ZFIN ID: ZDB-MRPHLNO-060317-4
Morpholino Name: MO1-tnnt2a
Target: tnnt2a (2)
Previous Names: MO1-tnnt2, tnnt2MO (1), Troponin T (1), MO silent heart (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CATGTTTGCTCTGATCTGACACGCA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-tnnt2a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-tnnt2a
Expressed Gene Anatomy Figures
acana Fig. 1 from Rambeau et al., 2017
adora2b Fig. 2 from Jing et al., 2015
bmp10 Fig. S4 with image from Laux et al., 2013
bmp10l Fig. S4 with image from Laux et al., 2013
cdh5 Fig. 1 with image from Laux et al., 2013
Fig. 2Fig. 3 from Nicoli et al., 2010
cxcr4a Fig. 1 with image from Laux et al., 2013
Fig. 6 with image from Bussmann et al., 2011
dbh Fig. 7 with image from Chou et al., 2014
dll4 Fig. 4 from Wang et al., 2011
edn1 Fig. 1 with image from Laux et al., 2013
efnb2a Fig. 4 with image from Samsa et al., 2015
Fig. 4 from Wang et al., 2011
Fig. S6 from Herpers et al., 2008
flt4 Fig. 2Fig. S6 from Herpers et al., 2008
fn1a Fig. 8 with image from Chiu et al., 2012
foxc1a Fig. 6 with image from Chen et al., 2017
foxc1b Fig. 6 with image from Chen et al., 2017
gata1a Fig. 1 from Wang et al., 2011
hbae1.1 Fig. 6 with image from Jin et al., 2009
heg1 Fig. 1 with image from Donat et al., 2018
hsd3b Fig. 5 with image from Liu et al., 2006
ifng1 Fig. 5 with image from Sawamiphak et al., 2014
kdrl Fig. 6 with image from Bussmann et al., 2011
klf2a Fig. S1 with image from Novodvorsky et al., 2015
Fig. 5 with image from Renz et al., 2015
Fig. 5 from Wang et al., 2011
Fig. 2 from Nicoli et al., 2010
klf2b Fig. 5 with image from Renz et al., 2015
krit1 Fig. 1 with image from Donat et al., 2018
lyz Fig. 6 with image from Jin et al., 2009
mir21-1 Fig. 2 from Banjo et al., 2013
mir126a Fig. 3 from Nicoli et al., 2010
mpx Fig. S2 with image from Glenn et al., 2014
myb Fig. S5 with image from Novodvorsky et al., 2015
Fig. 2 from Wang et al., 2011
Fig. 6 with image from Jin et al., 2009
Fig. 7 with image from Murayama et al., 2006
notch1b Fig. 4 with image from Samsa et al., 2015
nr5a1a Fig. 7 with image from Chou et al., 2014
nrg1 Fig. 4 with image from Samsa et al., 2015
pax2a Fig. 8 with image from Gerlach et al., 2014
podxl Fig. 8 with image from Gerlach et al., 2014
rag1 Fig. 2 from Wang et al., 2011
runx1 Fig. S5 with image from Novodvorsky et al., 2015
Fig. 5 with image from Sawamiphak et al., 2014
Fig. 2Fig. 7 from Wang et al., 2011
Fig. 6 with image from Jin et al., 2009
tal1 Fig. 1 from Wang et al., 2011
tcf21 Fig. 6 with image from Serluca, 2008
wt1a Fig. 8 with image from Gerlach et al., 2014
Fig. 6 with image from Serluca, 2008
PHENOTYPE
Phenotype resulting from MO1-tnnt2a
Phenotype Figures
adrenal gland development lacking processual parts cell migration, abnormal Fig. 2 with image from Chou et al., 2010
adrenal gland development process quality, abnormal Fig. 1 with imageFig. 7 with image from Chou et al., 2014
anterior cardinal vein unlumenized, abnormal Fig. 1 from Herbert et al., 2009
aortic arch 1 blood vessel endothelial cell migration process quality, abnormal Fig. 4 with image from Rochon et al., 2016
aortic arch 1 cell migration involved in heart development decreased occurrence, abnormal Fig. 4 with image from Rochon et al., 2016
artery morphogenesis delayed, abnormal Fig. 4 from Wang et al., 2011
atrioventricular canal GCaMP expression decreased amount, abnormal Fig. 4 with image from Heckel et al., 2015
atrioventricular valve Venus expression absent, abnormal Fig. 6 with image from Jiménez-Amilburu et al., 2016
basibranchial condensed, abnormal Fig. 4 with image from Anderson et al., 2008
basilar artery decreased diameter, abnormal Fig. 3 with image from Fujita et al., 2011
blood accumulation trunk, abnormal Fig. 1Fig. 2 from Wang et al., 2011
blood flow rate, abnormal Fig. 7 with image from Murayama et al., 2006
blood increased accumulation caudal vein, abnormal Fig. 4 with image from Ellertsdottir et al., 2012
blood circulation absent, abnormal Fig. 3 with image from Fujita et al., 2011
blood circulation arrested, abnormal Fig. 1 with image from Donat et al., 2018
Fig. 4 with image from Ellertsdottir et al., 2012
Fig. 6 with image from Bussmann et al., 2011
Fig. 1 from Herbert et al., 2009
blood circulation decreased occurrence, abnormal Fig. 1 with imageFig. 5 with image from Serbanovic-Canic et al., 2017
Fig. 4 with image from Rochon et al., 2016
blood circulation decreased process quality, abnormal Fig. 1 with image from Chou et al., 2014
blood circulation decreased rate, abnormal Fig. 2 with image from Chen et al., 2017
blood circulation disrupted, abnormal Fig. 8 with image from Chiu et al., 2012
Fig. S1 from Hogan et al., 2008
Fig. 7 with image from Murayama et al., 2006
blood vessel collapsed, abnormal Fig. 1 with image from Corti et al., 2011
blood vessel lumenization disrupted, abnormal Fig. 4 with image from Ellertsdottir et al., 2012
blood vessel morphogenesis decreased process quality, abnormal Fig. 7 from Mleynek et al., 2014
brain vasculature hemorrhagic, abnormal Fig. S1 with image from Mugoni et al., 2013
cardiac conduction system mislocalised, abnormal Fig. 4 with image from Poon et al., 2016
cardiac muscle cell Venus expression absent, abnormal Fig. 6 with image from Jiménez-Amilburu et al., 2016
cardiac muscle cell electric potential, abnormal Fig. 4 with image from Becker et al., 2011
cardiac muscle cell EGFP expression mislocalised, abnormal Fig. 6 with image from Rasouli et al., 2017
