Morpholino

MO1-tnnt2a

ID
ZDB-MRPHLNO-060317-4
Name
MO1-tnnt2a
Previous Names
  • MO1-tnnt2
  • tnnt2MO (1)
  • Troponin T (1)
  • MO silent heart (1)
Target
Sequence
5' - CATGTTTGCTCTGATCTGACACGCA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-tnnt2a
No data available
Phenotype
Phenotype resulting from MO1-tnnt2a
Phenotype Fish Figures
adrenal gland development lacking processual parts cell migration, abnormal y1Tg + MO1-tnnt2a Fig. 2 with image from Chou et al., 2010
adrenal gland development process quality, abnormal li1Tg + MO1-tnnt2a Fig. 1 with imageFig. 7 with image from Chou et al., 2014
anterior cardinal vein unlumenized, abnormal WT + MO1-tnnt2a Fig. 1 from Herbert et al., 2009
aortic arch 1 acvrl1 expression increased amount, abnormal WT + MO1-tnnt2a Fig. 5 from Anzell et al., 2024
aortic arch 1 cxcr4a expression increased amount, abnormal WT + MO1-tnnt2a Fig. 5 from Anzell et al., 2024
aortic arch 1 blood vessel endothelial cell migration process quality, abnormal rk8Tg; ubs4Tg + MO1-tnnt2a Fig. 4 with image from Rochon et al., 2016
aortic arch 1 cell migration involved in heart development decreased occurrence, abnormal rk8Tg; ubs4Tg + MO1-tnnt2a Fig. 4 with image from Rochon et al., 2016
artery acvrl1 expression decreased amount, abnormal WT + MO1-tnnt2a Fig. 1 from Anzell et al., 2024
artery morphogenesis delayed, abnormal WT + MO1-tnnt2a Fig. 4 from Wang et al., 2011
atrioventricular canal GCaMP expression decreased amount, abnormal ubs3Tg; zf350Tg + MO1-tnnt2a Fig. 4 with image from Heckel et al., 2015
atrioventricular canal Venus expression decreased amount, abnormal hu7135Tg + MO1-tnnt2a Fig. 1 from Fontana et al., 2020
atrioventricular canal blood circulation decreased process quality, abnormal y7Tg/y7Tg + MO1-tnnt2a Fig. 4 from Vignes et al., 2022
atrioventricular canal calcium ion decreased amount, abnormal nkUAShspzGCaMP6s13aTg; ubs4Tg + MO1-tnnt2a Fig. 4 with image from Juan et al., 2023
atrioventricular canal cytoskeleton organization decreased process quality, abnormal y7Tg/y7Tg + MO1-tnnt2a Fig. 4 from Vignes et al., 2022
atrioventricular canal endothelial cell migration decreased process quality, abnormal rk8Tg; ubs4Tg + MO1-tnnt2a Fig. 5. with image from da Silva et al., 2024
atrioventricular canal Golgi organization decreased process quality, abnormal y7Tg/y7Tg + MO1-tnnt2a Fig. 4 from Vignes et al., 2022
atrioventricular canal nucleus EGFP expression decreased amount, abnormal y7Tg/y7Tg + MO1-tnnt2a Fig. 4 from Vignes et al., 2022
atrioventricular canal nucleus EGFP expression spatial pattern, abnormal y7Tg/y7Tg + MO1-tnnt2a Fig. 4 from Vignes et al., 2022
atrioventricular canal regulation of cell size decreased process quality, abnormal y7Tg/y7Tg + MO1-tnnt2a Fig. 4 from Vignes et al., 2022
atrioventricular canal endocardium alcama expression absent, abnormal rk8Tg; ubs4Tg + MO1-tnnt2a Fig. 5. with image from da Silva et al., 2024
atrioventricular canal endocardium EGFP expression decreased amount, abnormal nkuasgfp1aTg; pbb65Tg + MO1-tnnt2a Figure 1 with image from Paolini et al., 2021
atrioventricular valve Venus expression absent, abnormal s940Tg + MO1-tnnt2a Fig. 6 with image from Jiménez-Amilburu et al., 2016
atrioventricular valve formation decreased process quality, abnormal nkuasgfp1aTg; pbb65Tg + MO1-tnnt2a Fig. 5. with image from da Silva et al., 2024
Figure 1 with image from Paolini et al., 2021
atrium cardiac muscle contraction arrested, abnormal s974Tg + MO1-tnnt2a Fig. 2 with image from Rasouli et al., 2018
basal communicating artery acvrl1 expression absent, abnormal WT + MO1-tnnt2a Fig. 1 from Anzell et al., 2024
basal communicating artery acvrl1 expression decreased amount, abnormal WT + MO1-tnnt2a Fig. 5 from Anzell et al., 2024
basal communicating artery cxcr4a expression increased amount, abnormal WT + MO1-tnnt2a Fig. 5 from Anzell et al., 2024
basibranchial condensed, abnormal WT + MO1-tnnt2a Fig. 4 with image from Anderson et al., 2008
basilar artery decreased diameter, abnormal y1Tg + MO1-tnnt2a Fig. 3 with image from Fujita et al., 2011
blood accumulation trunk, abnormal WT + MO1-tnnt2a Fig. 1Fig. 2 from Wang et al., 2011
blood flow rate, abnormal AB + MO1-tnnt2a Fig. 7 with image from Murayama et al., 2006
blood increased accumulation caudal vein, abnormal s843Tg; sd2Tg + MO1-tnnt2a Fig. 4 with image from Ellertsdottir et al., 2012
blood circulation absent, abnormal y1Tg + MO1-tnnt2a Fig. 3 with image from Fujita et al., 2011
blood circulation arrested, abnormal WT + MO1-tnnt2a Fig. 5. with image from da Silva et al., 2024
Figure 1 with image from Paolini et al., 2021
Fig. 1 with image from Donat et al., 2018
Fig. 4 with image from Ellertsdottir et al., 2012
Fig. 6 with image from Bussmann et al., 2011
Fig. 1 from Herbert et al., 2009
blood circulation decreased occurrence, abnormal rk8Tg; ubs4Tg + MO1-tnnt2a Fig. 2 from Rödel et al., 2019
Fig. 1 with imageFig. 5 with image from Serbanovic-Canic et al., 2017
Fig. 4 with image from Rochon et al., 2016
blood circulation decreased process quality, abnormal li1Tg + MO1-tnnt2a Fig. 1 with image from Chou et al., 2014
blood circulation decreased rate, abnormal s843Tg; uto5Tg + MO1-tnnt2a Fig. 2 with image from Chen et al., 2017
blood circulation disrupted, abnormal s843Tg + MO1-tnnt2a Fig. 8 with image from Chiu et al., 2012
Fig. S1 from Hogan et al., 2008
Fig. 7 with image from Murayama et al., 2006
blood vessel collapsed, abnormal pt505Tg; y7Tg + MO1-tnnt2a Fig. 1 with image from Corti et al., 2011
blood vessel lumenization disrupted, abnormal s843Tg; sd2Tg + MO1-tnnt2a Fig. 4 with image from Ellertsdottir et al., 2012
blood vessel morphogenesis decreased process quality, abnormal s843Tg + MO1-tnnt2a Fig. 7 from Mleynek et al., 2014
blood vessel remodeling disrupted, abnormal s843Tg + MO1-tnnt2a Fig. S13 with image from Chen et al., 2012
brain vasculature hemorrhagic, abnormal WT + MO1-tnnt2a Fig. S1 with image from Mugoni et al., 2013
bulbus arteriosus decreased diameter, abnormal zf495Tg + MO1-tnnt2a Figure 6 with image from Duchemin et al., 2019
bulbus arteriosus lacks all parts of type ventriculo bulbo valve, abnormal um14Tg + MO1-tnnt2a Figure 6 with image from Duchemin et al., 2019
bulbus arteriosus endocardial cushion EGFP expression spatial pattern, abnormal um14Tg + MO1-tnnt2a Figure 6 with image from Duchemin et al., 2019
bulbus arteriosus smooth muscle tissue development decreased process quality, abnormal zf495Tg + MO1-tnnt2a Figure 6 with image from Duchemin et al., 2019
bulbus arteriosus vascular smooth muscle ab1-elnb labeling decreased amount, abnormal zf495Tg + MO1-tnnt2a Figure 6 with image from Duchemin et al., 2019
bulbus arteriosus vascular smooth muscle yap1 expression decreased amount, abnormal zf495Tg + MO1-tnnt2a Figure 6 with image from Duchemin et al., 2019
bulbus arteriosus vascular smooth muscle ab2-fn labeling decreased amount, abnormal zf495Tg + MO1-tnnt2a Figure 6 with image from Duchemin et al., 2019
cardiac conduction system mislocalised, abnormal f2Tg; sqet33mi59BEt + MO1-tnnt2a Fig. 4 with image from Poon et al., 2016
cardiac muscle cell Venus expression absent, abnormal s940Tg + MO1-tnnt2a Fig. 6 with image from Jiménez-Amilburu et al., 2016
cardiac muscle cell electric potential, abnormal WT + MO1-tnnt2a Fig. 4 with image from Becker et al., 2011
cardiac muscle cell EGFP expression mislocalised, abnormal zf517Tg + MO1-tnnt2a Fig. 6 with image from Rasouli et al., 2017
cardiac muscle cell basal side EGFP expression absent, abnormal zf517Tg + MO1-tnnt2a Fig. 6 with image from Rasouli et al., 2017
cardiac muscle cell cell projection transient, abnormal s883Tg + MO1-tnnt2a Fig. 5 with image from Staudt et al., 2014
cardiac muscle cell Notch signaling pathway decreased process quality, abnormal s940Tg + MO1-tnnt2a Fig. 6 with image from Jiménez-Amilburu et al., 2016
cardiac muscle cell sarcomere disorganized, abnormal WT + MO1-tnnt2a Fig. 7 from Yang et al., 2012
cardiac ventricle Venus expression decreased amount, abnormal hu7135Tg + MO1-tnnt2a Fig. 1 from Fontana et al., 2020
