp53 standard conditions Fig. 4 from Groeneweg et al., 2011
brain apoptotic, abnormal AB/TU + MO1-cables1 + MO4-tp53 standard conditions Fig. 3 from Groeneweg et al., 2011
notochord development delayed, abnormal AB/TU + MO1-igf2a + MO2-igf2a + MO4-tp53 standard conditions Fig. 4 from White et al., 2009
somite specification disrupted, abnormal AB/TU + MO1-igf2a + MO2-igf2a + MO4-tp53 standard conditions Fig. 4 from White et al., 2009
notochord undulate, abnormal AB/TU + MO1-igf2a + MO2-igf2a + MO4-tp53 standard conditions Fig. 4 from White et al., 2009
trunk has fewer parts of type somite, abnormal AB/TU + MO1-igf2a + MO2-igf2a + MO4-tp53 standard conditions Fig. 4 from White et al., 2009
post-vent region kinked, abnormal AB/TU + MO1-inpp5e + MO4-tp53 standard conditions Fig. 2 with image from Luo et al., 2012
whole organism anatomical axis asymmetrical, abnormal AB/TU + MO1-inpp5e + MO4-tp53 standard conditions Fig. 2 with image from Luo et al., 2012
pronephros cystic, abnormal AB/TU + MO1-inpp5e + MO4-tp53 standard conditions Fig. 2 with image from Luo et al., 2012
whole organism decreased pigmentation, abnormal AB/TU + MO1-inpp5e + MO4-tp53 standard conditions Fig. 2 with image from Luo et al., 2012
retina development in camera-type eye disrupted, abnormal AB/TU + MO1-inpp5e + MO4-tp53 standard conditions Fig. 2 with image from Luo et al., 2012
pericardium edematous, abnormal AB/TU + MO1-inpp5e + MO4-tp53 standard conditions Fig. 2 with image from Luo et al., 2012
retina disorganized, abnormal AB/TU + MO1-inpp5e + MO4-tp53 standard conditions Fig. 2 with image from Luo et al., 2012
eye decreased size, abnormal AB/TU + MO1-inpp5e + MO4-tp53 standard conditions Fig. 2 with image from Luo et al., 2012
atrium cardiac conduction decreased velocity, abnormal AB/TU + MO1-rnf207b + MO4-tp53 standard conditions Fig. 3 from Roder et al., 2014
cardiac ventricle cardiac conduction decreased velocity, abnormal AB/TU + MO1-rnf207b + MO4-tp53 standard conditions Fig. 3 from Roder et al., 2014
heart contraction process quality, abnormal AB/TU + MO1-rnf207b + MO4-tp53 standard conditions text only from Roder et al., 2014
atrial myocardium action potential increased duration, abnormal AB/TU + MO1-rnf207b + MO4-tp53 standard conditions Fig. 2 from Roder et al., 2014
heart looping disrupted, abnormal AB/TU + MO1-rnf207b + MO4-tp53 standard conditions text only from Roder et al., 2014
ventricular myocardium action potential increased duration, abnormal AB/TU + MO1-rnf207b + MO4-tp53 standard conditions Fig. 2 from Roder et al., 2014
fourth ventricle increased size, abnormal AB/TU + MO1-tcf4 + MO2-tcf4 + MO4-tp53 standard conditions Fig. 4 from Brockschmidt et al., 2011
post-vent region curved, abnormal AB/TU + MO1-tcf4 + MO2-tcf4 + MO4-tp53 standard conditions Fig. 4Fig. 5 from Brockschmidt et al., 2011
embryo development delayed, abnormal AB/TU + MO1-tcf4 + MO2-tcf4 + MO4-tp53 standard conditions Fig. 4 from Brockschmidt et al., 2011
lens morphogenesis in camera-type eye delayed, abnormal AB/TU + MO1-tcf4 + MO2-tcf4 + MO4-tp53 standard conditions Fig. 5 from Brockschmidt et al., 2011
somite shape, abnormal AB/TU + MO2-igf2a + MO4-tp53 standard conditions text only from White et al., 2009
notochord undulate, abnormal AB/TU + MO2-igf2a + MO4-tp53 standard conditions text only from White et al., 2009
convergent extension involved in axis elongation delayed, abnormal AB/TU + MO2-igf2a + MO4-tp53 standard conditions text only from White et al., 2009
atrium cardiac conduction decreased velocity, abnormal AB/TU + MO2-rnf207b + MO4-tp53 standard conditions Fig. 3 from Roder et al., 2014
cardiac ventricle cardiac conduction decreased velocity, abnormal AB/TU + MO2-rnf207b + MO4-tp53 standard conditions Fig. 3 from Roder et al., 2014
heart contraction process quality, abnormal AB/TU + MO2-rnf207b + MO4-tp53 standard conditions text only from Roder et al., 2014
atrial myocardium action potential increased duration, abnormal AB/TU + MO2-rnf207b + MO4-tp53 standard conditions Fig. 2 from Roder et al., 2014
heart looping disrupted, abnormal AB/TU + MO2-rnf207b + MO4-tp53 standard conditions text only from Roder et al., 2014
ventricular myocardium action potential increased duration, abnormal AB/TU + MO2-rnf207b + MO4-tp53 standard conditions Fig. 2 from Roder et al., 2014
canonical Wnt signaling pathway decreased occurrence, abnormal AB/TU + MO4-tp53 + MO5-lbx2 + MO8-lbx2 control Fig. 2 from Lu et al., 2014
ventral mesoderm chrd expression mislocalised, abnormal AB/TU + MO4-tp53 + MO5-lbx2 + MO8-lbx2 standard conditions Fig. 1Fig. 5 from Lu et al., 2014
margin ventral region eve1 expression decreased amount, abnormal AB/TU + MO4-tp53 + MO5-lbx2 + MO8-lbx2 standard conditions Fig. 1 from Lu et al., 2014
caudal fin ventral region absent, abnormal AB/TU + MO4-tp53 + MO5-lbx2 + MO8-lbx2 standard conditions Fig. 1 from Lu et al., 2014
trunk posterior region absent, abnormal AB/TU + MO4-tp53 + MO5-lbx2 + MO8-lbx2 standard conditions Fig. 1 from Lu et al., 2014
axial mesoderm chrd expression increased amount, abnormal AB/TU + MO4-tp53 + MO5-lbx2 + MO8-lbx2 standard conditions Fig. 1 from Lu et al., 2014
whole organism wholly dorsalized, abnormal AB/TU + MO4-tp53 + MO5-lbx2 + MO8-lbx2 standard conditions Fig. 1 from Lu et al., 2014
whole organism elongated, abnormal AB/TU + MO4-tp53 + MO5-lbx2 + MO8-lbx2 standard conditions Fig. 1 from Lu et al., 2014
trunk ventral region absent, abnormal AB/TU + MO4-tp53 + MO5-lbx2 + MO8-lbx2 standard conditions Fig. 1 from Lu et al., 2014
margin ventral region eve1 expression decreased distribution, abnormal AB/TU + MO4-tp53 + MO5-lbx2 + MO8-lbx2 standard conditions Fig. 1 from Lu et al., 2014
presumptive ectoderm foxi1 expression decreased amount, abnormal AB/TU + MO4-tp53 + MO5-lbx2 + MO8-lbx2 standard conditions Fig. 1 from Lu et al., 2014
caudal fin posterior region absent, abnormal AB/TU + MO4-tp53 + MO5-lbx2 + MO8-lbx2 standard conditions Fig. 1 from Lu et al., 2014
presumptive ectoderm foxi1 expression decreased distribution, abnormal AB/TU + MO4-tp53 + MO5-lbx2 + MO8-lbx2 standard conditions Fig. 1 from Lu et al., 2014
axial mesoderm chrd expression increased distribution, abnormal AB/TU + MO4-tp53 + MO5-lbx2 + MO8-lbx2 standard conditions Fig. 1Fig. 5 from Lu et al., 2014
canonical Wnt signaling pathway decreased occurrence, abnormal AB/TU + MO4-tp53 + MO6-lbx2 + MO7-lbx2 control Fig. 2 from Lu et al., 2014
ventral mesoderm chrd expression mislocalised, abnormal AB/TU + MO4-tp53 + MO6-lbx2 + MO7-lbx2 standard conditions Fig. 1Fig. 5 from Lu et al., 2014
margin ventral region eve1 expression decreased amount, abnormal AB/TU + MO4-tp53 + MO6-lbx2 + MO7-lbx2 standard conditions Fig. 1 from Lu et al., 2014
caudal fin ventral region absent, abnormal AB/TU + MO4-tp53 + MO6-lbx2 + MO7-lbx2 standard conditions Fig. 1 from Lu et al., 2014
trunk posterior region absent, abnormal AB/TU + MO4-tp53 + MO6-lbx2 + MO7-lbx2 standard conditions Fig. 1 from Lu et al., 2014
axial mesoderm chrd expression increased amount, abnormal AB/TU + MO4-tp53 + MO6-lbx2 + MO7-lbx2 standard conditions Fig. 1 from Lu et al., 2014
whole organism wholly dorsalized, abnormal AB/TU + MO4-tp53 + MO6-lbx2 + MO7-lbx2 standard conditions Fig. 1 from Lu et al., 2014
whole organism elongated, abnormal AB/TU + MO4-tp53 + MO6-lbx2 + MO7-lbx2 standard conditions Fig. 1 from Lu et al., 2014
trunk ventral region absent, abnormal AB/TU + MO4-tp53 + MO6-lbx2 + MO7-lbx2 standard conditions Fig. 1 from Lu et al., 2014
margin ventral region eve1 expression decreased distribution, abnormal AB/TU + MO4-tp53 + MO6-lbx2 + MO7-lbx2 standard conditions Fig. 1 from Lu et al., 2014
presumptive ectoderm foxi1 expression decreased amount, abnormal AB/TU + MO4-tp53 + MO6-lbx2 + MO7-lbx2 standard conditions Fig. 1 from Lu et al., 2014
caudal fin posterior region absent, abnormal AB/TU + MO4-tp53 + MO6-lbx2 + MO7-lbx2 standard conditions Fig. 1 from Lu et al., 2014
presumptive ectoderm foxi1 expression decreased distribution, abnormal AB/TU + MO4-tp53 + MO6-lbx2 + MO7-lbx2 standard conditions Fig. 1 from Lu et al., 2014
axial mesoderm chrd expression increased distribution, abnormal AB/TU + MO4-tp53 + MO6-lbx2 + MO7-lbx2 standard conditions Fig. 1Fig. 5 from Lu et al., 2014
whole organism dead, abnormal TL + MO1-asrgl1 + MO4-tp53 standard conditions Table 4 from Biswas et al., 2016
whole organism decreased length, abnormal TL + MO1-asrgl1 + MO4-tp53 standard conditions Table 4 from Biswas et al., 2016
whole organism decreased life span, abnormal TL + MO1-asrgl1 + MO4-tp53 standard conditions Table 4 from Biswas et al., 2016
whole organism deformed, abnormal TL + MO1-asrgl1 + MO4-tp53 standard conditions Table 4 from Biswas et al., 2016
optic tectum regulation of neuronal action potential disrupted, abnormal TL + MO1-cln3 + MO4-tp53 standard conditions Fig. 4 from Wager et al., 2016
whole organism dead, abnormal TL + MO2-asrgl1 + MO4-tp53 standard conditions Table 4 from Biswas et al., 2016
whole organism decreased length, abnormal TL + MO2-asrgl1 + MO4-tp53 standard conditions Table 4 from Biswas et al., 2016
whole organism decreased life span, abnormal TL + MO2-asrgl1 + MO4-tp53 standard conditions Table 4 from Biswas et al., 2016