cardiac muscle cell basal side EGFP expression absent, abnormal Fig. 6 with image from Rasouli et al., 2017
cardiac muscle cell cell projection transient, abnormal Fig. 5 with image from Staudt et al., 2014
cardiac muscle cell Notch signaling pathway decreased process quality, abnormal Fig. 6 with image from Jiménez-Amilburu et al., 2016
cardiac muscle cell sarcomere disorganized, abnormal Fig. 7 from Yang et al., 2012
cardiac ventricle trabecular layer absent, abnormal Fig. 1 with image from Samsa et al., 2015
caudal division of the internal carotid artery blood vessel endothelial cell migration process quality, abnormal Fig. 4 with image from Rochon et al., 2016
caudal vein plexus decreased size, abnormal Fig. S6 from Hogan et al., 2008
caudal vein plexus angiogenic sprout increased amount, abnormal Fig. 7 from Mleynek et al., 2014
caudal vein plexus sprouting angiogenesis increased occurrence, abnormal Fig. 7 from Mleynek et al., 2014
cell migration involved in heart development decreased occurrence, abnormal Fig. 4 with image from Rochon et al., 2016
central artery decreased diameter, abnormal Fig. 3 with image from Fujita et al., 2011
central artery physical object quality, abnormal Fig. 6 with image from Bussmann et al., 2011
ceratobranchial cartilage orientation ceratobranchial cartilage, abnormal Fig. 4 with image from Anderson et al., 2008
ceratohyal cartilage orientation ceratohyal cartilage, abnormal Fig. 4 with image from Anderson et al., 2008
chromaffin cell mislocalised, abnormal Fig. 7 with image from Chou et al., 2014
common cardinal vein blood vessel endothelial cell decreased amount, abnormal Fig. 8 with image from Helker et al., 2013
cranial vasculature unlumenized, abnormal Fig. S3 from Hogan et al., 2008
distal tubule development arrested, abnormal Fig. 8 with image from Vasilyev et al., 2009
dorsal aorta structure, abnormal Fig. 4 with image from Ellertsdottir et al., 2012
dorsal aorta unlumenized, abnormal Fig. 4 from Wang et al., 2011
dorsal aorta anatomical region mCherry expression absent, abnormal Fig. 2 with image from Chen et al., 2017
dorsal aorta vascular associated smooth muscle cell mCherry expression absent, abnormal Fig. 2 with image from Chen et al., 2017
dorsal aorta vascular associated smooth muscle cell decreased amount, abnormal Fig. 2 with image from Chen et al., 2017
endocardium hypotrophic, abnormal Fig. 5 with image from Renz et al., 2015
endothelial cell apoptotic process increased occurrence, abnormal Fig. 1 with imageFig. 5 with imageFig. 6 from Serbanovic-Canic et al., 2017
endothelial cell apoptotic process increased occurrence, ameliorated Fig. 6 from Serbanovic-Canic et al., 2017
heart EGFP expression absent, abnormal Fig. 2 with image from Samsa et al., 2015
heart nrg1 expression decreased amount, abnormal Fig. 4 with image from Samsa et al., 2015
heart notch1b expression decreased amount, abnormal Fig. 4 with image from Samsa et al., 2015
heart efnb2a expression decreased amount, abnormal Fig. 4 with image from Samsa et al., 2015
heart morphology, abnormal Fig. S1 with image from Mugoni et al., 2013
heart Notch signaling pathway decreased process quality, abnormal Fig. 6 with image from Jiménez-Amilburu et al., 2016
heart contraction absent, abnormal Fig. 1 with imageFig. 2 with image from Samsa et al., 2015
heart contraction arrested, abnormal Fig. 2Fig. 5 from Andersen et al., 2015
Fig. 8 with image from Gerlach et al., 2014
Fig. 4 with image from Arnaout et al., 2007
heart contraction decreased occurrence, abnormal Fig. 2 with image from Xu et al., 2016
heart contraction decreased process quality, abnormal Fig. 1 with image from Chou et al., 2014
hematopoietic multipotent progenitor cell decreased amount, abnormal Fig. 7 from Wang et al., 2011
hematopoietic system decreased functionality, abnormal Fig. 7 with image from Murayama et al., 2006
hepatic sinusoid aplastic, abnormal Fig. 6 with image from Korzh et al., 2008
internal carotid artery blood vessel endothelial cell migration process quality, abnormal Fig. 4 with image from Rochon et al., 2016
interrenal angiogenic sprout mislocalised laterally, abnormal Fig. 8 with image from Chiu et al., 2012
interrenal gland position, abnormal Fig. 1 with image from Chou et al., 2014
interrenal gland animal organ morphogenesis process quality, abnormal Fig. 7 with image from Chou et al., 2014
interrenal gland epithelial to mesenchymal transition decreased occurrence, abnormal Fig. 6 with image from Chou et al., 2014
interrenal primordium position, abnormal Fig. 8 with image from Chiu et al., 2012
intersegmental vessel structure, abnormal Fig. 6 with imageFig. S1 with image from Mugoni et al., 2013
intersegmental vessel structure, cavities, abnormal Fig. 4 with image from Ellertsdottir et al., 2012
intersegmental vessel blood vessel lumenization process quality, abnormal Fig. S1 from Sauteur et al., 2014
liver decreased size, abnormal Fig. 6 with image from Korzh et al., 2008
nitric oxide biosynthetic process disrupted, abnormal Fig. 7 from Wang et al., 2011
Notch signaling involved in heart development decreased occurrence, abnormal Fig. 2 with image from Samsa et al., 2015
nucleate erythrocyte development disrupted, abnormal Fig. 8 with image from Helker et al., 2013
optic tectum decreased width, abnormal Fig. 2 with image from Xu et al., 2016
optic tectum microglial cell decreased amount, abnormal Fig. 2 with image from Xu et al., 2016