cardiac ventricle cardiac muscle contraction arrested, abnormal s974Tg + MO1-tnnt2a Fig. 2 with image from Rasouli et al., 2018
cardiac ventricle trabecular layer absent, abnormal s843Tg; vc6Tg + MO1-tnnt2a Fig. 1 with image from Samsa et al., 2015
caudal division of the internal carotid artery acvrl1 expression absent, abnormal WT + MO1-tnnt2a Fig. 1 from Anzell et al., 2024
caudal division of the internal carotid artery acvrl1 expression decreased amount, abnormal WT + MO1-tnnt2a Fig. 1Fig. 5 from Anzell et al., 2024
caudal division of the internal carotid artery cxcr4a expression increased amount, abnormal WT + MO1-tnnt2a Fig. 5 from Anzell et al., 2024
caudal division of the internal carotid artery blood vessel endothelial cell migration process quality, abnormal rk8Tg; ubs4Tg + MO1-tnnt2a Fig. 4 with image from Rochon et al., 2016
caudal vein plexus kdrl expression decreased distribution, abnormal WT + MO1-tnnt2a Fig. 5 from Xie et al., 2018
caudal vein plexus klf2a expression decreased distribution, abnormal WT + MO1-tnnt2a Fig. 4 from Xie et al., 2018
caudal vein plexus decreased size, abnormal y1Tg + MO1-tnnt2a Fig. S6 from Hogan et al., 2008
caudal vein plexus fused with caudal vein plexus, abnormal s843Tg + MO1-tnnt2a Fig. Online I from Rödel et al., 2019
caudal vein plexus malformed, abnormal s843Tg + MO1-tnnt2a Fig. 1Fig. 5 from Xie et al., 2018
caudal vein plexus morphology, abnormal s843Tg + MO1-tnnt2a Fig. 1 from Rödel et al., 2019
caudal vein plexus angiogenic sprout increased amount, abnormal s843Tg + MO1-tnnt2a Fig. 7 from Mleynek et al., 2014
caudal vein plexus sprouting angiogenesis decreased occurrence, abnormal s843Tg + MO1-tnnt2a Fig. 1Fig. 5 from Xie et al., 2018
caudal vein plexus sprouting angiogenesis increased occurrence, abnormal s843Tg + MO1-tnnt2a Fig. 7 from Mleynek et al., 2014
cell migration involved in heart development decreased occurrence, abnormal rk8Tg; ubs4Tg + MO1-tnnt2a Fig. 4 with image from Rochon et al., 2016
central artery decreased diameter, abnormal y1Tg + MO1-tnnt2a Fig. 3 with image from Fujita et al., 2011
central artery physical object quality, abnormal WT + MO1-tnnt2a Fig. 6 with image from Bussmann et al., 2011
central artery angiogenic sprout increased amount, abnormal s843Tg + MO1-tnnt2a Fig. Online I from Rödel et al., 2019
ceratobranchial cartilage orientation ceratobranchial cartilage, abnormal WT + MO1-tnnt2a Fig. 4 with image from Anderson et al., 2008
ceratohyal cartilage orientation ceratohyal cartilage, abnormal WT + MO1-tnnt2a Fig. 4 with image from Anderson et al., 2008
chromaffin cell mislocalised, abnormal WT + MO1-tnnt2a Fig. 7 with image from Chou et al., 2014
common cardinal vein blood vessel endothelial cell decreased amount, abnormal WT + MO1-tnnt2a Fig. 8 with image from Helker et al., 2013
cranial vasculature unlumenized, abnormal y1Tg + MO1-tnnt2a Fig. S3 from Hogan et al., 2008
distal tubule development arrested, abnormal sqet33D10Et + MO1-tnnt2a (AB) Fig. 8 with image from Vasilyev et al., 2009
dorsal aorta acvrl1 expression decreased amount, abnormal WT + MO1-tnnt2a Fig. 1 from Anzell et al., 2024
dorsal aorta dilated, abnormal WT + MO1-tnnt2a Fig. 4 with imageFig. 7 with image from Ichimura et al., 2012
dorsal aorta structure, abnormal s843Tg; sd2Tg + MO1-tnnt2a Fig. 4 with image from Ellertsdottir et al., 2012
dorsal aorta unlumenized, abnormal WT + MO1-tnnt2a Fig. 4 from Wang et al., 2011
dorsal aorta anatomical region mCherry expression absent, abnormal s843Tg; uto5Tg + MO1-tnnt2a Fig. 2 with image from Chen et al., 2017
dorsal aorta vascular associated smooth muscle cell mCherry expression absent, abnormal s843Tg; uto5Tg + MO1-tnnt2a Fig. 2 with image from Chen et al., 2017
dorsal aorta vascular associated smooth muscle cell decreased amount, abnormal s843Tg; uto5Tg + MO1-tnnt2a Fig. 2 with image from Chen et al., 2017
endocardium hypotrophic, abnormal s843Tg + MO1-tnnt2a Fig. 5 with image from Renz et al., 2015
endothelial cell apoptotic process increased occurrence, abnormal ubs1Tg + MO1-tnnt2a Fig. 1 with imageFig. 5 with imageFig. 6 from Serbanovic-Canic et al., 2017
endothelial cell apoptotic process increased occurrence, ameliorated ubs1Tg + MO1-tnnt2a + MO4-tp53 Fig. 6 from Serbanovic-Canic et al., 2017
heart EGFP expression absent, abnormal um14Tg; vc6Tg + MO1-tnnt2a Fig. 2 with image from Samsa et al., 2015
heart heg1 expression decreased amount, abnormal WT + MO1-tnnt2a Fig. 1 from Fontana et al., 2020
heart nrg1 expression decreased amount, abnormal twu26Tg + MO1-tnnt2a Fig. 4 with image from Samsa et al., 2015
heart notch1b expression decreased amount, abnormal WT + MO1-tnnt2a Fig. 1 from Fontana et al., 2020
Fig. 4 with image from Samsa et al., 2015
heart efnb2a expression decreased amount, abnormal twu26Tg + MO1-tnnt2a Fig. 4 with image from Samsa et al., 2015
heart Citrine expression decreased amount, abnormal hu7135Tg + MO1-tnnt2a Fig. 1 from Fontana et al., 2020
heart flt1 expression decreased amount, abnormal WT + MO1-tnnt2a Fig. 1 from Fontana et al., 2020
heart decreased size, abnormal s843Tg + MO1-tnnt2a Fig. Online I from Rödel et al., 2019
heart flt4 expression increased amount, abnormal WT + MO1-tnnt2a Fig. 1 from Fontana et al., 2020
heart Citrine expression increased amount, abnormal hu7135Tg + MO1-tnnt2a Fig. 1 from Fontana et al., 2020
heart morphology, abnormal WT + MO1-tnnt2a Fig. S1 with image from Mugoni et al., 2013
heart Notch signaling pathway decreased process quality, abnormal s940Tg + MO1-tnnt2a Fig. 6 with image from Jiménez-Amilburu et al., 2016
heart contraction absent, abnormal s843Tg; vc6Tg + MO1-tnnt2a Fig. 1 with imageFig. 2 with image from Samsa et al., 2015
heart contraction arrested, abnormal TU + MO1-tnnt2a Fig. 5. with image from da Silva et al., 2024
Figure 1 with image from Paolini et al., 2021
Fig. 2Fig. 5 from Andersen et al., 2015
Fig. 8 with image from Gerlach et al., 2014
Fig. 4 with image from Arnaout et al., 2007
heart contraction decreased frequency, abnormal zf495Tg + MO1-tnnt2a Figure 6 with image from Duchemin et al., 2019
heart contraction decreased occurrence, abnormal hkz011tTg; tsu11Tg + MO1-tnnt2a Fig. 2 with image from Xu et al., 2016
heart contraction decreased process quality, abnormal li1Tg + MO1-tnnt2a Fig. 1 with image from Chou et al., 2014
hematopoietic multipotent progenitor cell decreased amount, abnormal WT + MO1-tnnt2a Fig. 7 from Wang et al., 2011
hematopoietic system decreased functionality, abnormal AB + MO1-tnnt2a Fig. 7 with image from Murayama et al., 2006
hepatic sinusoid aplastic, abnormal gz15Tg; y1Tg + MO1-tnnt2a Fig. 6 with image from Korzh et al., 2008
internal carotid artery acvrl1 expression decreased amount, abnormal WT + MO1-tnnt2a Fig. 5 from Anzell et al., 2024
internal carotid artery cxcr4a expression increased amount, abnormal WT + MO1-tnnt2a Fig. 5 from Anzell et al., 2024
internal carotid artery blood vessel endothelial cell migration process quality, abnormal rk8Tg; ubs4Tg + MO1-tnnt2a Fig. 4 with image from Rochon et al., 2016
interrenal angiogenic sprout mislocalised laterally, abnormal s843Tg + MO1-tnnt2a Fig. 8 with image from Chiu et al., 2012
interrenal gland position, abnormal li1Tg + MO1-tnnt2a Fig. 1 with image from Chou et al., 2014
interrenal gland animal organ morphogenesis process quality, abnormal WT + MO1-tnnt2a Fig. 7 with image from Chou et al., 2014
interrenal gland epithelial to mesenchymal transition decreased occurrence, abnormal zf346Tg + MO1-tnnt2a Fig. 6 with image from Chou et al., 2014
interrenal primordium position, abnormal s843Tg + MO1-tnnt2a Fig. 8 with image from Chiu et al., 2012
intersegmental vessel collapsed, abnormal s843Tg + MO1-tnnt2a Fig. Online I from Rödel et al., 2019
intersegmental vessel decreased size, abnormal s843Tg + MO1-tnnt2a Fig. Online I from Rödel et al., 2019
intersegmental vessel morphology, abnormal s843Tg + MO1-tnnt2a Fig. 1 from Rödel et al., 2019
intersegmental vessel structure, abnormal s843Tg + MO1-tnnt2a Fig. 6 with imageFig. S1 with image from Mugoni et al., 2013