whole organism deformed, abnormal TL + MO2-asrgl1 + MO4-tp53 standard conditions Table 4 from Biswas et al., 2016
pectoral fin decreased size, abnormal TL + MO3-fgf16 + MO4-tp53 standard conditions text only from Laurell et al., 2014
pericardium edematous, abnormal TL + MO3-fgf16 + MO4-tp53 standard conditions text only from Laurell et al., 2014
pectoral fin development disrupted, abnormal TL + MO3-fgf16 + MO4-tp53 standard conditions text only from Laurell et al., 2014
whole organism morphology, abnormal TL + MO3-fgf16 + MO4-tp53 standard conditions text only from Laurell et al., 2014
pectoral fin decreased size, abnormal TL + MO4-fgf16 + MO4-tp53 standard conditions text only from Laurell et al., 2014
whole organism morphology, abnormal TL + MO4-fgf16 + MO4-tp53 standard conditions text only from Laurell et al., 2014
pectoral fin development disrupted, abnormal TL + MO4-fgf16 + MO4-tp53 standard conditions text only from Laurell et al., 2014
pericardium edematous, abnormal TL + MO4-fgf16 + MO4-tp53 standard conditions text only from Laurell et al., 2014
post-vent region curved dorsal, abnormal TU + MO1-atp1a2a + MO4-tp53 standard conditions Fig. 2 with image from Doganli et al., 2012
pericardium edematous, abnormal TU + MO1-atp1a2a + MO4-tp53 standard conditions Fig. 2 with image from Doganli et al., 2012
somite morphology, abnormal TU + MO1-atp1a2a + MO4-tp53 standard conditions Fig. 2 with image from Doganli et al., 2012
ventricular system dilated, abnormal TU + MO1-atp1a3a + MO4-tp53 standard conditions Fig. 2 from Doganli et al., 2013
cell division disrupted, abnormal TU + MO1-dync1li1 + MO4-tp53 standard conditions Fig. 6 with image from Mahale et al., 2016
blastodisc furrowed, abnormal TU + MO1-dync1li1 + MO4-tp53 standard conditions Fig. 6 with image from Mahale et al., 2016
embryo development ending in birth or egg hatching decreased process quality, abnormal TU + MO1-dync1li1 + MO4-tp53 standard conditions Fig. 6 with image from Mahale et al., 2016
mitotic cell cycle disrupted, abnormal TU + MO1-dync1li1 + MO4-tp53 standard conditions Fig. 6 with image from Mahale et al., 2016
cell division disrupted, abnormal TU + MO1-dync1li2 + MO4-tp53 standard conditions Fig. 6 with image from Mahale et al., 2016
blastodisc furrowed, abnormal TU + MO1-dync1li2 + MO4-tp53 standard conditions Fig. 6 with image from Mahale et al., 2016
embryo development ending in birth or egg hatching decreased process quality, abnormal TU + MO1-dync1li2 + MO4-tp53 standard conditions Fig. 6 with image from Mahale et al., 2016
mitotic cell cycle disrupted, abnormal TU + MO1-dync1li2 + MO4-tp53 standard conditions Fig. 6 with image from Mahale et al., 2016
post-vent region curved, abnormal TU + MO1-slc8a4a + MO4-tp53 standard conditions Fig. 2 with image from Doganli et al., 2012
pericardium edematous, abnormal TU + MO1-slc8a4a + MO4-tp53 standard conditions Fig. 2 with image from Doganli et al., 2012
heart contraction decreased rate, abnormal TU + MO1-slc8a4a + MO4-tp53 standard conditions Fig. 2 with image from Doganli et al., 2012
trunk decreased length, abnormal TU + MO1-stk36 + MO4-tp53 standard conditions Fig. 7 with image from Xia et al., 2010
whole organism wholly dorsalized, abnormal TU + MO1-stk36 + MO4-tp53 standard conditions Fig. 7 with image from Xia et al., 2010
eye development process quality, abnormal TU + MO1-upf1 + MO4-tp53 standard conditions Fig. S3 from Wittkopp et al., 2009
somitogenesis process quality, abnormal TU + MO1-upf1 + MO4-tp53 standard conditions Fig. S3 from Wittkopp et al., 2009
extension disorganized, abnormal TU + MO1-upf1 + MO4-tp53 standard conditions Fig. S3 from Wittkopp et al., 2009
central nervous system necrotic, abnormal TU + MO1-upf1 + MO4-tp53 standard conditions Fig. S3 from Wittkopp et al., 2009
whole organism posterior region ab1-casp3 labeling decreased amount, abnormal TU + MO1-wnt8a + MO2-wnt8a + MO4-tp53 standard conditions Fig. 4 with image from Naylor et al., 2017
apoptotic process decreased occurrence, abnormal TU + MO1-wnt8a + MO2-wnt8a + MO4-tp53 standard conditions Fig. 4 with image from Naylor et al., 2017
pronephric tubule slc12a3 expression decreased amount, abnormal TU + MO1-wnt8a + MO2-wnt8a + MO4-tp53 standard conditions Fig. 4 with image from Naylor et al., 2017
ventricular system dilated, abnormal TU + MO2-atp1a3a + MO4-tp53 standard conditions Fig. 2 from Doganli et al., 2013
ventricular system dilated, abnormal TU + MO2-atp1a3b + MO4-tp53 standard conditions Fig. 3 from Doganli et al., 2013
neural crest dlx2a expression decreased amount, abnormal TU + MO2-bmp5 + MO4-tp53 standard conditions Fig. 2 from Shih et al., 2017
neural crest cell proliferation decreased occurrence, abnormal TU + MO2-bmp5 + MO4-tp53 standard conditions Fig. 2 from Shih et al., 2017
anatomical structure sox10 expression decreased amount, abnormal TU + MO2-bmp5 + MO4-tp53 standard conditions Fig. 2 from Shih et al., 2017
anatomical structure dlx2a expression decreased amount, abnormal TU + MO2-bmp5 + MO4-tp53 standard conditions Fig. 2 from Shih et al., 2017
neural crest sox10 expression decreased amount, abnormal TU + MO2-bmp5 + MO4-tp53 standard conditions Fig. 2 from Shih et al., 2017
neural crest apoptotic process increased occurrence, abnormal TU + MO2-bmp5 + MO4-tp53 standard conditions Fig. 2 from Shih et al., 2017
neural crest cell development decreased occurrence, abnormal TU + MO2-bmp5 + MO4-tp53 standard conditions Fig. 2 from Shih et al., 2017
whole organism posterior region ab1-casp3 labeling decreased amount, abnormal TU + MO4-tp53 standard conditions Fig. 4 with image from Naylor et al., 2017
apoptotic process decreased occurrence, abnormal TU + MO4-tp53 standard conditions Fig. 4 with image from Naylor et al., 2017
head decreased size, abnormal WT + MO1-adarb1a + MO4-tp53 standard conditions Fig. 3 with image from Li et al., 2014
parachordal cartilage decreased size, abnormal WT + MO1-adarb1a + MO4-tp53 standard conditions Fig. 7 with image from Li et al., 2014
anterior lateral line neuromast decreased amount, abnormal WT + MO1-adarb1a + MO4-tp53 standard conditions Fig. 6 with image from Li et al., 2014
neurocranial trabecula decreased size, abnormal WT + MO1-adarb1a + MO4-tp53 standard conditions Fig. 7 with image from Li et al., 2014
third ventricle increased size, abnormal WT + MO1-adarb1a + MO4-tp53 standard conditions Fig. 3 with image from Li et al., 2014
cranial cartilage malformed, abnormal WT + MO1-adarb1a + MO4-tp53 standard conditions Fig. 7 with image from Li et al., 2014
fourth ventricle increased size, abnormal WT + MO1-adarb1a + MO4-tp53 standard conditions Fig. 3 with image from Li et al., 2014
ethmoid cartilage absent, abnormal WT + MO1-adarb1a + MO4-tp53 standard conditions Fig. 7 with image from Li et al., 2014
posterior lateral line neuromast decreased amount, abnormal WT + MO1-adarb1a + MO4-tp53 standard conditions Fig. 6 with image from Li et al., 2014
pharyngeal arch absent, abnormal WT + MO1-adarb1a + MO4-tp53 standard conditions Fig. 7 with image from Li et al., 2014
cornea increased thickness, abnormal WT + MO1-aldh1a2 + MO4-tp53 standard conditions Fig. 8 from Bohnsack et al., 2012
corneal epithelium scalloped, abnormal WT + MO1-aldh1a2 + MO4-tp53 standard conditions Fig. 8 from Bohnsack et al., 2012
photoreceptor outer segment layer absent, abnormal WT + MO1-aldh1a2 + MO4-tp53 standard conditions Fig. 8 from Bohnsack et al., 2012
head anterior-posterior axis decreased length, abnormal WT + MO1-aldh1a2 + MO4-tp53 standard conditions Fig. 8 from Bohnsack et al., 2012
medial rectus myofibril disorganized, abnormal WT + MO1-aldh1a2 + MO4-tp53 standard conditions Fig. 8 from Bohnsack et al., 2012
lens decreased size, abnormal WT + MO1-aldh1a2 + MO4-tp53 standard conditions Fig. 8 from Bohnsack et al., 2012
retinal outer plexiform layer disorganized, abnormal WT + MO1-aldh1a2 + MO4-tp53 standard conditions Fig. 8 from Bohnsack et al., 2012
mandibular arch skeleton malformed, abnormal WT + MO1-aldh1a2 + MO4-tp53 standard conditions Fig. 8 from Bohnsack et al., 2012
pectoral fin absent, abnormal WT + MO1-aldh1a2 + MO4-tp53 standard conditions Fig. 8 from Bohnsack et al., 2012
corneal endothelium absent, abnormal WT + MO1-aldh1a2 + MO4-tp53 standard conditions Fig. 8 from Bohnsack et al., 2012
lens morphology, abnormal WT + MO1-aldh1a2 + MO4-tp53 standard conditions Fig. 8 from Bohnsack et al., 2012
pigmentation delayed, abnormal WT + MO1-ambra1a + MO4-tp53 standard conditions Fig. 6 from Benato et al., 2013
embryo development disrupted, abnormal WT + MO1-ambra1a + MO4-tp53 standard conditions Fig. 6 from Benato et al., 2013
otolith decreased size, abnormal WT + MO1-ambra1a + MO4-tp53 standard conditions Fig. 6 from Benato et al., 2013
eye decreased size, abnormal WT + MO1-ambra1a + MO4-tp53 standard conditions Fig. 6 from Benato et al., 2013
post-vent region kinked, abnormal WT + MO1-ambra1a + MO4-tp53 standard conditions Fig. 6 from Benato et al., 2013
whole organism deformed, abnormal WT + MO1-ambra1a + MO4-tp53 standard conditions Fig. 6 from Benato et al., 2013
head decreased size, abnormal WT + MO1-ambra1a + MO4-tp53 standard conditions Fig. 6 from Benato et al., 2013