optic tectum microglial cell migration process quality, abnormal Fig. 2 with image from Xu et al., 2016
palatoquadrate arch decreased length, abnormal Fig. 4 with image from Anderson et al., 2008
pericardium edematous, abnormal Fig. 5 with image from Korzh et al., 2008
Fig. 6 with image from Serluca, 2008
Fig. 3 from Xie et al., 2008
post-vent vasculature morphology, abnormal Fig. 7 from Mleynek et al., 2014
posterior cardinal vein unlumenized, abnormal Fig. 1 from Herbert et al., 2009
pronephric glomerular capillary increased size, abnormal Fig. 2 with image from Chou et al., 2010
pronephric glomerulus separated from pronephric glomerulus, abnormal Fig. 1 with image from Chou et al., 2014
pronephric glomerulus right side unfused from pronephric glomerulus left side, abnormal Fig. 2 with image from Chou et al., 2010
pronephric glomerulus morphogenesis process quality, abnormal Fig. 1 with image from Chou et al., 2014
proximal convoluted tubule development arrested, abnormal Fig. 8 with image from Vasilyev et al., 2009
regulation of cardiac muscle contraction by calcium ion signaling disrupted, abnormal Fig. 4 with image from Becker et al., 2011
simple columnar epithelium displaced, abnormal Fig. 8 with image from Vasilyev et al., 2009
simple cuboidal epithelium displaced, abnormal Fig. 8 with image from Vasilyev et al., 2009
sinoatrial node increased area, abnormal Fig. 4 with image from Poon et al., 2016
sinoatrial node EGFP expression increased distribution, abnormal Fig. 4 with image from Poon et al., 2016
sprouting angiogenesis process quality, abnormal Fig. 6 with image from Bussmann et al., 2011
subintestinal vein morphology, abnormal Fig. 7 from Wu et al., 2015
subintestinal vein blood vessel morphogenesis disrupted, abnormal Fig. 7 from Wu et al., 2015
thymus decreased size, abnormal Fig. 2 from Wang et al., 2011
thymus hematopoietic multipotent progenitor cell decreased amount, abnormal Fig. 2 from Wang et al., 2011
trabecular layer absent, abnormal Fig. 1 with image from Samsa et al., 2015
trunk anterior side increased accumulation nucleate erythrocyte, abnormal Fig. 7 with image from Murayama et al., 2006
trunk hematopoietic multipotent progenitor cell decreased amount, abnormal Fig. 2Fig. 5 from Wang et al., 2011
trunk vasculature klf2a expression decreased amount, abnormal Fig. S1 with image from Novodvorsky et al., 2015
trunk vasculature morphology, abnormal Fig. S1 with image from Mugoni et al., 2013
trunk vasculature blood vessel lumenization decreased process quality, abnormal Fig. S4 from Zhao et al., 2013
vascular endothelium increased size, abnormal Fig. 2 with image from Chou et al., 2010
vascular endothelium mislocalised, abnormal Fig. 2 with image from Chou et al., 2010
venous blood vessel morphogenesis disrupted, abnormal Fig. 1 from Herbert et al., 2009
ventral wall of dorsal aorta has fewer parts of type hematopoietic stem cell, abnormal Fig. 5 with image from Sawamiphak et al., 2014
ventral wall of dorsal aorta hematopoietic stem cell myb expression decreased amount, abnormal Fig. S5 with image from Novodvorsky et al., 2015
ventral wall of dorsal aorta hematopoietic stem cell runx1 expression decreased amount, abnormal Fig. S5 with image from Novodvorsky et al., 2015
whole organism heg1 expression decreased amount, abnormal Fig. 1 with image from Donat et al., 2018
whole organism foxc1b expression decreased amount, abnormal Fig. 6 with image from Chen et al., 2017
whole organism foxc1a expression decreased amount, abnormal Fig. 6 with image from Chen et al., 2017

Phenotype of all Fish created by or utilizing MO1-tnnt2a
Phenotype Fish Conditions Figures
pericardium edematous, abnormal gz15Tg/gz15Tg + MO1-tnnt2a standard conditions Fig. 5 with image from Korzh et al., 2008
liver decreased size, abnormal gz15Tg/gz15Tg + MO1-tnnt2a standard conditions Fig. 6 with image from Korzh et al., 2008
hepatic sinusoid aplastic, abnormal gz15Tg/gz15Tg + MO1-tnnt2a standard conditions Fig. 6 with image from Korzh et al., 2008
blood circulation disrupted, abnormal AB + MO1-tnnt2a standard conditions Fig. 7 with image from Murayama et al., 2006
hematopoietic system decreased functionality, abnormal AB + MO1-tnnt2a standard conditions Fig. 7 with image from Murayama et al., 2006
trunk anterior side increased accumulation nucleate erythrocyte, abnormal AB + MO1-tnnt2a standard conditions Fig. 7 with image from Murayama et al., 2006
blood flow rate, abnormal AB + MO1-tnnt2a standard conditions Fig. 7 with image from Murayama et al., 2006
heart contraction arrested, abnormal TU + MO1-tnnt2a standard conditions Fig. 8 with image from Gerlach et al., 2014
hematopoietic multipotent progenitor cell decreased amount, abnormal WT + MO1-tnnt2a standard conditions Fig. 7 from Wang et al., 2011
pericardium edematous, abnormal WT + MO1-tnnt2a standard conditions Fig. 6 with image from Serluca, 2008
anterior cardinal vein unlumenized, abnormal WT + MO1-tnnt2a standard conditions Fig. 1 from Herbert et al., 2009
brain vasculature hemorrhagic, abnormal WT + MO1-tnnt2a standard conditions Fig. S1 with image from Mugoni et al., 2013
posterior cardinal vein unlumenized, abnormal WT + MO1-tnnt2a standard conditions Fig. 1 from Herbert et al., 2009
trunk vasculature klf2a expression decreased amount, abnormal WT + MO1-tnnt2a standard conditions Fig. S1 with image from Novodvorsky et al., 2015
venous blood vessel morphogenesis disrupted, abnormal WT + MO1-tnnt2a standard conditions Fig. 1 from Herbert et al., 2009