intersegmental vessel structure, cavities, abnormal s843Tg; sd2Tg + MO1-tnnt2a Fig. 4 with image from Ellertsdottir et al., 2012
intersegmental vessel blood vessel lumenization process quality, abnormal y1Tg + MO1-tnnt2a Fig. S1 from Sauteur et al., 2014
lateral dorsal aorta Citrine expression absent, abnormal mu107Tg + MO1-tnnt2a Fig. 2 from Rödel et al., 2019
lateral dorsal aorta acvrl1 expression decreased amount, abnormal WT + MO1-tnnt2a Fig. 1 from Anzell et al., 2024
lateral dorsal aorta morphology, abnormal s843Tg + MO1-tnnt2a Fig. 1 from Rödel et al., 2019
liver decreased size, abnormal gz15Tg/gz15Tg + MO1-tnnt2a Fig. 6 with image from Korzh et al., 2008
midbrain blood vasculature has fewer parts of type blood vessel, abnormal s843Tg + MO1-tnnt2a Fig. S13 with image from Chen et al., 2012
midbrain blood vasculature morphology, abnormal s843Tg + MO1-tnnt2a Fig. S13 with image from Chen et al., 2012
nitric oxide biosynthetic process disrupted, abnormal WT + MO1-tnnt2a Fig. 7 from Wang et al., 2011
Notch signaling involved in heart development decreased occurrence, abnormal um14Tg; vc6Tg + MO1-tnnt2a Fig. 2 with image from Samsa et al., 2015
nucleate erythrocyte development disrupted, abnormal WT + MO1-tnnt2a Fig. 8 with image from Helker et al., 2013
ocular blood vessel EGFP expression spatial pattern, abnormal sd2Tg/sd2Tg; y1Tg/y1Tg + MO1-tnnt2a Fig. 7 from Yue et al., 2021
ocular blood vessel blood vessel lumenization decreased process quality, abnormal sd2Tg/sd2Tg; y1Tg/y1Tg + MO1-tnnt2a Fig. 7 from Yue et al., 2021
ocular blood vessel morphogenesis of a branching structure decreased process quality, abnormal sd2Tg/sd2Tg; y1Tg/y1Tg + MO1-tnnt2a Fig. 7 from Yue et al., 2021
optic tectum decreased width, abnormal hkz011tTg; tsu11Tg + MO1-tnnt2a Fig. 2 with image from Xu et al., 2016
optic tectum microglial cell decreased amount, abnormal hkz011tTg; tsu11Tg + MO1-tnnt2a Fig. 2 with image from Xu et al., 2016
optic tectum microglial cell migration process quality, abnormal hkz011tTg; tsu11Tg + MO1-tnnt2a Fig. 2 with image from Xu et al., 2016
palatoquadrate arch decreased length, abnormal WT + MO1-tnnt2a Fig. 4 with image from Anderson et al., 2008
pericardium edematous, abnormal gz15Tg/gz15Tg + MO1-tnnt2a Fig. 5 with image from Korzh et al., 2008
Fig. 6 with image from Serluca, 2008
Fig. 3 from Xie et al., 2008
post-vent vasculature morphology, abnormal s843Tg + MO1-tnnt2a Fig. 7 from Mleynek et al., 2014
posterior cardinal vein unlumenized, abnormal WT + MO1-tnnt2a Fig. 1 from Herbert et al., 2009
pronephric glomerular capillary increased size, abnormal y1Tg + MO1-tnnt2a Fig. 2 with image from Chou et al., 2010
pronephric glomerulus disorganized, abnormal WT + MO1-tnnt2a Fig. 6 with imageFig. 7 with image from Ichimura et al., 2012
pronephric glomerulus hypoplastic, abnormal WT + MO1-tnnt2a Fig. 4 with imageFig. 7 with image from Ichimura et al., 2012
pronephric glomerulus lacks all parts of type pronephric glomerular capillary, abnormal WT + MO1-tnnt2a Fig. 4 with image from Ichimura et al., 2012
pronephric glomerulus morphology, abnormal WT + MO1-tnnt2a Fig. 4 with image from Ichimura et al., 2012
pronephric glomerulus separated from pronephric glomerulus, abnormal li1Tg + MO1-tnnt2a Fig. 1 with image from Chou et al., 2014
pronephric glomerulus unfused from pronephric glomerulus, abnormal WT + MO1-tnnt2a Fig. 4 with imageFig. 7 with image from Ichimura et al., 2012
pronephric glomerulus right side unfused from pronephric glomerulus left side, abnormal y1Tg + MO1-tnnt2a Fig. 2 with image from Chou et al., 2010
pronephric glomerulus morphogenesis process quality, abnormal li1Tg + MO1-tnnt2a Fig. 1 with image from Chou et al., 2014
pronephric podocyte nphs1 expression spatial pattern, abnormal WT + MO1-tnnt2a Fig. 7 with image from Ichimura et al., 2012
pronephros development process quality, abnormal WT + MO1-tnnt2a Fig. 4 with image from Ichimura et al., 2012
proximal convoluted tubule development arrested, abnormal sqet11Et + MO1-tnnt2a Fig. 8 with image from Vasilyev et al., 2009
regulation of cardiac muscle contraction by calcium ion signaling disrupted, abnormal WT + MO1-tnnt2a Fig. 4 with image from Becker et al., 2011
simple columnar epithelium displaced, abnormal sqet33D10Et + MO1-tnnt2a (AB) Fig. 8 with image from Vasilyev et al., 2009
simple cuboidal epithelium displaced, abnormal sqet11Et + MO1-tnnt2a Fig. 8 with image from Vasilyev et al., 2009
sinoatrial node increased area, abnormal f2Tg; sqet33mi59BEt + MO1-tnnt2a Fig. 4 with image from Poon et al., 2016
sinoatrial node EGFP expression increased distribution, abnormal f2Tg; sqet33mi59BEt + MO1-tnnt2a Fig. 4 with image from Poon et al., 2016
sprouting angiogenesis process quality, abnormal WT + MO1-tnnt2a Fig. 6 with image from Bussmann et al., 2011
subintestinal vein morphology, abnormal la116Tg + MO1-tnnt2a Fig. 7 from Wu et al., 2015
subintestinal vein blood vessel morphogenesis disrupted, abnormal la116Tg + MO1-tnnt2a Fig. 7 from Wu et al., 2015
subintestinal venous plexus EGFP expression spatial pattern, abnormal sd2Tg/sd2Tg; y1Tg/y1Tg + MO1-tnnt2a Fig. 3 from Yue et al., 2021
subintestinal venous plexus morphogenesis of a branching structure decreased process quality, abnormal sd2Tg/sd2Tg; y1Tg/y1Tg + MO1-tnnt2a Fig. 3 from Yue et al., 2021
thymus decreased size, abnormal WT + MO1-tnnt2a Fig. 2 from Wang et al., 2011
thymus hematopoietic multipotent progenitor cell decreased amount, abnormal WT + MO1-tnnt2a Fig. 2 from Wang et al., 2011
trabecular layer absent, abnormal s843Tg; vc6Tg + MO1-tnnt2a Fig. 1 with image from Samsa et al., 2015
trunk anterior side increased accumulation nucleate erythrocyte, abnormal AB + MO1-tnnt2a Fig. 7 with image from Murayama et al., 2006
trunk hematopoietic multipotent progenitor cell decreased amount, abnormal WT + MO1-tnnt2a Fig. 2Fig. 5 from Wang et al., 2011
trunk vasculature klf2a expression decreased amount, abnormal WT + MO1-tnnt2a Fig. S1 with image from Novodvorsky et al., 2015
trunk vasculature morphology, abnormal s843Tg + MO1-tnnt2a Fig. S1 with image from Mugoni et al., 2013
trunk vasculature blood vessel lumenization decreased process quality, abnormal zn1Tg + MO1-tnnt2a Fig. S4 from Zhao et al., 2013
vascular endothelium increased size, abnormal y1Tg + MO1-tnnt2a Fig. 2 with image from Chou et al., 2010
vascular endothelium mislocalised, abnormal y1Tg + MO1-tnnt2a Fig. 2 with image from Chou et al., 2010
venous blood vessel morphogenesis disrupted, abnormal WT + MO1-tnnt2a Fig. 1 from Herbert et al., 2009
ventral wall of dorsal aorta has fewer parts of type hematopoietic stem cell, abnormal la2Tg; s896Tg + MO1-tnnt2a Fig. 5 with image from Sawamiphak et al., 2014
ventral wall of dorsal aorta hematopoietic stem cell myb expression decreased amount, abnormal WT + MO1-tnnt2a Fig. S5 with image from Novodvorsky et al., 2015
ventral wall of dorsal aorta hematopoietic stem cell runx1 expression decreased amount, abnormal WT + MO1-tnnt2a Fig. S5 with image from Novodvorsky et al., 2015
whole organism heg1 expression decreased amount, abnormal WT + MO1-tnnt2a Fig. 1 with image from Donat et al., 2018
whole organism foxc1b expression decreased amount, abnormal WT + MO1-tnnt2a Fig. 6 with image from Chen et al., 2017
whole organism foxc1a expression decreased amount, abnormal WT + MO1-tnnt2a Fig. 6 with image from Chen et al., 2017
Phenotype of all Fish created by or utilizing MO1-tnnt2a
Phenotype Fish Conditions Figures
pericardium edematous, abnormal gz15Tg/gz15Tg + MO1-tnnt2a standard conditions Fig. 5 with image from Korzh et al., 2008
liver decreased size, abnormal gz15Tg/gz15Tg + MO1-tnnt2a standard conditions Fig. 6 with image from Korzh et al., 2008
hepatic sinusoid aplastic, abnormal gz15Tg/gz15Tg + MO1-tnnt2a standard conditions Fig. 6 with image from Korzh et al., 2008
atrioventricular canal regulation of cell size decreased process quality, abnormal y7Tg/y7Tg + MO1-tnnt2a standard conditions Fig. 4 from Vignes et al., 2022