trunk decreased size, abnormal WT + MO1-ambra1a + MO4-tp53 standard conditions Fig. 6 from Benato et al., 2013
post-vent region kinked, abnormal WT + MO1-ambra1b + MO4-tp53 standard conditions Fig. 6 from Benato et al., 2013
whole organism deformed, abnormal WT + MO1-ambra1b + MO4-tp53 standard conditions Fig. 6 from Benato et al., 2013
pigmentation delayed, abnormal WT + MO1-ambra1b + MO4-tp53 standard conditions Fig. 6 from Benato et al., 2013
head decreased size, abnormal WT + MO1-ambra1b + MO4-tp53 standard conditions Fig. 6 from Benato et al., 2013
embryo development disrupted, abnormal WT + MO1-ambra1b + MO4-tp53 standard conditions Fig. 6 from Benato et al., 2013
eye decreased size, abnormal WT + MO1-ambra1b + MO4-tp53 standard conditions Fig. 6 from Benato et al., 2013
otolith decreased size, abnormal WT + MO1-ambra1b + MO4-tp53 standard conditions Fig. 6 from Benato et al., 2013
trunk decreased size, abnormal WT + MO1-ambra1b + MO4-tp53 standard conditions Fig. 6 from Benato et al., 2013
heart development disrupted, abnormal WT + MO1-apln + MO4-tp53 standard conditions Fig. S4 from Zeng et al., 2007
apoptotic process decreased occurrence, abnormal WT + MO1-apln + MO4-tp53 standard conditions Fig. S4 from Zeng et al., 2007
embryonic heart tube elongation disrupted, abnormal WT + MO1-atp1a1a.1 + MO4-tp53 standard conditions Fig. 5 with image from Langenbacher et al., 2012
embryonic heart tube formation disrupted, abnormal WT + MO1-atp1a1a.1 + MO4-tp53 standard conditions Fig. 5 with image from Langenbacher et al., 2012
somite U-shaped, abnormal WT + MO1-b3galnt2 + MO4-tp53 standard conditions Fig. 5 from Stevens et al., 2013
whole organism decreased mobility, abnormal WT + MO1-b3galnt2 + MO4-tp53 standard conditions Fig. 5 from Stevens et al., 2013
myoseptum partially broken, abnormal WT + MO1-b3galnt2 + MO4-tp53 standard conditions Fig. 5 from Stevens et al., 2013
skeletal muscle cell disorganized, abnormal WT + MO1-b3galnt2 + MO4-tp53 standard conditions Fig. 5 from Stevens et al., 2013
muscle damaged, abnormal WT + MO1-b3galnt2 + MO4-tp53 standard conditions Fig. 5 from Stevens et al., 2013
whole organism curved, abnormal WT + MO1-b3galnt2 + MO4-tp53 standard conditions Fig. 5 from Stevens et al., 2013
brain hydrocephalic, abnormal WT + MO1-b3galnt2 + MO4-tp53 standard conditions Fig. 5 from Stevens et al., 2013
retina degeneration, abnormal WT + MO1-b3galnt2 + MO4-tp53 standard conditions Fig. 5 from Stevens et al., 2013
anterior/posterior axis specification disrupted, abnormal WT + MO1-bcl2l16 + MO4-tp53 standard conditions Fig. 3 from Prudent et al., 2013
somite morphology, abnormal WT + MO1-bcl2l16 + MO4-tp53 standard conditions Fig. 3 from Prudent et al., 2013
whole organism anterior-posterior axis shortened, abnormal WT + MO1-bcl2l16 + MO4-tp53 standard conditions Fig. S4 from Prudent et al., 2013
cell migration involved in gastrulation disrupted, abnormal WT + MO1-bcl2l16 + MO4-tp53 standard conditions Fig. 4 from Prudent et al., 2013
pectoral fin morphology, abnormal WT + MO1-bcl2l16 + MO4-tp53 standard conditions Fig. S4 from Prudent et al., 2013
embryo development disrupted, abnormal WT + MO1-bcl2l16 + MO4-tp53 standard conditions Fig. 3 from Prudent et al., 2013
actin polymerization or depolymerization process quality, abnormal WT + MO1-bcl2l16 + MO4-tp53 standard conditions Fig. 5 from Prudent et al., 2013
somite filamentous actin deformed, abnormal WT + MO1-bcl2l16 + MO4-tp53 standard conditions Fig. S4 from Prudent et al., 2013
notochord bent, abnormal WT + MO1-bcl2l16 + MO4-tp53 standard conditions Fig. 3 from Prudent et al., 2013
regulation of cytosolic calcium ion concentration disrupted, abnormal WT + MO1-bcl2l16 + MO4-tp53 standard conditions Fig. 7 from Prudent et al., 2013
mesodermal cell filamentous actin oriented, abnormal WT + MO1-bcl2l16 + MO4-tp53 standard conditions Fig. 5 from Prudent et al., 2013
cell cycle rate, abnormal WT + MO1-c1ql4l + MO4-tp53 standard conditions Fig. 6 with image from Mei et al., 2008
midbrain hindbrain boundary increased angle to midbrain hindbrain boundary, abnormal WT + MO1-calm1a + MO4-tp53 standard conditions Fig. 5 with image from Sahu et al., 2017
midbrain hindbrain boundary cell increased length, abnormal WT + MO1-calm1a + MO4-tp53 standard conditions Fig. 5 with image from Sahu et al., 2017
midbrain hindbrain boundary ab1-myl-ser19-p labeling decreased amount, abnormal WT + MO1-calm1a + MO4-tp53 standard conditions Fig. 5 with image from Sahu et al., 2017
midbrain elongated, abnormal WT + MO1-camk2n1a + MO4-tp53 standard conditions Fig. S2 with image from Hsu et al., 2010
ventricular system decreased size, abnormal WT + MO1-camk2n1a + MO4-tp53 standard conditions Fig. S2 with image from Hsu et al., 2010
optic tectum increased size, abnormal WT + MO1-camk2n1a + MO4-tp53 standard conditions Fig. S2 with image from Hsu et al., 2010
somitogenesis disrupted, abnormal WT + MO1-camk2n1a + MO4-tp53 standard conditions Fig. S2 with image from Hsu et al., 2010
whole organism decreased length, abnormal WT + MO1-camk2n1a + MO4-tp53 standard conditions Fig. S2 with image from Hsu et al., 2010
pericardium edematous, abnormal WT + MO1-camk2n1a + MO4-tp53 standard conditions Fig. S2 with image from Hsu et al., 2010
midbrain hindbrain boundary decreased size, abnormal WT + MO1-camk2n1a + MO4-tp53 standard conditions Fig. S2 with image from Hsu et al., 2010
brain morphogenesis disrupted, abnormal WT + MO1-camk2n1a + MO4-tp53 standard conditions Fig. S2 with image from Hsu et al., 2010
eye decreased size, abnormal WT + MO1-camk2n2 + MO4-tp53 standard conditions Fig. S2 with image from Hsu et al., 2010
head decreased size, abnormal WT + MO1-camk2n2 + MO4-tp53 standard conditions Fig. S2 with image from Hsu et al., 2010
post-vent region kinked, abnormal WT + MO1-camk2n2 + MO4-tp53 standard conditions Fig. S2 with image from Hsu et al., 2010
somite malformed, abnormal WT + MO1-camk2n2 + MO4-tp53 standard conditions Fig. S2 with image from Hsu et al., 2010
brain malformed, abnormal WT + MO1-camk2n2 + MO4-tp53 standard conditions Fig. S2 with image from Hsu et al., 2010
pericardium edematous, abnormal WT + MO1-camk2n2 + MO4-tp53 standard conditions Fig. S2 with image from Hsu et al., 2010
trunk decreased length, abnormal WT + MO1-camk2n2 + MO4-tp53 standard conditions Fig. S2 with image from Hsu et al., 2010
brain morphogenesis disrupted, abnormal WT + MO1-camk2n2 + MO4-tp53 standard conditions Fig. S2 with image from Hsu et al., 2010
eye malformed, abnormal WT + MO1-camk2n2 + MO4-tp53 standard conditions Fig. S2 with image from Hsu et al., 2010
neuromast hair cell decreased amount, abnormal WT + MO1-canx + MO4-tp53 standard conditions Fig. 7 with image from Hung et al., 2013
neuromast decreased amount, abnormal WT + MO1-canx + MO4-tp53 standard conditions Fig. 7 with image from Hung et al., 2013
glomerular visceral epithelial cell development disrupted, abnormal WT + MO1-cd2ap + MO4-tp53 standard conditions Fig. S4 from Yeo et al., 2015
glomerular filtration disrupted, abnormal WT + MO1-cd2ap + MO4-tp53 standard conditions Fig. S4 from Yeo et al., 2015
pronephric glomerular basement membrane increased permeability, abnormal WT + MO1-cd2ap + MO4-tp53 standard conditions Fig. S4 from Yeo et al., 2015
neural plate dorsal region apoptotic, abnormal WT + MO1-cdk10 + MO4-tp53 standard conditions Fig. 5 from Yeh et al., 2013
midbrain hindbrain boundary amorphous, abnormal WT + MO1-cdk10 + MO4-tp53 standard conditions Fig. 4 from Yeh et al., 2013
forebrain apoptotic, abnormal WT + MO1-cdk10 + MO4-tp53 standard conditions Fig. 5 from Yeh et al., 2013
hindbrain neuron decreased amount, abnormal WT + MO1-cdk10 + MO4-tp53 standard conditions Fig. 7 from Yeh et al., 2013
midbrain morphology, abnormal WT + MO1-cdk10 + MO4-tp53 standard conditions Fig. 4 from Yeh et al., 2013
eye decreased size, abnormal WT + MO1-cdk10 + MO4-tp53 standard conditions Fig. 4 from Yeh et al., 2013
hindbrain morphology, abnormal WT + MO1-cdk10 + MO4-tp53 standard conditions Fig. 4 from Yeh et al., 2013
optic tectum neuron decreased amount, abnormal WT + MO1-cdk10 + MO4-tp53 standard conditions Fig. 7 from Yeh et al., 2013
brain decreased size, abnormal WT + MO1-cdk10 + MO4-tp53 standard conditions Fig. 4 from Yeh et al., 2013
neurogenesis disrupted, abnormal WT + MO1-cdk10 + MO4-tp53 standard conditions Fig. 7Fig. 11 from Yeh et al., 2013
somite morphology, abnormal WT + MO1-cdk10 + MO4-tp53 standard conditions Fig. 4 from Yeh et al., 2013
motor neuron axon decreased amount, abnormal WT + MO1-cdk10 + MO4-tp53 standard conditions Fig. 7 from Yeh et al., 2013
neuronal stem cell apoptotic, abnormal WT + MO1-cdk10 + MO4-tp53 standard conditions Fig. 11 from Yeh et al., 2013
Rohon-Beard neuron decreased amount, abnormal WT + MO1-cdk10 + MO4-tp53 standard conditions Fig. 6Fig. 7 from Yeh et al., 2013
brain apoptotic, abnormal WT + MO1-cdk10 + MO4-tp53 standard conditions Fig. 5 from Yeh et al., 2013
midbrain apoptotic, abnormal WT + MO1-cdk10 + MO4-tp53 standard conditions Fig. 5 from Yeh et al., 2013
brain branching morphogenesis of a nerve decreased occurrence, abnormal WT + MO1-cdk10 + MO4-tp53 standard conditions Fig. 7 from Yeh et al., 2013