cardiac muscle cell electric potential, abnormal WT + MO1-tnnt2a standard conditions Fig. 4 with image from Becker et al., 2011
cardiac muscle cell sarcomere disorganized, abnormal WT + MO1-tnnt2a standard conditions Fig. 7 from Yang et al., 2012
central artery physical object quality, abnormal WT + MO1-tnnt2a standard conditions Fig. 6 with image from Bussmann et al., 2011
artery morphogenesis delayed, abnormal WT + MO1-tnnt2a standard conditions Fig. 4 from Wang et al., 2011
whole organism foxc1a expression decreased amount, abnormal WT + MO1-tnnt2a control Fig. 6 with image from Chen et al., 2017
basibranchial condensed, abnormal WT + MO1-tnnt2a standard conditions Fig. 4 with image from Anderson et al., 2008
ceratobranchial cartilage orientation ceratobranchial cartilage, abnormal WT + MO1-tnnt2a standard conditions Fig. 4 with image from Anderson et al., 2008
sprouting angiogenesis process quality, abnormal WT + MO1-tnnt2a standard conditions Fig. 6 with image from Bussmann et al., 2011
adrenal gland development process quality, abnormal WT + MO1-tnnt2a standard conditions Fig. 7 with image from Chou et al., 2014
heart morphology, abnormal WT + MO1-tnnt2a standard conditions Fig. S1 with image from Mugoni et al., 2013
ceratohyal cartilage orientation ceratohyal cartilage, abnormal WT + MO1-tnnt2a standard conditions Fig. 4 with image from Anderson et al., 2008
trunk hematopoietic multipotent progenitor cell decreased amount, abnormal WT + MO1-tnnt2a standard conditions Fig. 2Fig. 5 from Wang et al., 2011
blood circulation arrested, abnormal WT + MO1-tnnt2a standard conditions Fig. 1 with image from Donat et al., 2018
Fig. 6 with image from Bussmann et al., 2011
Fig. 1 from Herbert et al., 2009
ventral wall of dorsal aorta hematopoietic stem cell myb expression decreased amount, abnormal WT + MO1-tnnt2a standard conditions Fig. S5 with image from Novodvorsky et al., 2015
whole organism foxc1b expression decreased amount, abnormal WT + MO1-tnnt2a control Fig. 6 with image from Chen et al., 2017
regulation of cardiac muscle contraction by calcium ion signaling disrupted, abnormal WT + MO1-tnnt2a standard conditions Fig. 4 with image from Becker et al., 2011
thymus decreased size, abnormal WT + MO1-tnnt2a standard conditions Fig. 2 from Wang et al., 2011
whole organism heg1 expression decreased amount, abnormal WT + MO1-tnnt2a standard conditions Fig. 1 with image from Donat et al., 2018
common cardinal vein blood vessel endothelial cell decreased amount, abnormal WT + MO1-tnnt2a standard conditions Fig. 8 with image from Helker et al., 2013
ventral wall of dorsal aorta hematopoietic stem cell runx1 expression decreased amount, abnormal WT + MO1-tnnt2a standard conditions Fig. S5 with image from Novodvorsky et al., 2015
nucleate erythrocyte development disrupted, abnormal WT + MO1-tnnt2a standard conditions Fig. 8 with image from Helker et al., 2013
palatoquadrate arch decreased length, abnormal WT + MO1-tnnt2a standard conditions Fig. 4 with image from Anderson et al., 2008
nitric oxide biosynthetic process disrupted, abnormal WT + MO1-tnnt2a standard conditions Fig. 7 from Wang et al., 2011
chromaffin cell mislocalised, abnormal WT + MO1-tnnt2a standard conditions Fig. 7 with image from Chou et al., 2014
blood accumulation trunk, abnormal WT + MO1-tnnt2a standard conditions Fig. 2 from Wang et al., 2011
interrenal gland animal organ morphogenesis process quality, abnormal WT + MO1-tnnt2a standard conditions Fig. 7 with image from Chou et al., 2014
thymus hematopoietic multipotent progenitor cell decreased amount, abnormal WT + MO1-tnnt2a standard conditions Fig. 2 from Wang et al., 2011
dorsal aorta unlumenized, abnormal WT + MO1-tnnt2a standard conditions Fig. 4 from Wang et al., 2011
heart contraction arrested, abnormal f2Tg + MO1-tnnt2a chemical treatment: (S)-blebbistatin Fig. 5 from Andersen et al., 2015
cardiac muscle cell decreased volume, abnormal f2Tg + MO1-tnnt2a chemical treatment: cyclosporin A Fig. 6 from Andersen et al., 2015
heart contraction arrested, abnormal f2Tg + MO1-tnnt2a standard conditions Fig. 2Fig. 5 from Andersen et al., 2015
heart contraction arrested, abnormal f2Tg + MO1-tnnt2a chemical treatment: cyclosporin A Fig. 6 from Andersen et al., 2015
cardiac muscle cell increased volume, abnormal f2Tg + MO1-tnnt2a chemical treatment: (S)-blebbistatin Fig. 5 from Andersen et al., 2015
subintestinal vein morphology, abnormal la116Tg + MO1-tnnt2a standard conditions Fig. 7 from Wu et al., 2015
subintestinal vein blood vessel morphogenesis disrupted, abnormal la116Tg + MO1-tnnt2a standard conditions Fig. 7 from Wu et al., 2015
pericardium edematous, abnormal la2042Tg + MO1-tnnt2a standard conditions Fig. 3 from Xie et al., 2008
adrenal gland development process quality, abnormal li1Tg + MO1-tnnt2a standard conditions Fig. 1 with image from Chou et al., 2014
pronephric glomerulus separated from pronephric glomerulus, abnormal li1Tg + MO1-tnnt2a standard conditions Fig. 1 with image from Chou et al., 2014
interrenal gland position, abnormal li1Tg + MO1-tnnt2a standard conditions Fig. 1 with image from Chou et al., 2014
blood circulation decreased process quality, abnormal li1Tg + MO1-tnnt2a standard conditions Fig. 1 with image from Chou et al., 2014
pronephric glomerulus morphogenesis process quality, abnormal li1Tg + MO1-tnnt2a standard conditions Fig. 1 with image from Chou et al., 2014
heart contraction decreased process quality, abnormal li1Tg + MO1-tnnt2a standard conditions Fig. 1 with image from Chou et al., 2014