atrioventricular canal Golgi organization decreased process quality, abnormal y7Tg/y7Tg + MO1-tnnt2a standard conditions Fig. 4 from Vignes et al., 2022
atrioventricular canal cytoskeleton organization decreased process quality, abnormal y7Tg/y7Tg + MO1-tnnt2a standard conditions Fig. 4 from Vignes et al., 2022
atrioventricular canal nucleus EGFP expression decreased amount, abnormal y7Tg/y7Tg + MO1-tnnt2a standard conditions Fig. 4 from Vignes et al., 2022
atrioventricular canal blood circulation decreased process quality, abnormal y7Tg/y7Tg + MO1-tnnt2a standard conditions Fig. 4 from Vignes et al., 2022
atrioventricular canal nucleus EGFP expression spatial pattern, abnormal y7Tg/y7Tg + MO1-tnnt2a standard conditions Fig. 4 from Vignes et al., 2022
blood circulation disrupted, abnormal AB + MO1-tnnt2a standard conditions Fig. 7 with image from Murayama et al., 2006
hematopoietic system decreased functionality, abnormal AB + MO1-tnnt2a standard conditions Fig. 7 with image from Murayama et al., 2006
trunk anterior side increased accumulation nucleate erythrocyte, abnormal AB + MO1-tnnt2a standard conditions Fig. 7 with image from Murayama et al., 2006
blood flow rate, abnormal AB + MO1-tnnt2a standard conditions Fig. 7 with image from Murayama et al., 2006
heart contraction arrested, abnormal TU + MO1-tnnt2a standard conditions Fig. 8 with image from Gerlach et al., 2014
pronephric glomerulus morphology, abnormal WT + MO1-tnnt2a standard conditions Fig. 4 with image from Ichimura et al., 2012
internal carotid artery cxcr4a expression increased amount, abnormal WT + MO1-tnnt2a control Fig. 5 from Anzell et al., 2024
hematopoietic multipotent progenitor cell decreased amount, abnormal WT + MO1-tnnt2a standard conditions Fig. 7 from Wang et al., 2011
pronephric glomerulus hypoplastic, abnormal WT + MO1-tnnt2a standard conditions Fig. 4 with imageFig. 7 with image from Ichimura et al., 2012
heart flt1 expression decreased amount, abnormal WT + MO1-tnnt2a standard conditions Fig. 1 from Fontana et al., 2020
pericardium edematous, abnormal WT + MO1-tnnt2a standard conditions Fig. 6 with image from Serluca, 2008
basal communicating artery acvrl1 expression decreased amount, abnormal WT + MO1-tnnt2a control Fig. 5 from Anzell et al., 2024
dorsal aorta dilated, abnormal WT + MO1-tnnt2a standard conditions Fig. 4 with imageFig. 7 with image from Ichimura et al., 2012
pronephric glomerulus lacks all parts of type pronephric glomerular capillary, abnormal WT + MO1-tnnt2a standard conditions Fig. 4 with image from Ichimura et al., 2012
caudal vein plexus klf2a expression decreased distribution, abnormal WT + MO1-tnnt2a standard conditions Fig. 4 from Xie et al., 2018
anterior cardinal vein unlumenized, abnormal WT + MO1-tnnt2a standard conditions Fig. 1 from Herbert et al., 2009
brain vasculature hemorrhagic, abnormal WT + MO1-tnnt2a standard conditions Fig. S1 with image from Mugoni et al., 2013
posterior cardinal vein unlumenized, abnormal WT + MO1-tnnt2a standard conditions Fig. 1 from Herbert et al., 2009
trunk vasculature klf2a expression decreased amount, abnormal WT + MO1-tnnt2a standard conditions Fig. S1 with image from Novodvorsky et al., 2015
venous blood vessel morphogenesis disrupted, abnormal WT + MO1-tnnt2a standard conditions Fig. 1 from Herbert et al., 2009
cardiac muscle cell electric potential, abnormal WT + MO1-tnnt2a standard conditions Fig. 4 with image from Becker et al., 2011
cardiac muscle cell sarcomere disorganized, abnormal WT + MO1-tnnt2a standard conditions Fig. 7 from Yang et al., 2012
heart notch1b expression decreased amount, abnormal WT + MO1-tnnt2a standard conditions Fig. 1 from Fontana et al., 2020
pronephric podocyte nphs1 expression spatial pattern, abnormal WT + MO1-tnnt2a standard conditions Fig. 7 with image from Ichimura et al., 2012
caudal vein plexus kdrl expression decreased distribution, abnormal WT + MO1-tnnt2a control Fig. 5 from Xie et al., 2018
central artery physical object quality, abnormal WT + MO1-tnnt2a standard conditions Fig. 6 with image from Bussmann et al., 2011
internal carotid artery acvrl1 expression decreased amount, abnormal WT + MO1-tnnt2a control Fig. 5 from Anzell et al., 2024
artery morphogenesis delayed, abnormal WT + MO1-tnnt2a standard conditions Fig. 4 from Wang et al., 2011
whole organism foxc1a expression decreased amount, abnormal WT + MO1-tnnt2a control Fig. 6 with image from Chen et al., 2017
lateral dorsal aorta acvrl1 expression decreased amount, abnormal WT + MO1-tnnt2a standard conditions Fig. 1 from Anzell et al., 2024
basibranchial condensed, abnormal WT + MO1-tnnt2a standard conditions Fig. 4 with image from Anderson et al., 2008
ceratobranchial cartilage orientation ceratobranchial cartilage, abnormal WT + MO1-tnnt2a standard conditions Fig. 4 with image from Anderson et al., 2008
sprouting angiogenesis process quality, abnormal WT + MO1-tnnt2a standard conditions Fig. 6 with image from Bussmann et al., 2011
artery acvrl1 expression decreased amount, abnormal WT + MO1-tnnt2a standard conditions Fig. 1 from Anzell et al., 2024
basal communicating artery cxcr4a expression increased amount, abnormal WT + MO1-tnnt2a control Fig. 5 from Anzell et al., 2024
adrenal gland development process quality, abnormal WT + MO1-tnnt2a standard conditions Fig. 7 with image from Chou et al., 2014
heart morphology, abnormal WT + MO1-tnnt2a standard conditions Fig. S1 with image from Mugoni et al., 2013
pronephric glomerulus disorganized, abnormal WT + MO1-tnnt2a standard conditions Fig. 6 with imageFig. 7 with image from Ichimura et al., 2012
ceratohyal cartilage orientation ceratohyal cartilage, abnormal WT + MO1-tnnt2a standard conditions Fig. 4 with image from Anderson et al., 2008
trunk hematopoietic multipotent progenitor cell decreased amount, abnormal WT + MO1-tnnt2a standard conditions Fig. 2Fig. 5 from Wang et al., 2011
blood circulation arrested, abnormal WT + MO1-tnnt2a standard conditions Fig. 1 with image from Donat et al., 2018
Fig. 6 with image from Bussmann et al., 2011
Fig. 1 from Herbert et al., 2009
ventral wall of dorsal aorta hematopoietic stem cell myb expression decreased amount, abnormal WT + MO1-tnnt2a standard conditions Fig. S5 with image from Novodvorsky et al., 2015
whole organism foxc1b expression decreased amount, abnormal WT + MO1-tnnt2a control Fig. 6 with image from Chen et al., 2017
regulation of cardiac muscle contraction by calcium ion signaling disrupted, abnormal WT + MO1-tnnt2a standard conditions Fig. 4 with image from Becker et al., 2011
thymus decreased size, abnormal WT + MO1-tnnt2a standard conditions Fig. 2 from Wang et al., 2011
whole organism heg1 expression decreased amount, abnormal WT + MO1-tnnt2a standard conditions Fig. 1 with image from Donat et al., 2018
pronephric glomerulus unfused from pronephric glomerulus, abnormal WT + MO1-tnnt2a standard conditions Fig. 4 with imageFig. 7 with image from Ichimura et al., 2012
caudal division of the internal carotid artery acvrl1 expression decreased amount, abnormal WT + MO1-tnnt2a standard conditions Fig. 1Fig. 5 from Anzell et al., 2024
dorsal aorta acvrl1 expression decreased amount, abnormal WT + MO1-tnnt2a standard conditions Fig. 1 from Anzell et al., 2024
common cardinal vein blood vessel endothelial cell decreased amount, abnormal WT + MO1-tnnt2a standard conditions Fig. 8 with image from Helker et al., 2013
caudal division of the internal carotid artery acvrl1 expression absent, abnormal WT + MO1-tnnt2a standard conditions Fig. 1 from Anzell et al., 2024
ventral wall of dorsal aorta hematopoietic stem cell runx1 expression decreased amount, abnormal WT + MO1-tnnt2a standard conditions Fig. S5 with image from Novodvorsky et al., 2015
heart flt4 expression increased amount, abnormal WT + MO1-tnnt2a standard conditions Fig. 1 from Fontana et al., 2020
nucleate erythrocyte development disrupted, abnormal WT + MO1-tnnt2a standard conditions Fig. 8 with image from Helker et al., 2013
palatoquadrate arch decreased length, abnormal WT + MO1-tnnt2a standard conditions Fig. 4 with image from Anderson et al., 2008