retina structure, abnormal WT + MO1-cep164 + MO4-tp53 standard conditions Fig. 6 with image from Chaki et al., 2012
brain hydrocephalic, abnormal WT + MO1-cep164 + MO4-tp53 standard conditions Fig. 6 with image from Chaki et al., 2012
apoptotic process increased occurrence, abnormal WT + MO1-cep164 + MO4-tp53 standard conditions Fig. 6 with image from Chaki et al., 2012
pronephric tubule dilated, abnormal WT + MO1-cep164 + MO4-tp53 standard conditions Fig. 6 with image from Chaki et al., 2012
whole organism curved ventral, abnormal WT + MO1-cep164 + MO4-tp53 standard conditions Fig. 6 with image from Chaki et al., 2012
signal transduction in response to DNA damage decreased process quality, abnormal WT + MO1-cep164 + MO4-tp53 standard conditions Fig. 6 with image from Chaki et al., 2012
heart looping disrupted, abnormal WT + MO1-cep164 + MO4-tp53 standard conditions Fig. 6 with image from Chaki et al., 2012
pronephric tubule cystic, abnormal WT + MO1-cep164 + MO4-tp53 standard conditions Fig. 6 with image from Chaki et al., 2012
post-vent region apoptotic, abnormal WT + MO1-chrd + MO4-tp53 standard conditions Fig. 5 with image from Robu et al., 2007
whole organism wholly ventralized, abnormal WT + MO1-chrd + MO4-tp53 standard conditions Fig. S6 with image from Moreno-Ayala et al., 2015
Fig. 8 with image from Branam et al., 2010
dorsal/ventral pattern formation disrupted, abnormal WT + MO1-chrd + MO4-tp53 standard conditions Fig. 8 with image from Branam et al., 2010
post-vent region bent, abnormal WT + MO1-chrd + MO4-tp53 standard conditions Fig. 8 with image from Branam et al., 2010
convergent extension involved in axis elongation disrupted, abnormal WT + MO1-dcn + MO4-tp53 standard conditions Fig. 5 from Zoeller et al., 2009
trunk decreased length, abnormal WT + MO1-dcn + MO4-tp53 standard conditions Fig. 5 from Zoeller et al., 2009
post-vent region decreased length, abnormal WT + MO1-dcn + MO4-tp53 standard conditions Fig. 5 from Zoeller et al., 2009
pretectum dopaminergic neuron decreased amount, abnormal WT + MO1-ddb1 + MO4-tp53 control Fig. S3 with imageTable 1 from Hu et al., 2015
retina dopaminergic neuron decreased amount, abnormal WT + MO1-ddb1 + MO4-tp53 control Fig. S3 with imageTable 1 from Hu et al., 2015
retina decreased size, abnormal WT + MO1-ddb1 + MO4-tp53 control Table 1 from Hu et al., 2015
brain decreased size, abnormal WT + MO1-ddb1 + MO4-tp53 control Table 1 from Hu et al., 2015
oligodendrocyte cell fate specification disrupted, abnormal WT + MO1-disc1 + MO4-tp53 standard conditions Fig. 5 from Wood et al., 2009
hindbrain oligodendrocyte decreased amount, abnormal WT + MO1-disc1 + MO4-tp53 standard conditions Fig. 5 from Wood et al., 2009
primordial germ cell cell motility decreased occurrence, abnormal WT + MO1-dnd1 + MO4-tp53 standard conditions Fig. 4 with image from Goudarzi et al., 2012
intestine well differentiated, abnormal WT + MO1-dot1l + MO4-tp53 standard conditions Fig. 8 with image from Mahmoudi et al., 2010
canonical Wnt signaling pathway decreased process quality, abnormal WT + MO1-dot1l + MO4-tp53 standard conditions Fig. 9 with image from Mahmoudi et al., 2010
intestinal villus decreased length, abnormal WT + MO1-dot1l + MO4-tp53 standard conditions Fig. 9 with image from Mahmoudi et al., 2010
intestinal epithelial structure maintenance decreased process quality, abnormal WT + MO1-dot1l + MO4-tp53 standard conditions Fig. 9 with image from Mahmoudi et al., 2010
intestinal epithelium has fewer parts of type epithelial cell, abnormal WT + MO1-dot1l + MO4-tp53 standard conditions Fig. 9 with image from Mahmoudi et al., 2010
oligodendrocyte cell division decreased process quality, abnormal WT + MO1-dync1h1 + MO4-tp53 standard conditions Fig. 3 with image from Yang et al., 2015
pigmentation process quality, abnormal WT + MO1-dync1h1 + MO4-tp53 standard conditions Fig. 2 with image from Yang et al., 2015
eye decreased size, abnormal WT + MO1-dync1h1 + MO4-tp53 standard conditions Fig. 2 with image from Yang et al., 2015
brain decreased size, abnormal WT + MO1-dync1h1 + MO4-tp53 standard conditions Fig. 2 with image from Yang et al., 2015
swim bladder absent, abnormal WT + MO1-dync1h1 + MO4-tp53 standard conditions Fig. 2 with image from Yang et al., 2015
oligodendrocyte cell migration decreased process quality, abnormal WT + MO1-dync1h1 + MO4-tp53 standard conditions Fig. 3 with image from Yang et al., 2015
Meckel's cartilage fused with palatoquadrate cartilage, abnormal WT + MO1-ece1 + MO4-tp53 standard conditions Fig. 2 from Iklé et al., 2017
ceratobranchial cartilage decreased amount, abnormal WT + MO1-ece1 + MO4-tp53 standard conditions Fig. 2 from Iklé et al., 2017
Meckel's cartilage curved ventral, abnormal WT + MO1-ece1 + MO4-tp53 standard conditions Fig. 2 from Iklé et al., 2017
palatoquadrate cartilage hypoplastic, abnormal WT + MO1-ece1 + MO4-tp53 standard conditions Fig. 2 from Iklé et al., 2017
basihyal cartilage decreased size, abnormal WT + MO1-ece1 + MO4-tp53 standard conditions Fig. 2 from Iklé et al., 2017
ceratohyal cartilage fused with hyosymplectic cartilage, abnormal WT + MO1-ece1 + MO4-tp53 standard conditions Fig. 2 from Iklé et al., 2017
pharyngeal arch 1 dlx5a expression decreased distribution, abnormal WT + MO1-ece1 + MO4-tp53 standard conditions Fig. 2 from Iklé et al., 2017
ceratohyal cartilage decreased size, abnormal WT + MO1-ece1 + MO4-tp53 standard conditions Fig. 2 from Iklé et al., 2017
Meckel's cartilage fused with Meckel's cartilage, abnormal WT + MO1-ece1 + MO4-tp53 standard conditions Fig. 2 from Iklé et al., 2017
basihyal cartilage curved ventral, abnormal WT + MO1-ece1 + MO4-tp53 standard conditions Fig. 2 from Iklé et al., 2017
ceratohyal cartilage curved ventral, abnormal WT + MO1-ece1 + MO4-tp53 standard conditions Fig. 2 from Iklé et al., 2017
hyosymplectic cartilage hypoplastic, abnormal WT + MO1-ece1 + MO4-tp53 standard conditions Fig. 2 from Iklé et al., 2017
pharyngeal arch 2 dlx5a expression decreased distribution, abnormal WT + MO1-ece1 + MO4-tp53 standard conditions Fig. 2 from Iklé et al., 2017
Meckel's cartilage fused with palatoquadrate cartilage, abnormal WT + MO1-edn1 + MO4-tp53 standard conditions Fig. 2 from Iklé et al., 2017
ceratobranchial 2 cartilage absent, abnormal WT + MO1-edn1 + MO4-tp53 standard conditions Fig. 2 from Iklé et al., 2017
Meckel's cartilage curved ventral, abnormal WT + MO1-edn1 + MO4-tp53 standard conditions Fig. 2 from Iklé et al., 2017
Meckel's cartilage hypoplastic, abnormal WT + MO1-edn1 + MO4-tp53 standard conditions Fig. 2 from Iklé et al., 2017
pharyngeal arch 2 dlx5a expression absent, abnormal WT + MO1-edn1 + MO4-tp53 standard conditions Fig. 2 from Iklé et al., 2017
ceratobranchial 4 cartilage absent, abnormal WT + MO1-edn1 + MO4-tp53 standard conditions Fig. 2 from Iklé et al., 2017
ceratobranchial 3 cartilage absent, abnormal WT + MO1-edn1 + MO4-tp53 standard conditions Fig. 2 from Iklé et al., 2017
pharyngeal arch 1 dlx5a expression absent, abnormal WT + MO1-edn1 + MO4-tp53 standard conditions Fig. 2 from Iklé et al., 2017
ceratobranchial 1 cartilage absent, abnormal WT + MO1-edn1 + MO4-tp53 standard conditions Fig. 2 from Iklé et al., 2017
ceratohyal cartilage curved ventral, abnormal WT + MO1-edn1 + MO4-tp53 standard conditions Fig. 2 from Iklé et al., 2017
ceratohyal cartilage hypoplastic, abnormal WT + MO1-edn1 + MO4-tp53 standard conditions Fig. 2 from Iklé et al., 2017
dorsal telencephalon morphology, abnormal WT + MO1-emx1 + MO2-emx1 + MO4-tp53 standard conditions Fig. 3 with imagetext only from Viktorin et al., 2009
dorsal telencephalon morphology, abnormal WT + MO1-emx3 + MO4-emx3 + MO4-tp53 standard conditions Fig. 3 with image from Viktorin et al., 2009
brain apoptotic, abnormal WT + MO1-epas1b + MO4-tp53 standard conditions Fig. 1 from Ko et al., 2011
regulation of neuron apoptotic process disrupted, abnormal WT + MO1-epas1b + MO4-tp53 standard conditions Fig. 1 from Ko et al., 2011
neuron apoptotic process increased occurrence, abnormal WT + MO1-epas1b + MO4-tp53 standard conditions Fig. 1 from Ko et al., 2011
thymus rag1 expression decreased amount, abnormal WT + MO1-eps15l1b + MO4-tp53 standard conditions Fig. 6 with image from Seiler et al., 2015
T cell differentiation in thymus disrupted, abnormal WT + MO1-eps15l1b + MO4-tp53 standard conditions Fig. 6 with image from Seiler et al., 2015
neuromast decreased amount, abnormal WT + MO1-esr2a + MO4-tp53 standard conditions Fig. 4 with image from Froehlicher et al., 2009
trunk posterior region decreased length, abnormal WT + MO1-fam53b + MO4-tp53 standard conditions Fig. 1 with image from Kizil et al., 2014
post-vent region curled, abnormal WT + MO1-fbxo7 + MO4-tp53 standard conditions Fig. 6 with image from Zhao et al., 2012
heart malformed, abnormal WT + MO1-fbxo7 + MO4-tp53 standard conditions Fig. 6 with image from Zhao et al., 2012
heart edematous, abnormal WT + MO1-fbxo7 + MO4-tp53 standard conditions Fig. 6 with image from Zhao et al., 2012
heart edematous, abnormal WT + MO1-fer + MO4-tp53 standard conditions Fig. 3 with image from Paardekooper Overman et al., 2014
whole organism decreased length, abnormal WT + MO1-fer + MO4-tp53 standard conditions Fig. 3 with image from Paardekooper Overman et al., 2014