interrenal angiogenic sprout mislocalised laterally, abnormal s843Tg + MO1-tnnt2a standard conditions Fig. 8 with image from Chiu et al., 2012
interrenal primordium position, abnormal s843Tg + MO1-tnnt2a standard conditions Fig. 8 with image from Chiu et al., 2012
post-vent vasculature morphology, abnormal s843Tg + MO1-tnnt2a standard conditions Fig. 7 from Mleynek et al., 2014
caudal vein plexus angiogenic sprout increased amount, abnormal s843Tg + MO1-tnnt2a standard conditions Fig. 7 from Mleynek et al., 2014
intersegmental vessel structure, abnormal s843Tg + MO1-tnnt2a standard conditions Fig. 6 with imageFig. S1 with image from Mugoni et al., 2013
endocardium hypotrophic, abnormal s843Tg + MO1-tnnt2a standard conditions Fig. 5 with image from Renz et al., 2015
blood vessel morphogenesis decreased process quality, abnormal s843Tg + MO1-tnnt2a standard conditions Fig. 7 from Mleynek et al., 2014
caudal vein plexus sprouting angiogenesis increased occurrence, abnormal s843Tg + MO1-tnnt2a standard conditions Fig. 7 from Mleynek et al., 2014
trunk vasculature morphology, abnormal s843Tg + MO1-tnnt2a standard conditions Fig. S1 with image from Mugoni et al., 2013
blood circulation disrupted, abnormal s843Tg + MO1-tnnt2a standard conditions Fig. 8 with image from Chiu et al., 2012
heart contraction arrested, abnormal s878Tg + MO1-tnnt2a standard conditions Fig. 4 with image from Arnaout et al., 2007
cardiac muscle cell cell projection transient, abnormal s883Tg + MO1-tnnt2a standard conditions Fig. 5 with image from Staudt et al., 2014
cardiac muscle cell Venus expression absent, abnormal s940Tg + MO1-tnnt2a control Fig. 6 with image from Jiménez-Amilburu et al., 2016
atrioventricular valve Venus expression absent, abnormal s940Tg + MO1-tnnt2a control Fig. 6 with image from Jiménez-Amilburu et al., 2016
cardiac muscle cell Notch signaling pathway decreased process quality, abnormal s940Tg + MO1-tnnt2a control Fig. 6 with image from Jiménez-Amilburu et al., 2016
heart Notch signaling pathway decreased process quality, abnormal s940Tg + MO1-tnnt2a control Fig. 6 with image from Jiménez-Amilburu et al., 2016
proximal convoluted tubule development arrested, abnormal sqet11Et + MO1-tnnt2a standard conditions Fig. 8 with image from Vasilyev et al., 2009
distal tubule development arrested, abnormal sqet11Et + MO1-tnnt2a standard conditions Fig. 8 with image from Vasilyev et al., 2009
simple cuboidal epithelium displaced, abnormal sqet11Et + MO1-tnnt2a standard conditions Fig. 8 with image from Vasilyev et al., 2009
simple columnar epithelium displaced, abnormal sqet11Et + MO1-tnnt2a standard conditions Fig. 8 with image from Vasilyev et al., 2009
distal tubule development arrested, abnormal sqet33D10Et + MO1-tnnt2a(AB) standard conditions Fig. 8 with image from Vasilyev et al., 2009
simple cuboidal epithelium displaced, abnormal sqet33D10Et + MO1-tnnt2a(AB) standard conditions Fig. 8 with image from Vasilyev et al., 2009
proximal convoluted tubule development arrested, abnormal sqet33D10Et + MO1-tnnt2a(AB) standard conditions Fig. 8 with image from Vasilyev et al., 2009
simple columnar epithelium displaced, abnormal sqet33D10Et + MO1-tnnt2a(AB) standard conditions Fig. 8 with image from Vasilyev et al., 2009
heart notch1b expression decreased amount, abnormal twu26Tg + MO1-tnnt2a control Fig. 4 with image from Samsa et al., 2015
heart efnb2a expression decreased amount, abnormal twu26Tg + MO1-tnnt2a control Fig. 4 with image from Samsa et al., 2015
heart nrg1 expression decreased amount, abnormal twu26Tg + MO1-tnnt2a control Fig. 4 with image from Samsa et al., 2015
endothelial cell apoptotic process increased occurrence, abnormal ubs1Tg + MO1-tnnt2a control Fig. 1 with imageFig. 5 with imageFig. 6 from Serbanovic-Canic et al., 2017
blood circulation decreased occurrence, abnormal ubs1Tg + MO1-tnnt2a control Fig. 1 with imageFig. 5 with image from Serbanovic-Canic et al., 2017
endothelial cell apoptotic process increased occurrence, ameliorated ubs1Tg + MO1-tnnt2a + MO4-tp53 control Fig. 6 from Serbanovic-Canic et al., 2017
basilar artery decreased diameter, abnormal y1Tg + MO1-tnnt2a standard conditions Fig. 3 with image from Fujita et al., 2011
intersegmental vessel blood vessel lumenization process quality, abnormal y1Tg + MO1-tnnt2a standard conditions Fig. S1 from Sauteur et al., 2014
vascular endothelium increased size, abnormal y1Tg + MO1-tnnt2a standard conditions Fig. 2 with image from Chou et al., 2010
pronephric glomerulus right side unfused from pronephric glomerulus left side, abnormal y1Tg + MO1-tnnt2a standard conditions Fig. 2 with image from Chou et al., 2010
vascular endothelium mislocalised, abnormal y1Tg + MO1-tnnt2a standard conditions Fig. 2 with image from Chou et al., 2010
central artery decreased diameter, abnormal y1Tg + MO1-tnnt2a standard conditions Fig. 3 with image from Fujita et al., 2011
caudal vein plexus decreased size, abnormal y1Tg + MO1-tnnt2a standard conditions Fig. S6 from Hogan et al., 2008
blood circulation disrupted, abnormal y1Tg + MO1-tnnt2a standard conditions Fig. S1 from Hogan et al., 2008
pronephric glomerular capillary increased size, abnormal y1Tg + MO1-tnnt2a standard conditions Fig. 2 with image from Chou et al., 2010
cranial vasculature unlumenized, abnormal y1Tg + MO1-tnnt2a standard conditions Fig. S3 from Hogan et al., 2008
blood circulation absent, abnormal y1Tg + MO1-tnnt2a standard conditions Fig. 3 with image from Fujita et al., 2011