aortic arch 1 acvrl1 expression increased amount, abnormal WT + MO1-tnnt2a control Fig. 5 from Anzell et al., 2024
heart heg1 expression decreased amount, abnormal WT + MO1-tnnt2a standard conditions Fig. 1 from Fontana et al., 2020
caudal division of the internal carotid artery cxcr4a expression increased amount, abnormal WT + MO1-tnnt2a control Fig. 5 from Anzell et al., 2024
nitric oxide biosynthetic process disrupted, abnormal WT + MO1-tnnt2a standard conditions Fig. 7 from Wang et al., 2011
chromaffin cell mislocalised, abnormal WT + MO1-tnnt2a standard conditions Fig. 7 with image from Chou et al., 2014
blood accumulation trunk, abnormal WT + MO1-tnnt2a standard conditions Fig. 2 from Wang et al., 2011
pronephros development process quality, abnormal WT + MO1-tnnt2a standard conditions Fig. 4 with image from Ichimura et al., 2012
interrenal gland animal organ morphogenesis process quality, abnormal WT + MO1-tnnt2a standard conditions Fig. 7 with image from Chou et al., 2014
thymus hematopoietic multipotent progenitor cell decreased amount, abnormal WT + MO1-tnnt2a standard conditions Fig. 2 from Wang et al., 2011
basal communicating artery acvrl1 expression absent, abnormal WT + MO1-tnnt2a standard conditions Fig. 1 from Anzell et al., 2024
dorsal aorta unlumenized, abnormal WT + MO1-tnnt2a standard conditions Fig. 4 from Wang et al., 2011
aortic arch 1 cxcr4a expression increased amount, abnormal WT + MO1-tnnt2a control Fig. 5 from Anzell et al., 2024
heart contraction arrested, abnormal f2Tg + MO1-tnnt2a chemical treatment: (S)-blebbistatin Fig. 5 from Andersen et al., 2015
cardiac muscle cell decreased volume, abnormal f2Tg + MO1-tnnt2a chemical treatment: cyclosporin A Fig. 6 from Andersen et al., 2015
heart contraction arrested, abnormal f2Tg + MO1-tnnt2a standard conditions Fig. 2Fig. 5 from Andersen et al., 2015
heart contraction arrested, abnormal f2Tg + MO1-tnnt2a chemical treatment: cyclosporin A Fig. 6 from Andersen et al., 2015
cardiac muscle cell increased volume, abnormal f2Tg + MO1-tnnt2a chemical treatment: (S)-blebbistatin Fig. 5 from Andersen et al., 2015
heart Citrine expression decreased amount, abnormal hu7135Tg + MO1-tnnt2a standard conditions Fig. 1 from Fontana et al., 2020
heart Citrine expression increased amount, abnormal hu7135Tg + MO1-tnnt2a standard conditions Fig. 1 from Fontana et al., 2020
cardiac ventricle Venus expression decreased amount, abnormal hu7135Tg + MO1-tnnt2a standard conditions Fig. 1 from Fontana et al., 2020
atrioventricular canal Venus expression decreased amount, abnormal hu7135Tg + MO1-tnnt2a standard conditions Fig. 1 from Fontana et al., 2020
heart contraction decreased rate, abnormal hu11688Tg + MO1-tnnt2a (TL) chemical treatment by environment: propranolol Fig. 3 from van Opbergen et al., 2018
heart calcium ion import decreased frequency, abnormal hu11688Tg + MO1-tnnt2a (TL) chemical treatment by environment: E-4031 Fig. 4 from van Opbergen et al., 2018
heart contraction process quality, abnormal hu11688Tg + MO1-tnnt2a (TL) chemical treatment by environment: nifedipine Fig. 6 from van Opbergen et al., 2018
heart contraction decreased rate, abnormal hu11688Tg + MO1-tnnt2a (TL) chemical treatment by environment: nifedipine Fig. 6 from van Opbergen et al., 2018
heart contraction decreased rate, abnormal hu11688Tg + MO1-tnnt2a (TL) chemical treatment by environment: E-4031 Fig. 4 from van Opbergen et al., 2018
heart contraction increased rate, abnormal hu11688Tg + MO1-tnnt2a (TL) chemical treatment by environment: isoprenaline Fig. 3 from van Opbergen et al., 2018
subintestinal vein morphology, abnormal la116Tg + MO1-tnnt2a standard conditions Fig. 7 from Wu et al., 2015
subintestinal vein blood vessel morphogenesis disrupted, abnormal la116Tg + MO1-tnnt2a standard conditions Fig. 7 from Wu et al., 2015
pericardium edematous, abnormal la2042Tg + MO1-tnnt2a standard conditions Fig. 3 from Xie et al., 2008
adrenal gland development process quality, abnormal li1Tg + MO1-tnnt2a standard conditions Fig. 1 with image from Chou et al., 2014
pronephric glomerulus separated from pronephric glomerulus, abnormal li1Tg + MO1-tnnt2a standard conditions Fig. 1 with image from Chou et al., 2014
interrenal gland position, abnormal li1Tg + MO1-tnnt2a standard conditions Fig. 1 with image from Chou et al., 2014
blood circulation decreased process quality, abnormal li1Tg + MO1-tnnt2a standard conditions Fig. 1 with image from Chou et al., 2014
pronephric glomerulus morphogenesis process quality, abnormal li1Tg + MO1-tnnt2a standard conditions Fig. 1 with image from Chou et al., 2014
heart contraction decreased process quality, abnormal li1Tg + MO1-tnnt2a standard conditions Fig. 1 with image from Chou et al., 2014
lateral dorsal aorta Citrine expression absent, abnormal mu107Tg + MO1-tnnt2a control Fig. 2 from Rödel et al., 2019
blood circulation decreased occurrence, abnormal mu107Tg + MO1-tnnt2a control Fig. 2 from Rödel et al., 2019
intersegmental vessel decreased size, abnormal s843Tg + MO1-tnnt2a control Fig. Online I from Rödel et al., 2019
interrenal angiogenic sprout mislocalised laterally, abnormal s843Tg + MO1-tnnt2a standard conditions Fig. 8 with image from Chiu et al., 2012
interrenal primordium position, abnormal s843Tg + MO1-tnnt2a standard conditions Fig. 8 with image from Chiu et al., 2012
lateral dorsal aorta morphology, abnormal s843Tg + MO1-tnnt2a control Fig. 1 from Rödel et al., 2019
post-vent vasculature morphology, abnormal s843Tg + MO1-tnnt2a standard conditions Fig. 7 from Mleynek et al., 2014
caudal vein plexus angiogenic sprout increased amount, abnormal s843Tg + MO1-tnnt2a standard conditions Fig. 7 from Mleynek et al., 2014
intersegmental vessel structure, abnormal s843Tg + MO1-tnnt2a standard conditions Fig. 6 with imageFig. S1 with image from Mugoni et al., 2013
blood vessel remodeling disrupted, abnormal s843Tg + MO1-tnnt2a standard conditions Fig. S13 with image from Chen et al., 2012
endocardium hypotrophic, abnormal s843Tg + MO1-tnnt2a standard conditions Fig. 5 with image from Renz et al., 2015
intersegmental vessel collapsed, abnormal s843Tg + MO1-tnnt2a control Fig. Online I from Rödel et al., 2019
caudal vein plexus morphology, abnormal s843Tg + MO1-tnnt2a control Fig. 1 from Rödel et al., 2019
caudal vein plexus malformed, abnormal s843Tg + MO1-tnnt2a control Fig. 1Fig. 5 from Xie et al., 2018
heart decreased size, abnormal s843Tg + MO1-tnnt2a control Fig. Online I from Rödel et al., 2019
midbrain blood vasculature morphology, abnormal s843Tg + MO1-tnnt2a standard conditions Fig. S13 with image from Chen et al., 2012
midbrain blood vasculature has fewer parts of type blood vessel, abnormal s843Tg + MO1-tnnt2a standard conditions Fig. S13 with image from Chen et al., 2012
blood vessel morphogenesis decreased process quality, abnormal s843Tg + MO1-tnnt2a standard conditions Fig. 7 from Mleynek et al., 2014
central artery angiogenic sprout increased amount, abnormal s843Tg + MO1-tnnt2a control Fig. Online I from Rödel et al., 2019
caudal vein plexus sprouting angiogenesis increased occurrence, abnormal s843Tg + MO1-tnnt2a standard conditions Fig. 7 from Mleynek et al., 2014
intersegmental vessel morphology, abnormal s843Tg + MO1-tnnt2a control Fig. 1 from Rödel et al., 2019
caudal vein plexus fused with caudal vein plexus, abnormal s843Tg + MO1-tnnt2a control Fig. Online I from Rödel et al., 2019
trunk vasculature morphology, abnormal s843Tg + MO1-tnnt2a standard conditions Fig. S1 with image from Mugoni et al., 2013
caudal vein plexus sprouting angiogenesis decreased occurrence, abnormal s843Tg + MO1-tnnt2a control Fig. 1Fig. 5 from Xie et al., 2018
blood circulation disrupted, abnormal s843Tg + MO1-tnnt2a standard conditions Fig. 8 with image from Chiu et al., 2012
heart contraction arrested, abnormal s878Tg + MO1-tnnt2a standard conditions Fig. 4 with image from Arnaout et al., 2007
cardiac muscle cell cell projection transient, abnormal s883Tg + MO1-tnnt2a standard conditions Fig. 5 with image from Staudt et al., 2014