cranium malformed, abnormal WT + MO1-fer + MO4-tp53 standard conditions Fig. 3 with image from Paardekooper Overman et al., 2014
forebrain development disrupted, abnormal WT + MO1-fgf22 + MO4-tp53 standard conditions Fig. 2 with image from Miyake et al., 2013
midbrain-hindbrain boundary development disrupted, abnormal WT + MO1-fgf22 + MO4-tp53 standard conditions Fig. 2 with image from Miyake et al., 2013
midbrain development disrupted, abnormal WT + MO1-fgf22 + MO4-tp53 standard conditions Fig. 2 with image from Miyake et al., 2013
forebrain morphology, abnormal WT + MO1-fgf22 + MO4-tp53 standard conditions Fig. 2 with image from Miyake et al., 2013
midbrain morphology, abnormal WT + MO1-fgf22 + MO4-tp53 standard conditions Fig. 2 with image from Miyake et al., 2013
midbrain hindbrain boundary morphology, abnormal WT + MO1-fgf22 + MO4-tp53 standard conditions Fig. 2 with image from Miyake et al., 2013
trunk decreased length, abnormal WT + MO1-fhl1a + MO2-fhl1a + MO4-tp53 standard conditions Fig. 2 from Xie et al., 2013
whole organism curved, abnormal WT + MO1-fhl1a + MO2-fhl1a + MO4-tp53 standard conditions Fig. 2 from Xie et al., 2013
pigmentation decreased process quality, abnormal WT + MO1-fhl1a + MO2-fhl1a + MO4-tp53 standard conditions Fig. 2 from Xie et al., 2013
muscle pioneer increased amount, abnormal WT + MO1-gdf6a + MO4-tp53 standard conditions Fig. 7 with image from Nguyen-Chi et al., 2012
retina morphology, abnormal WT + MO1-gdf6a + MO4-tp53 standard conditions Fig. 7 with image from French et al., 2007
heart edematous, abnormal WT + MO1-golgb1 + MO4-tp53 standard conditions Fig. 1 with image from Bergen et al., 2017
eye decreased size, abnormal WT + MO1-golgb1 + MO4-tp53 standard conditions Fig. 1 with image from Bergen et al., 2017
post-vent region kinked, abnormal WT + MO1-golgb1 + MO4-tp53 standard conditions Fig. 1 with image from Bergen et al., 2017
brain edematous, abnormal WT + MO1-golgb1 + MO4-tp53 standard conditions Fig. 1 with image from Bergen et al., 2017
cell proliferation decreased occurrence, abnormal WT + MO1-gper1 + MO4-tp53 standard conditions Fig. 3 from Shi et al., 2013
apoptotic process increased occurrence, abnormal WT + MO1-gper1 + MO4-tp53 standard conditions Fig. 3 from Shi et al., 2013
determination of left/right asymmetry in lateral mesoderm process quality, abnormal WT + MO1-gpr22a + MO4-tp53 standard conditions Fig. 2 with imageFig. 3 with image from Verleyen et al., 2014
Kupffer's vesicle cilium disorganized, abnormal WT + MO1-gpr22a + MO4-tp53 standard conditions Fig. 5 with image from Verleyen et al., 2014
determination of digestive tract left/right asymmetry process quality, abnormal WT + MO1-gpr22a + MO4-tp53 standard conditions Fig. 2 with image from Verleyen et al., 2014
Kupffer's vesicle cilium decreased length, abnormal WT + MO1-gpr22a + MO4-tp53 standard conditions Fig. 5 with image from Verleyen et al., 2014
whole organism decreased length, abnormal WT + MO1-gpr22a + MO4-tp53 standard conditions Fig. 1 with image from Verleyen et al., 2014
determination of liver left/right asymmetry process quality, abnormal WT + MO1-gpr22a + MO4-tp53 standard conditions Fig. 2 with image from Verleyen et al., 2014
inner ear has extra parts of type otolith, abnormal WT + MO1-gpr22a + MO4-tp53 standard conditions Fig. S6 with image from Verleyen et al., 2014
Kupffer's vesicle cilium has fewer parts of type Kupffer's vesicle axonemal microtubule, abnormal WT + MO1-gpr22a + MO4-tp53 standard conditions Fig. 5 with image from Verleyen et al., 2014
otolith fused with otolith, abnormal WT + MO1-gpr22a + MO4-tp53 standard conditions Fig. S6 with image from Verleyen et al., 2014
caudal fin curved ventral, abnormal WT + MO1-gpr22a + MO4-tp53 standard conditions Fig. 1 with image from Verleyen et al., 2014
heart edematous, abnormal WT + MO1-gpr22a + MO4-tp53 standard conditions Fig. 1 with image from Verleyen et al., 2014
left/right axis specification process quality, abnormal WT + MO1-gpr22a + MO4-tp53 standard conditions Fig. 2 with image from Verleyen et al., 2014
ethmoid cartilage absent, abnormal WT + MO1-gria2a + MO4-tp53 standard conditions Fig. 7 with image from Li et al., 2014
posterior lateral line neuromast decreased amount, abnormal WT + MO1-gria2a + MO4-tp53 standard conditions Fig. 6 with image from Li et al., 2014
cranial cartilage malformed, abnormal WT + MO1-gria2a + MO4-tp53 standard conditions Fig. 7 with image from Li et al., 2014
parachordal cartilage decreased size, abnormal WT + MO1-gria2a + MO4-tp53 standard conditions Fig. 7 with image from Li et al., 2014
pharyngeal arch absent, abnormal WT + MO1-gria2a + MO4-tp53 standard conditions Fig. 7 with image from Li et al., 2014
anterior lateral line neuromast decreased amount, abnormal WT + MO1-gria2a + MO4-tp53 standard conditions Fig. 6 with image from Li et al., 2014
neurocranial trabecula decreased size, abnormal WT + MO1-gria2a + MO4-tp53 standard conditions Fig. 7 with image from Li et al., 2014
whole organism morphology, abnormal WT + MO1-h2af1al + MO4-tp53 standard conditions Fig. 7 from Yue et al., 2013
embryonic morphogenesis arrested, abnormal WT + MO1-h2af1al + MO4-tp53 standard conditions Fig. 7 from Yue et al., 2013
embryo development ending in birth or egg hatching arrested, abnormal WT + MO1-h2af1al + MO4-tp53 standard conditions Fig. 7 from Yue et al., 2013
whole organism monstrous, abnormal WT + MO1-h2af1al + MO4-tp53 standard conditions Fig. 7 from Yue et al., 2013
Meckel's cartilage shortened, abnormal WT + MO1-hcfc1b + MO4-tp53 standard conditions Fig. 2 with image from Quintana et al., 2014
ceratohyal cartilage malformed, abnormal WT + MO1-hcfc1b + MO4-tp53 standard conditions Fig. 2 with imageFig. 7 with imageFig. 9 with image from Quintana et al., 2014
Meckel's cartilage malformed, abnormal WT + MO1-hcfc1b + MO4-tp53 standard conditions Fig. 2 with imageFig. 7 with imageFig. 9 with image from Quintana et al., 2014
ceratobranchial cartilage absent, abnormal WT + MO1-hcfc1b + MO4-tp53 standard conditions Fig. 2 with imageFig. 4 with imageFig. 7 with imageFig. 9 with image from Quintana et al., 2014
splanchnocranium malformed, abnormal WT + MO1-hcfc1b + MO4-tp53 standard conditions Fig. 7 with imageFig. 9 with image from Quintana et al., 2014
ceratohyal cartilage inverted, abnormal WT + MO1-hcfc1b + MO4-tp53 standard conditions Fig. 2 with image from Quintana et al., 2014
heart deformed, abnormal WT + MO1-hsbp1b + MO4-tp53 standard conditions Table S3 with image from Eroglu et al., 2014
whole organism decreased length, abnormal WT + MO1-hsbp1b + MO4-tp53 standard conditions Fig. S7 with image from Eroglu et al., 2014
head deformed, abnormal WT + MO1-hsbp1b + MO4-tp53 standard conditions Fig. S7 with imageTable S3 with image from Eroglu et al., 2014
embryo development disrupted, abnormal WT + MO1-hsbp1b + MO4-tp53 standard conditions Fig. S7 with image from Eroglu et al., 2014
whole organism anterior-posterior axis increased curvature, abnormal WT + MO1-hsbp1b + MO4-tp53 standard conditions Fig. S7 with imageTable S3 with image from Eroglu et al., 2014
yolk increased size, abnormal WT + MO1-hsbp1b + MO4-tp53 standard conditions Table S3 with image from Eroglu et al., 2014
trunk kinked, abnormal WT + MO1-hspg2 + MO4-tp53 standard conditions Fig. S2 from Zoeller et al., 2008
post-vent region curved dorsal, abnormal WT + MO1-hspg2 + MO4-tp53 standard conditions Fig. S2 from Zoeller et al., 2008
determination of intestine left/right asymmetry process quality, abnormal WT + MO1-ikzf5 + MO4-tp53 standard conditions Fig. 2 with image from John et al., 2013
determination of intestine left/right asymmetry decreased process quality, abnormal WT + MO1-ikzf5 + MO4-tp53 standard conditions Fig. 2 with image from John et al., 2013
growth decreased process quality, abnormal WT + MO1-itcha + MO2-itcha + MO4-tp53 standard conditions Fig. 3 with image from Angers et al., 2014
whole organism decreased length, abnormal WT + MO1-itcha + MO2-itcha + MO4-tp53 standard conditions Fig. 3 with image from Angers et al., 2014
brain hemorrhagic, abnormal WT + MO1-itgb8 + MO4-tp53 control Fig. 4 with image from Hirota et al., 2015
brain vasculature broken, abnormal WT + MO1-itgb8 + MO4-tp53 control Fig. 4 with image from Hirota et al., 2015
brain vasculature development process quality, abnormal WT + MO1-itgb8 + MO4-tp53 control Fig. 4 with image from Hirota et al., 2015
heart decreased functionality, abnormal WT + MO1-kif20a + MO4-tp53 standard conditions text only from Louw et al., 2018
pericardium edematous, abnormal WT + MO1-kif20a + MO4-tp53 standard conditions text only from Louw et al., 2018
retina adherens junction distributed, abnormal WT + MO1-llgl1 + MO4-tp53 standard conditions Fig. 3 with imageFig. S3 with image from Clark et al., 2012
retinal neural layer structure, abnormal WT + MO1-llgl1 + MO4-tp53 standard conditions Fig. 1 with image from Clark et al., 2012
retina adherens junction increased size, abnormal WT + MO1-llgl1 + MO4-tp53 standard conditions Fig. 3 with imageFig. S3 with image from Clark et al., 2012
retinal neural layer apical region increased area, abnormal WT + MO1-llgl1 + MO4-tp53 standard conditions Fig. 4 with image from Clark et al., 2012