adrenal gland development lacking processual parts cell migration, abnormal y1Tg + MO1-tnnt2a standard conditions Fig. 2 with image from Chou et al., 2010
blood circulation disrupted, abnormal zf169Tg + MO1-tnnt2a standard conditions Fig. S4 with image from Bertrand et al., 2008
interrenal gland epithelial to mesenchymal transition decreased occurrence, abnormal zf346Tg + MO1-tnnt2a standard conditions Fig. 6 with image from Chou et al., 2014
cardiac muscle cell EGFP expression mislocalised, abnormal zf517Tg + MO1-tnnt2a standard conditions Fig. 6 with image from Rasouli et al., 2017
cardiac muscle cell basal side EGFP expression absent, abnormal zf517Tg + MO1-tnnt2a standard conditions Fig. 6 with image from Rasouli et al., 2017
trunk vasculature blood vessel lumenization decreased process quality, abnormal zn1Tg + MO1-tnnt2a standard conditions Fig. S4 from Zhao et al., 2013
pericardium edematous, abnormal gz15Tg; y1Tg + MO1-tnnt2a standard conditions Fig. 5 with image from Korzh et al., 2008
liver decreased size, abnormal gz15Tg; y1Tg + MO1-tnnt2a standard conditions Fig. 6 with image from Korzh et al., 2008
hepatic sinusoid aplastic, abnormal gz15Tg; y1Tg + MO1-tnnt2a standard conditions Fig. 6 with image from Korzh et al., 2008
optic tectum microglial cell migration process quality, abnormal hkz011tTg ; tsu11Tg + MO1-tnnt2a standard conditions Fig. 2 with image from Xu et al., 2016
heart contraction decreased occurrence, abnormal hkz011tTg ; tsu11Tg + MO1-tnnt2a standard conditions Fig. 2 with image from Xu et al., 2016
optic tectum decreased width, abnormal hkz011tTg ; tsu11Tg + MO1-tnnt2a standard conditions Fig. 2 with image from Xu et al., 2016
optic tectum microglial cell decreased amount, abnormal hkz011tTg ; tsu11Tg + MO1-tnnt2a standard conditions Fig. 2 with image from Xu et al., 2016
blood circulation decreased rate, abnormal hu10049Tg; kca3Tg + MO1-tnnt2a control Fig. 4 with image from Chen et al., 2017
dorsal aorta vascular associated smooth muscle cell amount, ameliorated hu10049Tg; kca3Tg + MO1-tnnt2a control Fig. 4 with image from Chen et al., 2017
heart efnb2a expression increased amount, abnormal kca3Tg ; kca4Tg ; um14Tg ; vc6Tg + MO1-tnnt2a heat shock Fig. 5 with image from Samsa et al., 2015
heart EGFP expression absent, abnormal kca3Tg ; kca4Tg ; um14Tg ; vc6Tg + MO1-tnnt2a control Fig. 5 with image from Samsa et al., 2015
heart EGFP expression amount, ameliorated kca3Tg ; kca4Tg ; um14Tg ; vc6Tg + MO1-tnnt2a heat shock Fig. 5 with image from Samsa et al., 2015
trabecular layer absent, abnormal kca3Tg ; kca4Tg ; um14Tg ; vc6Tg + MO1-tnnt2a control Fig. 5 with image from Samsa et al., 2015
heart contraction absent, abnormal kca3Tg ; kca4Tg ; um14Tg ; vc6Tg + MO1-tnnt2a control Fig. 5 with image from Samsa et al., 2015
Notch signaling involved in heart development decreased occurrence, abnormal kca3Tg ; kca4Tg ; um14Tg ; vc6Tg + MO1-tnnt2a control Fig. 5 with image from Samsa et al., 2015
heart contraction absent, abnormal kca3Tg ; kca4Tg ; um14Tg ; vc6Tg + MO1-tnnt2a heat shock Fig. 5 with image from Samsa et al., 2015
anatomical structure EGFP expression increased amount, abnormal kca3Tg ; kca4Tg ; um14Tg ; vc6Tg + MO1-tnnt2a heat shock Fig. 5 with image from Samsa et al., 2015
trabecular layer absent, abnormal kca3Tg ; kca4Tg ; um14Tg ; vc6Tg + MO1-tnnt2a heat shock Fig. 5 with image from Samsa et al., 2015
heart nrg1 expression increased amount, abnormal kca3Tg ; kca4Tg ; um14Tg ; vc6Tg + MO1-tnnt2a heat shock Fig. 5 with image from Samsa et al., 2015
ventral wall of dorsal aorta has fewer parts of type hematopoietic stem cell, abnormal la2Tg; s896Tg + MO1-tnnt2a standard conditions Fig. 5 with image from Sawamiphak et al., 2014
blood accumulation trunk, abnormal la116Tg; sd2Tg + MO1-tnnt2a standard conditions Fig. 1 from Wang et al., 2011
tube formation process quality, abnormal nkuasrfp1aTg; ubs3Tg; ubs5Tg + MO1-tnnt2a standard conditions Fig. 4 with image from Herwig et al., 2011
blood vessel collapsed, abnormal pt505Tg; y7Tg + MO1-tnnt2a standard conditions Fig. 1 with image from Corti et al., 2011
internal carotid artery blood vessel endothelial cell migration process quality, abnormal rk8Tg; ubs4Tg + MO1-tnnt2a control Fig. 4 with image from Rochon et al., 2016
cell migration involved in heart development decreased occurrence, abnormal rk8Tg; ubs4Tg + MO1-tnnt2a control Fig. 4 with image from Rochon et al., 2016
aortic arch 1 blood vessel endothelial cell migration process quality, abnormal rk8Tg; ubs4Tg + MO1-tnnt2a control Fig. 4 with image from Rochon et al., 2016
caudal division of the internal carotid artery blood vessel endothelial cell migration process quality, abnormal rk8Tg; ubs4Tg + MO1-tnnt2a control Fig. 4 with image from Rochon et al., 2016
blood circulation decreased occurrence, abnormal rk8Tg; ubs4Tg + MO1-tnnt2a control Fig. 4 with image from Rochon et al., 2016
aortic arch 1 cell migration involved in heart development decreased occurrence, abnormal rk8Tg; ubs4Tg + MO1-tnnt2a control Fig. 4 with image from Rochon et al., 2016
dorsal aorta vascular associated smooth muscle cell mCherry expression absent, abnormal s843Tg ; uto5Tg + MO1-tnnt2a control Fig. 2 with image from Chen et al., 2017
dorsal aorta vascular associated smooth muscle cell decreased amount, abnormal s843Tg ; uto5Tg + MO1-tnnt2a control Fig. 2 with image from Chen et al., 2017