cardiac muscle cell Venus expression absent, abnormal s940Tg + MO1-tnnt2a control Fig. 6 with image from Jiménez-Amilburu et al., 2016
atrioventricular valve Venus expression absent, abnormal s940Tg + MO1-tnnt2a control Fig. 6 with image from Jiménez-Amilburu et al., 2016
cardiac muscle cell Notch signaling pathway decreased process quality, abnormal s940Tg + MO1-tnnt2a control Fig. 6 with image from Jiménez-Amilburu et al., 2016
heart Notch signaling pathway decreased process quality, abnormal s940Tg + MO1-tnnt2a control Fig. 6 with image from Jiménez-Amilburu et al., 2016
cardiac ventricle cardiac muscle contraction arrested, abnormal s974Tg + MO1-tnnt2a standard conditions Fig. 2 with image from Rasouli et al., 2018
atrium cardiac muscle contraction arrested, abnormal s974Tg + MO1-tnnt2a standard conditions Fig. 2 with image from Rasouli et al., 2018
proximal convoluted tubule development arrested, abnormal sqet11Et + MO1-tnnt2a standard conditions Fig. 8 with image from Vasilyev et al., 2009
distal tubule development arrested, abnormal sqet11Et + MO1-tnnt2a standard conditions Fig. 8 with image from Vasilyev et al., 2009
simple cuboidal epithelium displaced, abnormal sqet11Et + MO1-tnnt2a standard conditions Fig. 8 with image from Vasilyev et al., 2009
simple columnar epithelium displaced, abnormal sqet11Et + MO1-tnnt2a standard conditions Fig. 8 with image from Vasilyev et al., 2009
distal tubule development arrested, abnormal sqet33D10Et + MO1-tnnt2a (AB) standard conditions Fig. 8 with image from Vasilyev et al., 2009
simple cuboidal epithelium displaced, abnormal sqet33D10Et + MO1-tnnt2a (AB) standard conditions Fig. 8 with image from Vasilyev et al., 2009
proximal convoluted tubule development arrested, abnormal sqet33D10Et + MO1-tnnt2a (AB) standard conditions Fig. 8 with image from Vasilyev et al., 2009
simple columnar epithelium displaced, abnormal sqet33D10Et + MO1-tnnt2a (AB) standard conditions Fig. 8 with image from Vasilyev et al., 2009
heart notch1b expression decreased amount, abnormal twu26Tg + MO1-tnnt2a control Fig. 4 with image from Samsa et al., 2015
heart efnb2a expression decreased amount, abnormal twu26Tg + MO1-tnnt2a control Fig. 4 with image from Samsa et al., 2015
heart nrg1 expression decreased amount, abnormal twu26Tg + MO1-tnnt2a control Fig. 4 with image from Samsa et al., 2015
endothelial cell apoptotic process increased occurrence, abnormal ubs1Tg + MO1-tnnt2a control Fig. 1 with imageFig. 5 with imageFig. 6 from Serbanovic-Canic et al., 2017
blood circulation decreased occurrence, abnormal ubs1Tg + MO1-tnnt2a control Fig. 1 with imageFig. 5 with image from Serbanovic-Canic et al., 2017
endothelial cell apoptotic process increased occurrence, ameliorated ubs1Tg + MO1-tnnt2a + MO4-tp53 control Fig. 6 from Serbanovic-Canic et al., 2017
bulbus arteriosus lacks all parts of type ventriculo bulbo valve, abnormal um14Tg + MO1-tnnt2a standard conditions Figure 6 with image from Duchemin et al., 2019
heart contraction decreased frequency, abnormal um14Tg + MO1-tnnt2a standard conditions Figure 6 with image from Duchemin et al., 2019
bulbus arteriosus endocardial cushion EGFP expression spatial pattern, abnormal um14Tg + MO1-tnnt2a standard conditions Figure 6 with image from Duchemin et al., 2019
basilar artery decreased diameter, abnormal y1Tg + MO1-tnnt2a standard conditions Fig. 3 with image from Fujita et al., 2011
intersegmental vessel blood vessel lumenization process quality, abnormal y1Tg + MO1-tnnt2a standard conditions Fig. S1 from Sauteur et al., 2014
vascular endothelium increased size, abnormal y1Tg + MO1-tnnt2a standard conditions Fig. 2 with image from Chou et al., 2010
pronephric glomerulus right side unfused from pronephric glomerulus left side, abnormal y1Tg + MO1-tnnt2a standard conditions Fig. 2 with image from Chou et al., 2010
vascular endothelium mislocalised, abnormal y1Tg + MO1-tnnt2a standard conditions Fig. 2 with image from Chou et al., 2010
central artery decreased diameter, abnormal y1Tg + MO1-tnnt2a standard conditions Fig. 3 with image from Fujita et al., 2011
caudal vein plexus decreased size, abnormal y1Tg + MO1-tnnt2a standard conditions Fig. S6 from Hogan et al., 2008
blood circulation disrupted, abnormal y1Tg + MO1-tnnt2a standard conditions Fig. S1 from Hogan et al., 2008
pronephric glomerular capillary increased size, abnormal y1Tg + MO1-tnnt2a standard conditions Fig. 2 with image from Chou et al., 2010
cranial vasculature unlumenized, abnormal y1Tg + MO1-tnnt2a standard conditions Fig. S3 from Hogan et al., 2008
blood circulation absent, abnormal y1Tg + MO1-tnnt2a standard conditions Fig. 3 with image from Fujita et al., 2011
adrenal gland development lacking processual parts cell migration, abnormal y1Tg + MO1-tnnt2a standard conditions Fig. 2 with image from Chou et al., 2010
interrenal gland epithelial to mesenchymal transition decreased occurrence, abnormal zf346Tg + MO1-tnnt2a standard conditions Fig. 6 with image from Chou et al., 2014
bulbus arteriosus vascular smooth muscle yap1 expression decreased amount, abnormal zf495Tg + MO1-tnnt2a standard conditions Figure 6 with image from Duchemin et al., 2019
bulbus arteriosus vascular smooth muscle ab2-fn labeling decreased amount, abnormal zf495Tg + MO1-tnnt2a standard conditions Figure 6 with image from Duchemin et al., 2019
bulbus arteriosus vascular smooth muscle ab1-elnb labeling decreased amount, abnormal zf495Tg + MO1-tnnt2a standard conditions Figure 6 with image from Duchemin et al., 2019
bulbus arteriosus decreased diameter, abnormal zf495Tg + MO1-tnnt2a standard conditions Figure 6 with image from Duchemin et al., 2019
bulbus arteriosus smooth muscle tissue development decreased process quality, abnormal zf495Tg + MO1-tnnt2a standard conditions Figure 6 with image from Duchemin et al., 2019
heart contraction decreased frequency, abnormal zf495Tg + MO1-tnnt2a standard conditions Figure 6 with image from Duchemin et al., 2019
cardiac muscle cell EGFP expression mislocalised, abnormal zf517Tg + MO1-tnnt2a standard conditions Fig. 6 with image from Rasouli et al., 2017
cardiac muscle cell basal side EGFP expression absent, abnormal zf517Tg + MO1-tnnt2a standard conditions Fig. 6 with image from Rasouli et al., 2017
trunk vasculature blood vessel lumenization decreased process quality, abnormal zn1Tg + MO1-tnnt2a standard conditions Fig. S4 from Zhao et al., 2013
heart calcium ion import process quality, abnormal ccu1Tg; hu6531Tg + MO1-tnnt2a chemical treatment by environment: isoprenaline Fig. 3 from van Opbergen et al., 2018
heart calcium ion import decreased frequency, abnormal ccu1Tg; hu6531Tg + MO1-tnnt2a chemical treatment by environment: nifedipine Fig. 5 from van Opbergen et al., 2018
heart calcium ion import increased frequency, abnormal ccu1Tg; hu6531Tg + MO1-tnnt2a chemical treatment by environment: isoprenaline Fig. 3 from van Opbergen et al., 2018
heart calcium ion import process quality, abnormal ccu1Tg; hu6531Tg + MO1-tnnt2a chemical treatment by environment: propranolol Fig. 3 from van Opbergen et al., 2018
heart calcium ion import process quality, abnormal ccu1Tg; hu6531Tg + MO1-tnnt2a chemical treatment by environment: nifedipine Fig. 5 from van Opbergen et al., 2018
heart calcium ion import decreased frequency, abnormal ccu1Tg; hu6531Tg + MO1-tnnt2a chemical treatment by environment: propranolol Fig. 3 from van Opbergen et al., 2018
cardiac conduction system mislocalised, abnormal f2Tg; sqet33mi28Et + MO1-tnnt2a standard conditions Fig. 4 with image from Poon et al., 2016
sinoatrial node increased area, abnormal f2Tg; sqet33mi28Et + MO1-tnnt2a standard conditions Fig. 4 with image from Poon et al., 2016
sinoatrial node EGFP expression increased distribution, abnormal f2Tg; sqet33mi28Et + MO1-tnnt2a standard conditions Fig. 4 with image from Poon et al., 2016
cardiac conduction system mislocalised, abnormal f2Tg; sqet33mi59BEt + MO1-tnnt2a standard conditions Fig. 4 with image from Poon et al., 2016