cell proliferation increased occurrence, abnormal WT + MO1-llgl1 + MO4-tp53 standard conditions Fig. 2 with image from Clark et al., 2012
heart decreased object quality, abnormal WT + MO1-llgl1 + MO4-tp53 standard conditions Fig. S1 with image from Clark et al., 2012
eye decreased size, abnormal WT + MO1-llgl1 + MO4-tp53 standard conditions Fig. S1 with image from Clark et al., 2012
retinal neural layer cell aggregated, abnormal WT + MO1-llgl1 + MO4-tp53 standard conditions Fig. 1 with image from Clark et al., 2012
retina cell disorganized, abnormal WT + MO1-llgl1 + MO4-tp53 standard conditions Fig. S1 with image from Clark et al., 2012
retina layer formation delayed, abnormal WT + MO1-llgl1 + MO4-tp53 standard conditions Fig. 1 with image from Clark et al., 2012
brain decreased size, abnormal WT + MO1-llgl1 + MO4-tp53 standard conditions Fig. S1 with image from Clark et al., 2012
exit from mitosis decreased occurrence, abnormal WT + MO1-llgl1 + MO4-tp53 standard conditions Fig. 2 with image from Clark et al., 2012
chondrocyte differentiation decreased occurrence, abnormal WT + MO1-loxl3b + MO4-tp53 standard conditions Fig. 6 from van Boxtel et al., 2011
pharyngeal arch cartilage malformed, abnormal WT + MO1-loxl3b + MO4-tp53 standard conditions Fig. 3 from van Boxtel et al., 2011
embryonic viscerocranium morphogenesis decreased process quality, abnormal WT + MO1-loxl3b + MO4-tp53 standard conditions Fig. 3Fig. 6 from van Boxtel et al., 2011
cartilage condensation decreased occurrence, abnormal WT + MO1-loxl3b + MO4-tp53 standard conditions Fig. 6 from van Boxtel et al., 2011
brain development disrupted, abnormal WT + MO1-marcksa + MO4-tp53 standard conditions Fig. 6 from Ott et al., 2011
brain morphology, abnormal WT + MO1-marcksa + MO4-tp53 standard conditions Fig. 6 from Ott et al., 2011
post-vent region curved, abnormal WT + MO1-marcksa + MO4-tp53 standard conditions Fig. 6 from Ott et al., 2011
eye morphology, abnormal WT + MO1-marcksa + MO4-tp53 standard conditions Fig. 6 from Ott et al., 2011
eye morphology, abnormal WT + MO1-marcksb + MO4-tp53 standard conditions Fig. 6 from Ott et al., 2011
brain development disrupted, abnormal WT + MO1-marcksb + MO4-tp53 standard conditions Fig. 6 from Ott et al., 2011
post-vent region curved, abnormal WT + MO1-marcksb + MO4-tp53 standard conditions Fig. 6 from Ott et al., 2011
brain morphology, abnormal WT + MO1-marcksb + MO4-tp53 standard conditions Fig. 6 from Ott et al., 2011
paraxial mesoderm mespba expression increased distribution, abnormal WT + MO1-mespbb + MO4-tp53 control Fig. 4 with image from Windner et al., 2015
paraxial mesoderm mespba expression increased amount, abnormal WT + MO1-mespbb + MO4-tp53 control Fig. 4 with image from Windner et al., 2015
melanocyte absent, abnormal WT + MO1-mitfa + MO4-tp53 standard conditions Fig. 5 with image from Robu et al., 2007
ceratohyal cartilage malformed, abnormal WT + MO1-mkxa + MO4-tp53 standard conditions Fig. 8 with image from Chuang et al., 2010
ventricular system malformed, abnormal WT + MO1-mkxa + MO4-tp53 standard conditions Fig. 5 with image from Chuang et al., 2010
embryonic viscerocranium morphogenesis process quality, abnormal WT + MO1-mkxa + MO4-tp53 standard conditions Fig. 6 with imageFig. 8 with image from Chuang et al., 2010
Meckel's cartilage decreased size, abnormal WT + MO1-mkxa + MO4-tp53 standard conditions Fig. 8 with image from Chuang et al., 2010
brain morphogenesis process quality, abnormal WT + MO1-mkxa + MO4-tp53 standard conditions Fig. 5 with image from Chuang et al., 2010
brain malformed, abnormal WT + MO1-mkxa + MO4-tp53 standard conditions Fig. 5 with image from Chuang et al., 2010
pharyngeal pouch disorganized, abnormal WT + MO1-mkxa + MO4-tp53 standard conditions Fig. 6 with image from Chuang et al., 2010
cephalic musculature decreased amount, abnormal WT + MO1-mkxa + MO4-tp53 standard conditions Fig. 9 with image from Chuang et al., 2010
skeletal muscle cell irregular spatial pattern, abnormal WT + MO1-mkxa + MO4-tp53 standard conditions Fig. 11 from Chuang et al., 2014
extraocular musculature decreased amount, abnormal WT + MO1-mkxa + MO4-tp53 standard conditions Fig. 6 with image from Chuang et al., 2010
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-mkxa + MO4-tp53 standard conditions Fig. 11 from Chuang et al., 2014
neural crest physical object quality, abnormal WT + MO1-mkxa + MO4-tp53 standard conditions Fig. 7 with image from Chuang et al., 2010
ceratobranchial cartilage decreased amount, abnormal WT + MO1-mkxa + MO4-tp53 standard conditions Fig. 8 with image from Chuang et al., 2010
ceratobranchial cartilage malformed, abnormal WT + MO1-mkxa + MO4-tp53 standard conditions Fig. 8 with image from Chuang et al., 2010
whole organism curved, abnormal WT + MO1-mkxa + MO4-tp53 standard conditions Fig. 11 from Chuang et al., 2014
pharyngeal musculature decreased amount, abnormal WT + MO1-mkxa + MO4-tp53 standard conditions Fig. 6 with image from Chuang et al., 2010
palatoquadrate cartilage decreased size, abnormal WT + MO1-mkxa + MO4-tp53 standard conditions Fig. 8 with image from Chuang et al., 2010
pharyngeal arch cartilage physical object quality, abnormal WT + MO1-mkxa + MO4-tp53 standard conditions Fig. 6 with image from Chuang et al., 2010
canonical Wnt signaling pathway decreased process quality, abnormal WT + MO1-mllt10 + MO4-tp53 standard conditions Fig. 9 with image from Mahmoudi et al., 2010
intestinal epithelium has fewer parts of type epithelial cell, abnormal WT + MO1-mllt10 + MO4-tp53 standard conditions Fig. 9 with image from Mahmoudi et al., 2010
intestinal villus decreased length, abnormal WT + MO1-mllt10 + MO4-tp53 standard conditions Fig. 9 with image from Mahmoudi et al., 2010
intestine well differentiated, abnormal WT + MO1-mllt10 + MO4-tp53 standard conditions Fig. 8 with image from Mahmoudi et al., 2010
intestinal epithelial structure maintenance decreased process quality, abnormal WT + MO1-mllt10 + MO4-tp53 standard conditions Fig. 9 with image from Mahmoudi et al., 2010
ceratobranchial cartilage absent, abnormal WT + MO1-mmachc + MO4-tp53 standard conditions Fig. 7 with image from Quintana et al., 2014
Meckel's cartilage malformed, abnormal WT + MO1-mmachc + MO4-tp53 standard conditions Fig. 7 with image from Quintana et al., 2014
splanchnocranium malformed, abnormal WT + MO1-mmachc + MO4-tp53 standard conditions Fig. 7 with image from Quintana et al., 2014
ceratohyal cartilage malformed, abnormal WT + MO1-mmachc + MO4-tp53 standard conditions Fig. 7 with image from Quintana et al., 2014
apoptotic process increased occurrence, abnormal WT + MO1-mob1a + MO4-tp53 standard conditions Fig. S3 with image from Yuan et al., 2009
embryo development delayed, abnormal WT + MO1-mob1a + MO4-tp53 standard conditions Fig. S3 with image from Yuan et al., 2009
head decreased size, abnormal WT + MO1-mpzl1l + MO4-tp53 standard conditions Fig. 4 from Paardekooper Overman et al., 2014
heart edematous, abnormal WT + MO1-mpzl1l + MO4-tp53 standard conditions Fig. 4 from Paardekooper Overman et al., 2014
whole organism degenerate, abnormal WT + MO1-msi2b + MO4-tp53 standard conditions Fig. 7 from Hochgreb-Hägele et al., 2014
fourth ventricle edematous, abnormal WT + MO1-msi2b + MO4-tp53 standard conditions Fig. 7 from Hochgreb-Hägele et al., 2014
eye atrophied, abnormal WT + MO1-msi2b + MO4-tp53 standard conditions Fig. 7 from Hochgreb-Hägele et al., 2014
eye aplastic, abnormal WT + MO1-msi2b + MO4-tp53 standard conditions Fig. 7 from Hochgreb-Hägele et al., 2014
caudal fin atrophied, abnormal WT + MO1-msi2b + MO4-tp53 standard conditions Fig. 7 from Hochgreb-Hägele et al., 2014
whole organism axis shortened, abnormal WT + MO1-msi2b + MO4-tp53 standard conditions Fig. 7 from Hochgreb-Hägele et al., 2014
heart edematous, abnormal WT + MO1-msi2b + MO4-tp53 standard conditions Fig. 7 from Hochgreb-Hägele et al., 2014
whole organism decreased pigmentation, abnormal WT + MO1-naa10 + MO4-tp53 standard conditions Fig. S1 from Ree et al., 2015
eye morphology, abnormal WT + MO1-naa10 + MO4-tp53 standard conditions Fig. S1 from Ree et al., 2015
eye malformed, abnormal WT + MO1-naa10 + MO4-tp53 standard conditions Fig. S1 from Ree et al., 2015
whole organism decreased length, abnormal WT + MO1-naa10 + MO4-tp53 standard conditions Fig. S1 from Ree et al., 2015
whole organism ploidy, abnormal WT + MO1-ncapd2 + MO4-tp53 standard conditions text only from Seipold et al., 2009
whole organism ploidy, abnormal WT + MO1-ncaph + MO4-tp53 standard conditions text only from Seipold et al., 2009
blood accumulation heart, abnormal WT + MO1-ncl + MO4-tp53 standard conditions Fig. 4 from Monte et al., 2013
pericardium edematous, abnormal WT + MO1-ncl + MO4-tp53 standard conditions Fig. 4 from Monte et al., 2013
neutrophil decreased amount, abnormal WT + MO1-ncor1 + MO4-tp53 standard conditions Fig. 3 with image from Li et al., 2014
macrophage decreased amount, abnormal WT + MO1-ncor1 + MO4-tp53 standard conditions Fig. 3 with image from Li et al., 2014
ceratohyal bone mislocalised, abnormal WT + MO1-ndst1a + MO2-ndst1a + MO4-tp53 standard conditions Fig. 6 with image from Filipek-Górniok et al., 2015