dorsal aorta anatomical region mCherry expression absent, abnormal s843Tg ; uto5Tg + MO1-tnnt2a control Fig. 2 with image from Chen et al., 2017
blood circulation decreased rate, abnormal s843Tg ; uto5Tg + MO1-tnnt2a control Fig. 2 with image from Chen et al., 2017
blood circulation arrested, abnormal s843Tg; sd2Tg + MO1-tnnt2a standard conditions Fig. 4 with image from Ellertsdottir et al., 2012
dorsal aorta structure, abnormal s843Tg; sd2Tg + MO1-tnnt2a standard conditions Fig. 4 with image from Ellertsdottir et al., 2012
blood vessel lumenization disrupted, abnormal s843Tg; sd2Tg + MO1-tnnt2a standard conditions Fig. 4 with image from Ellertsdottir et al., 2012
blood increased accumulation caudal vein, abnormal s843Tg; sd2Tg + MO1-tnnt2a standard conditions Fig. 4 with image from Ellertsdottir et al., 2012
intersegmental vessel structure, cavities, abnormal s843Tg; sd2Tg + MO1-tnnt2a standard conditions Fig. 4 with image from Ellertsdottir et al., 2012
ventricular myocardium cardiac muscle cell increased amount, abnormal s883Tg ; bns140Tg + MO1-tnnt2a standard conditions Fig. 6 with image from Rasouli et al., 2017
atrial myocardium cardiac muscle cell increased amount, abnormal s883Tg ; bns140Tg + MO1-tnnt2a standard conditions Fig. 6 with image from Rasouli et al., 2017
cardiac conduction system mislocalised, abnormal sqet33mi28Et ; f2Tg + MO1-tnnt2a standard conditions Fig. 4 with image from Poon et al., 2016
sinoatrial node increased area, abnormal sqet33mi28Et ; f2Tg + MO1-tnnt2a standard conditions Fig. 4 with image from Poon et al., 2016
sinoatrial node EGFP expression increased distribution, abnormal sqet33mi28Et ; f2Tg + MO1-tnnt2a standard conditions Fig. 4 with image from Poon et al., 2016
cardiac conduction system mislocalised, abnormal sqet33mi59BEt ; f2Tg + MO1-tnnt2a standard conditions Fig. 4 with image from Poon et al., 2016
sinoatrial node increased area, abnormal sqet33mi59BEt ; f2Tg + MO1-tnnt2a standard conditions Fig. 4 with image from Poon et al., 2016
sinoatrial node EGFP expression increased distribution, abnormal sqet33mi59BEt ; f2Tg + MO1-tnnt2a standard conditions Fig. 4 with image from Poon et al., 2016
Notch signaling involved in heart development decreased occurrence, abnormal um14Tg ; vc6Tg + MO1-tnnt2a control Fig. 2 with image from Samsa et al., 2015
heart EGFP expression absent, abnormal um14Tg ; vc6Tg + MO1-tnnt2a control Fig. 2 with image from Samsa et al., 2015
heart contraction absent, abnormal um14Tg ; vc6Tg + MO1-tnnt2a control Fig. 2 with image from Samsa et al., 2015
cardiac ventricle trabecular layer absent, abnormal vc6Tg ; s843Tg + MO1-tnnt2a control Fig. 1 with image from Samsa et al., 2015
heart contraction absent, abnormal vc6Tg ; s843Tg + MO1-tnnt2a control Fig. 1 with image from Samsa et al., 2015
trabecular layer absent, abnormal vc6Tg ; s843Tg + MO1-tnnt2a control Fig. 1 with image from Samsa et al., 2015
atrioventricular canal GCaMP expression decreased amount, abnormal zf350Tg ; ubs3Tg + MO1-tnnt2a control Fig. 4 with image from Heckel et al., 2015
blood circulation absent, abnormal acvrl1y6/y6 + MO1-tnnt2a standard conditions Fig. 2 with image from Corti et al., 2011
heart contraction absent, abnormal acvrl1y6/y6 + MO1-tnnt2a standard conditions Fig. 2 with image from Corti et al., 2011
heart increased size, abnormal ccm2m201/+ + MO1-tnnt2a standard conditions Fig. S2 with image from Cullere et al., 2015
hematopoietic multipotent progenitor cell mislocalised, abnormal gata1am651/m651 + MO1-tnnt2a standard conditions Fig. 6 with image from Jin et al., 2009
blood island hematopoietic multipotent progenitor cell absent, abnormal gata1am651/m651 + MO1-tnnt2a standard conditions Fig. 6 with image from Jin et al., 2009
definitive hemopoiesis process quality, abnormal gata1am651/m651 + MO1-tnnt2a standard conditions Fig. 6 with image from Jin et al., 2009
primitive hemopoiesis process quality, abnormal gata1am651/m651 + MO1-tnnt2a standard conditions Fig. 6 with image from Jin et al., 2009
blood circulation arrested, abnormal gata1am651/m651 + MO1-tnnt2a standard conditions Fig. 6 with image from Jin et al., 2009
erythroid progenitor cell absent, abnormal gata1am651/m651 + MO1-tnnt2a standard conditions Fig. 6 with image from Jin et al., 2009
erythrocyte differentiation process quality, abnormal gata1am651/m651 + MO1-tnnt2a standard conditions Fig. 6 with image from Jin et al., 2009
pronephros epithelial cilium movement arrested, abnormal TU + MO1-tnnt2a + MO2-ift88 standard conditions Fig. 8 with image from Gerlach et al., 2014
heart contraction arrested, abnormal TU + MO1-tnnt2a + MO2-ift88 standard conditions Fig. 8 with image from Gerlach et al., 2014
cardiac muscle cell proliferation decreased process quality, abnormal WT + MO1-scn5lab + MO1-tnnt2a + MO4-tp53 standard conditions Fig. 8 from Bennett et al., 2013
cardiac muscle cell Z disc shape, abnormal WT + MO1-tnnt2a + MO5-actn2b standard conditions Fig. 7 from Yang et al., 2012
cardiac muscle cell decreased amount, abnormal WT + MO1-tnnt2a + MO5-actn2b standard conditions Fig. 7 from Yang et al., 2012
heart contraction arrested, abnormal WT + MO1-tnnt2a + MO5-actn2b standard conditions Fig. 7 from Yang et al., 2012
cardiac muscle cell sarcomere disorganized, abnormal WT + MO1-tnnt2a + MO5-actn2b standard conditions Fig. 7 from Yang et al., 2012
endothelial cell apoptotic process increased occurrence, abnormal ubs1Tg + MO1-angptl4 + MO1-tnnt2a control Fig. 5 with image from Serbanovic-Canic et al., 2017