sinoatrial node increased area, abnormal f2Tg; sqet33mi59BEt + MO1-tnnt2a standard conditions Fig. 4 with image from Poon et al., 2016
sinoatrial node EGFP expression increased distribution, abnormal f2Tg; sqet33mi59BEt + MO1-tnnt2a standard conditions Fig. 4 with image from Poon et al., 2016
pericardium edematous, abnormal gz15Tg; y1Tg + MO1-tnnt2a standard conditions Fig. 5 with image from Korzh et al., 2008
liver decreased size, abnormal gz15Tg; y1Tg + MO1-tnnt2a standard conditions Fig. 6 with image from Korzh et al., 2008
hepatic sinusoid aplastic, abnormal gz15Tg; y1Tg + MO1-tnnt2a standard conditions Fig. 6 with image from Korzh et al., 2008
optic tectum microglial cell migration process quality, abnormal hkz011tTg; tsu11Tg + MO1-tnnt2a standard conditions Fig. 2 with image from Xu et al., 2016
heart contraction decreased occurrence, abnormal hkz011tTg; tsu11Tg + MO1-tnnt2a standard conditions Fig. 2 with image from Xu et al., 2016
optic tectum decreased width, abnormal hkz011tTg; tsu11Tg + MO1-tnnt2a standard conditions Fig. 2 with image from Xu et al., 2016
optic tectum microglial cell decreased amount, abnormal hkz011tTg; tsu11Tg + MO1-tnnt2a standard conditions Fig. 2 with image from Xu et al., 2016
bulbus arteriosus lacks all parts of type ventriculo bulbo valve, abnormal ig11Tg; ubs10Tg + MO1-tnnt2a standard conditions Figure 6 with image from Duchemin et al., 2019
heart contraction decreased frequency, abnormal ig11Tg; ubs10Tg + MO1-tnnt2a standard conditions Figure 6 with image from Duchemin et al., 2019
bulbus arteriosus endocardial cushion EGFP expression spatial pattern, abnormal ig11Tg; ubs10Tg + MO1-tnnt2a standard conditions Figure 6 with image from Duchemin et al., 2019
ventral wall of dorsal aorta has fewer parts of type hematopoietic stem cell, abnormal la2Tg; s896Tg + MO1-tnnt2a standard conditions Fig. 5 with image from Sawamiphak et al., 2014
blood accumulation trunk, abnormal la116Tg; sd2Tg + MO1-tnnt2a standard conditions Fig. 1 from Wang et al., 2011
atrioventricular canal endocardium EGFP expression decreased amount, abnormal nkuasgfp1aTg; pbb65Tg + MO1-tnnt2a standard conditions Figure 1 with image from Paolini et al., 2021
atrioventricular valve formation decreased process quality, abnormal nkuasgfp1aTg; pbb65Tg + MO1-tnnt2a standard conditions Figure 1 with image from Paolini et al., 2021
blood circulation arrested, abnormal nkuasgfp1aTg; pbb65Tg + MO1-tnnt2a standard conditions Figure 1 with image from Paolini et al., 2021
heart contraction arrested, abnormal nkuasgfp1aTg; pbb65Tg + MO1-tnnt2a standard conditions Figure 1 with image from Paolini et al., 2021
atrioventricular canal calcium ion decreased amount, abnormal nkUAShspzGCaMP6s13aTg; ubs4Tg + MO1-tnnt2a standard conditions Fig. 4 with image from Juan et al., 2023
blood vessel collapsed, abnormal pt505Tg; y7Tg + MO1-tnnt2a standard conditions Fig. 1 with image from Corti et al., 2011
blood circulation arrested, abnormal rk8Tg; ubs4Tg + MO1-tnnt2a standard conditions Fig. 5. with image from da Silva et al., 2024
internal carotid artery blood vessel endothelial cell migration process quality, abnormal rk8Tg; ubs4Tg + MO1-tnnt2a control Fig. 4 with image from Rochon et al., 2016
heart contraction arrested, abnormal rk8Tg; ubs4Tg + MO1-tnnt2a standard conditions Fig. 5. with image from da Silva et al., 2024
cell migration involved in heart development decreased occurrence, abnormal rk8Tg; ubs4Tg + MO1-tnnt2a control Fig. 4 with image from Rochon et al., 2016
aortic arch 1 blood vessel endothelial cell migration process quality, abnormal rk8Tg; ubs4Tg + MO1-tnnt2a control Fig. 4 with image from Rochon et al., 2016
atrioventricular valve formation decreased process quality, abnormal rk8Tg; ubs4Tg + MO1-tnnt2a standard conditions Fig. 5. with image from da Silva et al., 2024
caudal division of the internal carotid artery blood vessel endothelial cell migration process quality, abnormal rk8Tg; ubs4Tg + MO1-tnnt2a control Fig. 4 with image from Rochon et al., 2016
blood circulation decreased occurrence, abnormal rk8Tg; ubs4Tg + MO1-tnnt2a control Fig. 4 with image from Rochon et al., 2016
atrioventricular canal endothelial cell migration decreased process quality, abnormal rk8Tg; ubs4Tg + MO1-tnnt2a standard conditions Fig. 5. with image from da Silva et al., 2024
atrioventricular canal endocardium alcama expression absent, abnormal rk8Tg; ubs4Tg + MO1-tnnt2a standard conditions Fig. 5. with image from da Silva et al., 2024
aortic arch 1 cell migration involved in heart development decreased occurrence, abnormal rk8Tg; ubs4Tg + MO1-tnnt2a control Fig. 4 with image from Rochon et al., 2016
blood circulation arrested, abnormal s843Tg; sd2Tg + MO1-tnnt2a standard conditions Fig. 4 with image from Ellertsdottir et al., 2012
dorsal aorta structure, abnormal s843Tg; sd2Tg + MO1-tnnt2a standard conditions Fig. 4 with image from Ellertsdottir et al., 2012
blood vessel lumenization disrupted, abnormal s843Tg; sd2Tg + MO1-tnnt2a standard conditions Fig. 4 with image from Ellertsdottir et al., 2012
blood increased accumulation caudal vein, abnormal s843Tg; sd2Tg + MO1-tnnt2a standard conditions Fig. 4 with image from Ellertsdottir et al., 2012
intersegmental vessel structure, cavities, abnormal s843Tg; sd2Tg + MO1-tnnt2a standard conditions Fig. 4 with image from Ellertsdottir et al., 2012
dorsal aorta vascular associated smooth muscle cell mCherry expression absent, abnormal s843Tg; uto5Tg + MO1-tnnt2a control Fig. 2 with image from Chen et al., 2017
dorsal aorta vascular associated smooth muscle cell decreased amount, abnormal s843Tg; uto5Tg + MO1-tnnt2a control Fig. 2 with image from Chen et al., 2017
dorsal aorta anatomical region mCherry expression absent, abnormal s843Tg; uto5Tg + MO1-tnnt2a control Fig. 2 with image from Chen et al., 2017
blood circulation decreased rate, abnormal s843Tg; uto5Tg + MO1-tnnt2a control Fig. 2 with image from Chen et al., 2017
cardiac ventricle trabecular layer absent, abnormal s843Tg; vc6Tg + MO1-tnnt2a control Fig. 1 with image from Samsa et al., 2015
heart contraction absent, abnormal s843Tg; vc6Tg + MO1-tnnt2a control Fig. 1 with image from Samsa et al., 2015
trabecular layer absent, abnormal s843Tg; vc6Tg + MO1-tnnt2a control Fig. 1 with image from Samsa et al., 2015
ocular blood vessel morphogenesis of a branching structure decreased process quality, abnormal sd2Tg/sd2Tg; y1Tg/y1Tg + MO1-tnnt2a standard conditions Fig. 7 from Yue et al., 2021
subintestinal venous plexus morphogenesis of a branching structure decreased process quality, abnormal sd2Tg/sd2Tg; y1Tg/y1Tg + MO1-tnnt2a standard conditions Fig. 3 from Yue et al., 2021
subintestinal venous plexus EGFP expression spatial pattern, abnormal sd2Tg/sd2Tg; y1Tg/y1Tg + MO1-tnnt2a standard conditions Fig. 3 from Yue et al., 2021
ocular blood vessel EGFP expression spatial pattern, abnormal sd2Tg/sd2Tg; y1Tg/y1Tg + MO1-tnnt2a standard conditions Fig. 7 from Yue et al., 2021
ocular blood vessel blood vessel lumenization decreased process quality, abnormal sd2Tg/sd2Tg; y1Tg/y1Tg + MO1-tnnt2a standard conditions Fig. 7 from Yue et al., 2021
atrioventricular canal GCaMP expression decreased amount, abnormal ubs3Tg; zf350Tg + MO1-tnnt2a control Fig. 4 with image from Heckel et al., 2015
Notch signaling involved in heart development decreased occurrence, abnormal um14Tg; vc6Tg + MO1-tnnt2a control Fig. 2 with image from Samsa et al., 2015
heart EGFP expression absent, abnormal um14Tg; vc6Tg + MO1-tnnt2a control Fig. 2 with image from Samsa et al., 2015
heart contraction absent, abnormal um14Tg; vc6Tg + MO1-tnnt2a control Fig. 2 with image from Samsa et al., 2015
caudal division of the internal carotid artery cxcr4a expression increased amount, abnormal acvrl1y6/y6 + MO1-tnnt2a control Fig. 5 from Anzell et al., 2024
caudal division of the internal carotid artery acvrl1 expression decreased amount, abnormal acvrl1y6/y6 + MO1-tnnt2a standard conditions Fig. 5 from Anzell et al., 2024
basal communicating artery cxcr4a expression increased amount, abnormal acvrl1y6/y6 + MO1-tnnt2a control Fig. 5 from Anzell et al., 2024