pharyngeal arch cartilage decreased size, abnormal WT + MO1-ndst1a + MO4-tp53 standard conditions Fig. 6 with image from Filipek-Górniok et al., 2015
head decreased size, abnormal WT + MO1-ndst1a + MO4-tp53 standard conditions Fig. 6 with image from Filipek-Górniok et al., 2015
pectoral fin decreased length, abnormal WT + MO1-ndst1a + MO4-tp53 standard conditions Fig. 6 with image from Filipek-Górniok et al., 2015
ceratohyal bone mislocalised, abnormal WT + MO1-ndst1a + MO4-tp53 standard conditions Fig. 6 with image from Filipek-Górniok et al., 2015
eye decreased size, abnormal WT + MO1-ndst1a + MO4-tp53 standard conditions Fig. 6 with image from Filipek-Górniok et al., 2015
whole organism decreased length, abnormal WT + MO1-ndst1a + MO4-tp53 standard conditions Fig. 6 with image from Filipek-Górniok et al., 2015
whole organism has fewer parts of type swim bladder, abnormal WT + MO1-ndst1a + MO4-tp53 standard conditions Fig. 6 with image from Filipek-Górniok et al., 2015
whole organism apoptotic, abnormal WT + MO1-nedd1 + MO2-nedd1 + MO4-tp53 standard conditions Fig. 4 from Manning et al., 2010
brain hydrophilic, abnormal WT + MO1-nphp4 + MO4-tp53 standard conditions Fig. 2 from Slanchev et al., 2011
whole organism curved ventral, abnormal WT + MO1-nphp4 + MO4-tp53 standard conditions Fig. 2 from Slanchev et al., 2011
pronephric duct dilated, abnormal WT + MO1-nphp4 + MO4-tp53 standard conditions Fig. 2 from Slanchev et al., 2011
pronephros cystic, abnormal WT + MO1-nphp4 + MO4-tp53 standard conditions Fig. 2 from Slanchev et al., 2011
pericardium edematous, abnormal WT + MO1-nphp4 + MO4-tp53 standard conditions Fig. 2 from Slanchev et al., 2011
head decreased size, abnormal WT + MO1-nr1h3 + MO4-tp53 standard conditions Fig. 2 from Archer et al., 2012
eye decreased size, abnormal WT + MO1-nr1h3 + MO4-tp53 standard conditions Fig. 2 from Archer et al., 2012
Meckel's cartilage circular, abnormal WT + MO1-nr1h3 + MO4-tp53 standard conditions Fig. 2 from Archer et al., 2012
ceratohyal cartilage curved, abnormal WT + MO1-nr1h3 + MO4-tp53 standard conditions Fig. 2 from Archer et al., 2012
Meckel's cartilage shape, abnormal WT + MO1-nr1h3 + MO4-tp53 standard conditions Fig. 2 from Archer et al., 2012
thigmotaxis decreased occurrence, abnormal WT + MO1-nrxn1a + MO4-tp53 standard conditions Fig. S2 from Rissone et al., 2012
ceratohyal bone perichondral ossification decreased process quality, abnormal WT + MO1-panx3 + MO4-tp53 standard conditions Fig. 4 from Oh et al., 2015
hyomandibula perichondral ossification decreased process quality, abnormal WT + MO1-panx3 + MO4-tp53 standard conditions Fig. 4 from Oh et al., 2015
osteoblast col10a1a expression decreased amount, abnormal WT + MO1-panx3 + MO4-tp53 standard conditions Fig. 8 from Oh et al., 2015
ventral mandibular arch decreased size, abnormal WT + MO1-panx3 + MO4-tp53 standard conditions Fig. 4 from Oh et al., 2015
Meckel's cartilage bent, abnormal WT + MO1-panx3 + MO4-tp53 standard conditions Fig. 4 from Oh et al., 2015
cleithrum col10a1a expression decreased distribution, abnormal WT + MO1-panx3 + MO4-tp53 standard conditions Fig. 8 from Oh et al., 2015
cleithrum malformed, abnormal WT + MO1-panx3 + MO4-tp53 standard conditions Fig. 4 from Oh et al., 2015
branchiostegal ray intramembranous ossification decreased process quality, abnormal WT + MO1-panx3 + MO4-tp53 standard conditions Fig. 4 from Oh et al., 2015
intramembranous ossification decreased process quality, abnormal WT + MO1-panx3 + MO4-tp53 standard conditions Fig. 4 from Oh et al., 2015
ceratohyal cartilage bent, abnormal WT + MO1-panx3 + MO4-tp53 standard conditions Fig. 4 from Oh et al., 2015
cranial skeletal system development disrupted, abnormal WT + MO1-panx3 + MO4-tp53 standard conditions Fig. 4 from Oh et al., 2015
osteoblast col10a1a expression decreased distribution, abnormal WT + MO1-panx3 + MO4-tp53 standard conditions Fig. 8 from Oh et al., 2015
osteoblast col10a1a expression absent, abnormal WT + MO1-panx3 + MO4-tp53 standard conditions Fig. 8 from Oh et al., 2015
osteoblast differentiation delayed, abnormal WT + MO1-panx3 + MO4-tp53 standard conditions Fig. 8 from Oh et al., 2015
mouth open, abnormal WT + MO1-panx3 + MO4-tp53 standard conditions Fig. 4 from Oh et al., 2015
whole organism anterior-posterior axis increased curvature, abnormal WT + MO1-panx3 + MO4-tp53 standard conditions Fig. 4 from Oh et al., 2015
opercle intramembranous ossification decreased process quality, abnormal WT + MO1-panx3 + MO4-tp53 standard conditions Fig. 4 from Oh et al., 2015
perichondral ossification decreased process quality, abnormal WT + MO1-panx3 + MO4-tp53 standard conditions Fig. 4 from Oh et al., 2015
parasphenoid col10a1a expression decreased distribution, abnormal WT + MO1-panx3 + MO4-tp53 standard conditions Fig. 8 from Oh et al., 2015
ceratobranchial 5 bone perichondral ossification decreased process quality, abnormal WT + MO1-panx3 + MO4-tp53 standard conditions Fig. 4 from Oh et al., 2015
opercle col10a1a expression decreased distribution, abnormal WT + MO1-panx3 + MO4-tp53 standard conditions Fig. 8 from Oh et al., 2015
parasphenoid intramembranous ossification decreased process quality, abnormal WT + MO1-panx3 + MO4-tp53 standard conditions Fig. 4 from Oh et al., 2015
palatoquadrate arch absent, abnormal WT + MO1-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
Meckel's cartilage decreased size, abnormal WT + MO1-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
pharyngeal arch 3-7 decreased size, abnormal WT + MO1-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
ceratohyal cartilage absent, abnormal WT + MO1-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
trunk curved ventral, abnormal WT + MO1-pappa2 + MO4-tp53 standard conditions Fig. 3 with image from Kjaer-Sorensen et al., 2014
notochord undulate, abnormal WT + MO1-pappa2 + MO4-tp53 standard conditions Fig. 3 with image from Kjaer-Sorensen et al., 2014
Meckel's cartilage absent, abnormal WT + MO1-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
hyosymplectic cartilage decreased size, abnormal WT + MO1-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
palatoquadrate arch decreased size, abnormal WT + MO1-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
neurocranial trabecula absent, abnormal WT + MO1-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
ethmoid cartilage decreased size, abnormal WT + MO1-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
cranial neural crest cell decreased amount, abnormal WT + MO1-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
ceratohyal cartilage decreased size, abnormal WT + MO1-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
hyosymplectic cartilage absent, abnormal WT + MO1-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
neurocranial trabecula decreased size, abnormal WT + MO1-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
neuromast decreased amount, abnormal WT + MO1-pcsk5a + MO4-tp53 standard conditions Fig. 4 with image from Chitramuthu et al., 2010
neuromast development disrupted, abnormal WT + MO1-pcsk5a + MO4-tp53 standard conditions Fig. 4 with image from Chitramuthu et al., 2010
fast muscle cell disorganized, abnormal WT + MO1-pgam2 + MO4-tp53 standard conditions Fig. 3 with image from Tixier et al., 2013
fast muscle cell has fewer parts of type fast muscle cell nucleus, abnormal WT + MO1-pgam2 + MO4-tp53 standard conditions Fig. 3 with image from Tixier et al., 2013
myoblast fusion involved in skeletal muscle regeneration disrupted, abnormal WT + MO1-pgam2 + MO4-tp53 standard conditions Fig. 3 with image from Tixier et al., 2013
fast muscle cell decreased diameter, abnormal WT + MO1-pgam2 + MO4-tp53 standard conditions Fig. 3 with image from Tixier et al., 2013
fast muscle cell disheveled, abnormal WT + MO1-pgam2 + MO4-tp53 standard conditions Fig. 3 with image from Tixier et al., 2013
diencephalon has fewer parts of type dopaminergic neuron, abnormal WT + MO1-pitx3 + MO4-tp53 standard conditions Fig. S10 with imageFig. S11 with image from Filippi et al., 2007
retinal inner nuclear layer has fewer parts of type amacrine cell, abnormal WT + MO1-pitx3 + MO4-tp53 standard conditions Fig. S10 with imageFig. S11 with image from Filippi et al., 2007
whole organism decreased length, abnormal WT + MO1-plekhg5a + MO4-tp53 standard conditions Fig. S2 with image from Goh et al., 2010
whole organism viability, abnormal WT + MO1-plekhg5a + MO4-tp53 standard conditions Fig. S2 with image from Goh et al., 2010
convergent extension process quality, abnormal WT + MO1-ppp1caa + MO4-tp53 standard conditions Fig. 6 with image from Shimizu et al., 2014
brain primary motor neuron decreased amount, abnormal WT + MO1-psenen + MO4-tp53 standard conditions Fig. 9 from Campbell et al., 2006
brain primary motor neuron spatial pattern, abnormal WT + MO1-psenen + MO4-tp53 standard conditions Fig. 9 from Campbell et al., 2006
whole organism decreased size, abnormal WT + MO1-psenen + MO4-tp53 standard conditions Fig. 8 from Campbell et al., 2006
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-rab5b + MO4-tp53 standard conditions Fig. 2 with image from Kenyon et al., 2015