blood circulation decreased occurrence, abnormal ubs1Tg + MO1-angptl4 + MO1-tnnt2a control Fig. 5 with image from Serbanovic-Canic et al., 2017
endothelial cell apoptotic process increased occurrence, exacerbated ubs1Tg + MO1-cdh13 + MO1-tnnt2a control Fig. 5 with image from Serbanovic-Canic et al., 2017
blood circulation decreased occurrence, abnormal ubs1Tg + MO1-cdh13 + MO1-tnnt2a control Fig. 5 with image from Serbanovic-Canic et al., 2017
endothelial cell apoptotic process increased occurrence, ameliorated ubs1Tg + MO1-pdcd2l + MO1-tnnt2a control Fig. 5 with image from Serbanovic-Canic et al., 2017
blood circulation decreased occurrence, abnormal ubs1Tg + MO1-pdcd2l + MO1-tnnt2a control Fig. 5 with image from Serbanovic-Canic et al., 2017
endothelial cell apoptotic process increased occurrence, ameliorated ubs1Tg + MO1-pdcd2l + MO1-tnnt2a + MO4-tp53 control Fig. 6 from Serbanovic-Canic et al., 2017
endothelial cell apoptotic process increased occurrence, abnormal ubs1Tg + MO1-ptgis + MO1-tnnt2a control Fig. 5 with image from Serbanovic-Canic et al., 2017
blood circulation decreased occurrence, abnormal ubs1Tg + MO1-ptgis + MO1-tnnt2a control Fig. 5 with image from Serbanovic-Canic et al., 2017
endothelial cell apoptotic process increased occurrence, abnormal ubs1Tg + MO1-tnip1 + MO1-tnnt2a control Fig. 5 with image from Serbanovic-Canic et al., 2017
blood circulation decreased occurrence, abnormal ubs1Tg + MO1-tnip1 + MO1-tnnt2a control Fig. 5 with image from Serbanovic-Canic et al., 2017
endothelial cell apoptotic process increased occurrence, abnormal ubs1Tg + MO1-tnnt2a + MO2-angptl4 control Fig. 6 from Serbanovic-Canic et al., 2017
endothelial cell apoptotic process increased occurrence, abnormal ubs1Tg + MO1-tnnt2a + MO2-cd74a control Fig. 5 with image from Serbanovic-Canic et al., 2017
blood circulation decreased occurrence, abnormal ubs1Tg + MO1-tnnt2a + MO2-cd74a control Fig. 5 with image from Serbanovic-Canic et al., 2017
endothelial cell apoptotic process increased occurrence, abnormal ubs1Tg + MO1-tnnt2a + MO2-cd74b control Fig. 5 with image from Serbanovic-Canic et al., 2017
blood circulation decreased occurrence, abnormal ubs1Tg + MO1-tnnt2a + MO2-cd74b control Fig. 5 with image from Serbanovic-Canic et al., 2017
endothelial cell apoptotic process increased occurrence, exacerbated ubs1Tg + MO1-tnnt2a + MO2-cdh13 control Fig. 6 from Serbanovic-Canic et al., 2017
endothelial cell apoptotic process increased occurrence, ameliorated ubs1Tg + MO1-tnnt2a + MO2-pdcd2l control Fig. 6 from Serbanovic-Canic et al., 2017
endothelial cell apoptotic process increased occurrence, ameliorated ubs1Tg + MO1-tnnt2a + MO2-perp control Fig. 5 with imageFig. 6 from Serbanovic-Canic et al., 2017
blood circulation decreased occurrence, abnormal ubs1Tg + MO1-tnnt2a + MO2-perp control Fig. 5 with image from Serbanovic-Canic et al., 2017
endothelial cell apoptotic process increased occurrence, ameliorated ubs1Tg + MO1-tnnt2a + MO2-perp + MO4-tp53 control Fig. 6 from Serbanovic-Canic et al., 2017
endothelial cell apoptotic process increased occurrence, abnormal ubs1Tg + MO1-tnnt2a + MO4-jun control Fig. 5 with image from Serbanovic-Canic et al., 2017
blood circulation decreased occurrence, abnormal ubs1Tg + MO1-tnnt2a + MO4-jun control Fig. 5 with image from Serbanovic-Canic et al., 2017
endothelial cell apoptotic process increased occurrence, ameliorated ubs1Tg + MO1-pdcd2l + MO1-tnnt2a + MO2-perp control Fig. 6 from Serbanovic-Canic et al., 2017
blood vessel collapsed, abnormal acvrl1y6/y6; pt505Tg; y7Tg + MO1-tnnt2a standard conditions Fig. 1 with image from Corti et al., 2011
endocardium proliferative, abnormal ccm2m201/m201; s843Tg + MO1-tnnt2a standard conditions Fig. 5 with image from Renz et al., 2015
heart increased size, abnormal ccm2m201/m201; twu34Tg + MO1-tnnt2a standard conditions Fig. 5 with image from Renz et al., 2015
heart edematous, abnormal ccm2m201/m201; twu34Tg + MO1-tnnt2a standard conditions Fig. 5 with image from Renz et al., 2015
heart contraction arrested, abnormal kcnh6as290/s290; s878Tg + MO1-tnnt2a standard conditions Fig. 4 with imagetext only from Arnaout et al., 2007
cardiac ventricle conductivity, abnormal kcnh6as290/s290; s878Tg + MO1-tnnt2a standard conditions Fig. 4 with imagetext only from Arnaout et al., 2007
heart contraction arrested, abnormal lmo2vu270/vu270; s843Tg + MO1-tnnt2a standard conditions Fig. 6 from Weiss et al., 2012
nucleate erythrocyte absent, abnormal lmo2vu270/vu270; s843Tg + MO1-tnnt2a standard conditions Fig. 6 from Weiss et al., 2012
ocular blood vessel decreased diameter, abnormal lmo2vu270/vu270; s843Tg + MO1-tnnt2a standard conditions Fig. 6 from Weiss et al., 2012
blood circulation arrested, abnormal lmo2vu270/vu270; s843Tg + MO1-tnnt2a standard conditions Fig. 6 from Weiss et al., 2012
embryonic hemopoiesis decreased process quality, abnormal lmo2vu270/vu270; s843Tg + MO1-tnnt2a standard conditions Fig. 6 from Weiss et al., 2012
atrial endocardium mRFP1 expression decreased amount, abnormal nrg2amn0237Gt/+ ; ubs1Tg + MO1-tnnt2a standard conditions Fig. 6 with image from Rasouli et al., 2017
ventricular endocardium mRFP1 expression decreased amount, abnormal nrg2amn0237Gt/+ ; ubs1Tg + MO1-tnnt2a standard conditions Fig. 6 with image from Rasouli et al., 2017
endocardium perforate, abnormal fbn2bte382a; pku300te382b; s843Tg + MO1-tnnt2a standard conditions Fig. 4 with image from Mellman et al., 2012
OTHER MO1-tnnt2a MORPHOLINO PAGESNo links to external sites
CITATIONS (119)