head decreased size, abnormal WT + MO1-rab5b + MO4-tp53 standard conditions Fig. 2 with image from Kenyon et al., 2015
whole organism anterior-posterior axis curved, abnormal WT + MO1-rab5b + MO4-tp53 standard conditions Fig. 2 with image from Kenyon et al., 2015
skeletal muscle morphology, abnormal WT + MO1-rab5b + MO4-tp53 standard conditions Fig. 2 with image from Kenyon et al., 2015
somite shape, abnormal WT + MO1-rab5b + MO4-tp53 standard conditions Fig. 2 with image from Kenyon et al., 2015
notochord curved, abnormal WT + MO1-rab5b + MO4-tp53 standard conditions Fig. 2 with image from Kenyon et al., 2015
somite U-shaped, abnormal WT + MO1-rab5c + MO4-tp53 standard conditions Fig. 2 with image from Kenyon et al., 2015
brain necrotic, abnormal WT + MO1-rab5c + MO4-tp53 standard conditions Fig. 2 with image from Kenyon et al., 2015
skeletal muscle disorganized, abnormal WT + MO1-rab5c + MO4-tp53 standard conditions Fig. 2 with image from Kenyon et al., 2015
forebrain morphology, abnormal WT + MO1-rab5c + MO4-tp53 standard conditions Fig. 2 with image from Kenyon et al., 2015
head hypoplastic, abnormal WT + MO1-rab5c + MO4-tp53 standard conditions Fig. 2 with image from Kenyon et al., 2015
whole organism anterior-posterior axis curved, abnormal WT + MO1-rab5c + MO4-tp53 standard conditions Fig. 2 with image from Kenyon et al., 2015
anatomical structure dhrs3a expression decreased amount, abnormal WT + MO1-rdh10a + MO2-rdh10a + MO4-tp53 standard conditions Fig. 2 with image from D'Aniello et al., 2015
extension increased thickness, abnormal WT + MO1-rdh10a + MO2-rdh10a + MO4-tp53 standard conditions Fig. 1 with image from D'Aniello et al., 2015
anatomical structure cyp26a1 expression decreased amount, abnormal WT + MO1-rdh10a + MO2-rdh10a + MO4-tp53 standard conditions Fig. 2 with image from D'Aniello et al., 2015
extension shape, abnormal WT + MO1-rdh10a + MO2-rdh10a + MO4-tp53 standard conditions Fig. 1 with image from D'Aniello et al., 2015
anatomical structure myl7 expression increased amount, abnormal WT + MO1-rdh10a + MO2-rdh10a + MO4-tp53 standard conditions Fig. 3 with image from D'Aniello et al., 2015
anatomical structure myh7 expression increased amount, abnormal WT + MO1-rdh10a + MO2-rdh10a + MO4-tp53 standard conditions Fig. 3 with image from D'Aniello et al., 2015
anatomical structure hoxb5b expression decreased amount, abnormal WT + MO1-rdh10a + MO2-rdh10a + MO4-tp53 standard conditions Fig. 2 with image from D'Aniello et al., 2015
anatomical structure myh6 expression increased amount, abnormal WT + MO1-rdh10a + MO2-rdh10a + MO4-tp53 standard conditions Fig. 3 with image from D'Aniello et al., 2015
pericardium edematous, abnormal WT + MO1-rdh10a + MO2-rdh10a + MO4-tp53 standard conditions Fig. 1 with image from D'Aniello et al., 2015
trunk posterior region tbx6 expression mislocalised, abnormal WT + MO1-ripply1 + MO4-tp53 control Fig. 5 with image from Windner et al., 2015
segmental plate mespba expression increased distribution, abnormal WT + MO1-ripply1 + MO4-tp53 control Fig. 4 with image from Windner et al., 2015
somite pax3a expression decreased amount, abnormal WT + MO1-ripply1 + MO4-tp53 control Fig. 5 with image from Windner et al., 2015
somite meox1 expression increased amount, abnormal WT + MO1-ripply1 + MO4-tp53 control Fig. 5 with image from Windner et al., 2015
trunk pax3a expression increased distribution, abnormal WT + MO1-ripply1 + MO4-tp53 control Fig. 5 with image from Windner et al., 2015
slow muscle myoblast ab-mf20 labeling increased amount, abnormal WT + MO1-ripply1 + MO4-tp53 control Fig. 4 with image from Windner et al., 2015
paraxial mesoderm tbx6 expression increased distribution, abnormal WT + MO1-ripply1 + MO4-tp53 control Fig. 4 with image from Windner et al., 2015
segmental plate mespbb expression increased distribution, abnormal WT + MO1-ripply1 + MO4-tp53 control Fig. 4 with image from Windner et al., 2015
trunk ab-pax7 labeling increased distribution, abnormal WT + MO1-ripply1 + MO4-tp53 control Fig. 5 with image from Windner et al., 2015
slow muscle cell mislocalised, abnormal WT + MO1-ripply1 + MO4-tp53 control Fig. 5 with image from Windner et al., 2015
dermomyotome increased amount, abnormal WT + MO1-ripply1 + MO4-tp53 control Fig. 5 with image from Windner et al., 2015
trunk pax7a expression increased distribution, abnormal WT + MO1-ripply1 + MO4-tp53 control Fig. 5 with image from Windner et al., 2015
paraxial mesoderm tbx6 expression increased amount, abnormal WT + MO1-ripply1 + MO4-tp53 control Fig. 4 with image from Windner et al., 2015
trunk posterior region tbx6 expression increased distribution, abnormal WT + MO1-ripply1 + MO4-tp53 control Fig. 5 with image from Windner et al., 2015
nucleate erythrocyte decreased amount, abnormal WT + MO1-rpl11 + MO4-tp53 standard conditions Fig. 2 from Chakraborty et al., 2017
hemopoiesis process quality, abnormal WT + MO1-rpl11 + MO4-tp53 standard conditions Fig. 4 with image from Zhang et al., 2013
nucleate erythrocyte decreased amount, abnormal WT + MO1-rpl35 + MO4-tp53 standard conditions Fig. 2 from Yadav et al., 2014
nucleate erythrocyte decreased amount, abnormal WT + MO1-rpl35a + MO4-tp53 standard conditions Fig. 2 from Yadav et al., 2014
nucleate erythrocyte decreased amount, abnormal WT + MO1-rplp1 + MO4-tp53 standard conditions Fig. 2 from Yadav et al., 2014
nucleate erythrocyte decreased amount, abnormal WT + MO1-rps3 + MO4-tp53 standard conditions Fig. 2 from Yadav et al., 2014
nucleate erythrocyte decreased amount, abnormal WT + MO1-rps19 + MO4-tp53 standard conditions Fig. 2 from Torihara et al., 2011
brain hydrocephalic, abnormal WT + MO1-rxylt1 + MO4-tp53 standard conditions Fig. 6 with image from Praissman et al., 2016
eye decreased width, abnormal WT + MO1-rxylt1 + MO4-tp53 standard conditions Fig. 6 with image from Praissman et al., 2016
heart decreased size, abnormal WT + MO1-scn5lab + MO4-tp53 standard conditions Fig. 2 from Bennett et al., 2013
heart looping arrested, abnormal WT + MO1-scn5lab + MO4-tp53 standard conditions Fig. S6 from Chopra et al., 2010
atrium orientation cardiac ventricle, abnormal WT + MO1-scn5lab + MO4-tp53 standard conditions Fig. S6 from Chopra et al., 2010
heart looping decreased process quality, abnormal WT + MO1-scn5lab + MO4-tp53 standard conditions Fig. 2 from Bennett et al., 2013
atrium orientation cardiac ventricle, abnormal WT + MO1-scn12aa + MO4-tp53 standard conditions Fig. S6 from Chopra et al., 2010
heart looping arrested, abnormal WT + MO1-scn12aa + MO4-tp53 standard conditions Fig. S6 from Chopra et al., 2010
post-vent region pigment cell decreased amount, abnormal WT + MO1-sh3pxd2aa + MO4-tp53 standard conditions Fig. 1 with image from Murphy et al., 2011
epithelial to mesenchymal transition delayed, abnormal WT + MO1-slc39a10 + MO4-tp53 standard conditions Fig. S2 with image from Taylor et al., 2016
post-vent region bent, abnormal WT + MO1-slc39a10 + MO4-tp53 standard conditions Fig. 4 with image from Taylor et al., 2016
tail bud immature, abnormal WT + MO1-slc39a10 + MO4-tp53 standard conditions Fig. 4 with image from Taylor et al., 2016
head morphology, abnormal WT + MO1-slc39a10 + MO4-tp53 standard conditions Fig. 4 with image from Taylor et al., 2016
head deformed, abnormal WT + MO1-slc39a10 + MO4-tp53 standard conditions Fig. S2 with image from Taylor et al., 2016
pericardium edematous, abnormal WT + MO1-slc39a10 + MO4-tp53 standard conditions Fig. 4 with imageFig. S2 with image from Taylor et al., 2016
post-vent region curved, abnormal WT + MO1-slc39a10 + MO4-tp53 standard conditions Fig. 4 with imageFig. S2 with image from Taylor et al., 2016
eye malformed, abnormal WT + MO1-slc39a10 + MO4-tp53 standard conditions Fig. S2 with image from Taylor et al., 2016
eye morphology, abnormal WT + MO1-slc39a10 + MO4-tp53 standard conditions Fig. 4 with image from Taylor et al., 2016
epiboly involved in gastrulation with mouth forming second delayed, abnormal WT + MO1-slc39a10 + MO4-tp53 standard conditions Fig. 4 with imageFig. S2 with image from Taylor et al., 2016
heart malformed, abnormal WT + MO1-slc39a10 + MO4-tp53 standard conditions Fig. 4 with imageFig. S2 with image from Taylor et al., 2016
whole organism dorsal-ventral axis shortened, abnormal WT + MO1-slc39a10 + MO4-tp53 standard conditions Fig. 4 with imageFig. S2 with image from Taylor et al., 2016
hatching delayed, abnormal WT + MO1-slc39a10 + MO4-tp53 standard conditions Fig. S2 with image from Taylor et al., 2016
intersegmental vessel absent, abnormal WT + MO1-stab2 + MO4-stab2 + MO4-tp53 standard conditions Fig. 1 with image from Rost et al., 2014
apoptotic process increased occurrence, abnormal WT + MO1-surf1 + MO4-tp53 standard conditions Fig. 5 from Baden et al., 2007
post-vent region aplastic, abnormal WT + MO1-tbxta + MO4-tp53 standard conditions Fig. 5 with image from Robu et al., 2007
pronephros cystic, abnormal WT + MO1-tctex1d2 + MO4-tp53 standard conditions Fig. 3 with image from Schmidts et al., 2015
trunk curved ventral, abnormal WT + MO1-tctex1d2 + MO4-tp53 standard conditions Fig. 3 with image from Schmidts et al., 2015
pronephric duct cilium decreased length, abnormal WT + MO1-tctex1d2 + MO4-tp53