blood circulation absent, abnormal acvrl1y6/y6 + MO1-tnnt2a standard conditions Fig. 2 with image from Corti et al., 2011
internal carotid artery acvrl1 expression decreased amount, abnormal acvrl1y6/y6 + MO1-tnnt2a standard conditions Fig. 5 from Anzell et al., 2024
aortic arch 1 acvrl1 expression decreased amount, abnormal acvrl1y6/y6 + MO1-tnnt2a standard conditions Fig. 5 from Anzell et al., 2024
basal communicating artery acvrl1 expression decreased amount, abnormal acvrl1y6/y6 + MO1-tnnt2a standard conditions Fig. 5 from Anzell et al., 2024
heart contraction absent, abnormal acvrl1y6/y6 + MO1-tnnt2a standard conditions Fig. 2 with image from Corti et al., 2011
internal carotid artery cxcr4a expression increased amount, abnormal acvrl1y6/y6 + MO1-tnnt2a control Fig. 5 from Anzell et al., 2024
aortic arch 1 cxcr4a expression increased amount, abnormal acvrl1y6/y6 + MO1-tnnt2a control Fig. 5 from Anzell et al., 2024
heart increased size, abnormal ccm2m201/+ + MO1-tnnt2a standard conditions Fig. S2 with image from Cullere et al., 2015
hematopoietic multipotent progenitor cell mislocalised, abnormal gata1am651/m651 + MO1-tnnt2a standard conditions Fig. 6 with image from Jin et al., 2009
blood island hematopoietic multipotent progenitor cell absent, abnormal gata1am651/m651 + MO1-tnnt2a standard conditions Fig. 6 with image from Jin et al., 2009
definitive hemopoiesis process quality, abnormal gata1am651/m651 + MO1-tnnt2a standard conditions Fig. 6 with image from Jin et al., 2009
primitive hemopoiesis process quality, abnormal gata1am651/m651 + MO1-tnnt2a standard conditions Fig. 6 with image from Jin et al., 2009
blood circulation arrested, abnormal gata1am651/m651 + MO1-tnnt2a standard conditions Fig. 6 with image from Jin et al., 2009
erythroid progenitor cell absent, abnormal gata1am651/m651 + MO1-tnnt2a standard conditions Fig. 6 with image from Jin et al., 2009
erythrocyte differentiation process quality, abnormal gata1am651/m651 + MO1-tnnt2a standard conditions Fig. 6 with image from Jin et al., 2009
ventricular endocardium lamb1b expression decreased amount, abnormal lamb1ash590/+ + MO1-tnnt2a + MO4-tp53 standard conditions Fig. 5 with image from Derrick et al., 2021
atrial endocardium lamb1b expression decreased amount, abnormal lamb1ash590/+ + MO1-tnnt2a + MO4-tp53 standard conditions Fig. 5 with image from Derrick et al., 2021
endocardium klf2a expression decreased amount, abnormal lamb1ash590/+ + MO1-tnnt2a + MO4-tp53 standard conditions Fig. 5 with image from Derrick et al., 2021
endocardium klf2a expression amount, ameliorated lamb1ash590/sh590 + MO1-tnnt2a + MO4-tp53 standard conditions Fig. 5 with image from Derrick et al., 2021
ventricular endocardium lamb1b expression decreased amount, abnormal lamb1ash590/sh590 + MO1-tnnt2a + MO4-tp53 standard conditions Fig. 5 with image from Derrick et al., 2021
atrial endocardium lamb1b expression decreased amount, abnormal lamb1ash590/sh590 + MO1-tnnt2a + MO4-tp53 standard conditions Fig. 5 with image from Derrick et al., 2021
heart myl7 expression amount, ameliorated lamb1ash590/sh590 + MO1-tnnt2a + MO4-tp53 standard conditions Fig. 6 with image from Derrick et al., 2021
endocardium aldh1a2 expression amount, ameliorated lamb1ash590/sh590 + MO1-tnnt2a + MO4-tp53 standard conditions Fig. 7 with image from Derrick et al., 2021
pronephros epithelial cilium movement involved in extracellular fluid movement arrested, abnormal TU + MO1-tnnt2a + MO2-ift88 standard conditions Fig. 8 with image from Gerlach et al., 2014
heart contraction arrested, abnormal TU + MO1-tnnt2a + MO2-ift88 standard conditions Fig. 8 with image from Gerlach et al., 2014
cardiac muscle cell proliferation decreased process quality, abnormal WT + MO1-scn5lab + MO1-tnnt2a + MO4-tp53 standard conditions Fig. 8 from Bennett et al., 2013
cardiac muscle cell Z disc shape, abnormal WT + MO1-tnnt2a + MO5-actn2b standard conditions Fig. 7 from Yang et al., 2012
cardiac muscle cell decreased amount, abnormal WT + MO1-tnnt2a + MO5-actn2b standard conditions Fig. 7 from Yang et al., 2012
heart contraction arrested, abnormal WT + MO1-tnnt2a + MO5-actn2b standard conditions Fig. 7 from Yang et al., 2012
cardiac muscle cell sarcomere disorganized, abnormal WT + MO1-tnnt2a + MO5-actn2b standard conditions Fig. 7 from Yang et al., 2012
intersegmental artery decreased diameter, abnormal s916Tg + MO1-tnnt2a standard conditions Fig. 3 from Klems et al., 2020
endothelial cell apoptotic process increased occurrence, abnormal ubs1Tg + MO1-angptl4 + MO1-tnnt2a control Fig. 5 with image from Serbanovic-Canic et al., 2017
blood circulation decreased occurrence, abnormal ubs1Tg + MO1-angptl4 + MO1-tnnt2a control Fig. 5 with image from Serbanovic-Canic et al., 2017
endothelial cell apoptotic process increased occurrence, exacerbated ubs1Tg + MO1-cdh13 + MO1-tnnt2a control Fig. 5 with image from Serbanovic-Canic et al., 2017
blood circulation decreased occurrence, abnormal ubs1Tg + MO1-cdh13 + MO1-tnnt2a control Fig. 5 with image from Serbanovic-Canic et al., 2017
endothelial cell apoptotic process increased occurrence, ameliorated ubs1Tg + MO1-pdcd2l + MO1-tnnt2a control Fig. 5 with image from Serbanovic-Canic et al., 2017
blood circulation decreased occurrence, abnormal ubs1Tg + MO1-pdcd2l + MO1-tnnt2a control Fig. 5 with image from Serbanovic-Canic et al., 2017
endothelial cell apoptotic process increased occurrence, ameliorated ubs1Tg + MO1-pdcd2l + MO1-tnnt2a + MO4-tp53 control Fig. 6 from Serbanovic-Canic et al., 2017
endothelial cell apoptotic process increased occurrence, abnormal ubs1Tg + MO1-ptgis + MO1-tnnt2a control Fig. 5 with image from Serbanovic-Canic et al., 2017
blood circulation decreased occurrence, abnormal ubs1Tg + MO1-ptgis + MO1-tnnt2a control Fig. 5 with image from Serbanovic-Canic et al., 2017
endothelial cell apoptotic process increased occurrence, abnormal ubs1Tg + MO1-tnip1 + MO1-tnnt2a control Fig. 5 with image from Serbanovic-Canic et al., 2017
blood circulation decreased occurrence, abnormal ubs1Tg + MO1-tnip1 + MO1-tnnt2a control Fig. 5 with image from Serbanovic-Canic et al., 2017
endothelial cell apoptotic process increased occurrence, abnormal ubs1Tg + MO1-tnnt2a + MO2-angptl4 control Fig. 6 from Serbanovic-Canic et al., 2017
endothelial cell apoptotic process increased occurrence, abnormal ubs1Tg + MO1-tnnt2a + MO2-cd74a control Fig. 5 with image from Serbanovic-Canic et al., 2017
blood circulation decreased occurrence, abnormal ubs1Tg + MO1-tnnt2a + MO2-cd74a control Fig. 5 with image from Serbanovic-Canic et al., 2017
endothelial cell apoptotic process increased occurrence, abnormal ubs1Tg + MO1-tnnt2a + MO2-cd74b control Fig. 5 with image from Serbanovic-Canic et al., 2017
blood circulation decreased occurrence, abnormal ubs1Tg + MO1-tnnt2a + MO2-cd74b control Fig. 5 with image from Serbanovic-Canic et al., 2017
endothelial cell apoptotic process increased occurrence, exacerbated ubs1Tg + MO1-tnnt2a + MO2-cdh13 control Fig. 6 from Serbanovic-Canic et al., 2017
endothelial cell apoptotic process increased occurrence, ameliorated ubs1Tg + MO1-tnnt2a + MO2-pdcd2l control Fig. 6 from Serbanovic-Canic et al., 2017
endothelial cell apoptotic process increased occurrence, ameliorated ubs1Tg + MO1-tnnt2a + MO2-perp control Fig. 5 with imageFig. 6 from Serbanovic-Canic et al., 2017
blood circulation decreased occurrence, abnormal ubs1Tg + MO1-tnnt2a + MO2-perp control Fig. 5 with image from Serbanovic-Canic et al., 2017
endothelial cell apoptotic process increased occurrence, ameliorated ubs1Tg + MO1-tnnt2a + MO2-perp + MO4-tp53 control Fig. 6 from Serbanovic-Canic et al., 2017
endothelial cell apoptotic process increased occurrence, abnormal ubs1Tg + MO1-tnnt2a + MO4-jun control Fig. 5 with image from Serbanovic-Canic et al., 2017
blood circulation decreased occurrence, abnormal ubs1Tg + MO1-tnnt2a + MO4-jun control Fig. 5 with image from Serbanovic-Canic et al., 2017
caudal vein plexus size, ameliorated y1Tg + CRISPR1-ccm2 + CRISPR2-ccm2 + CRISPR3-ccm2 + CRISPR4-ccm2 + MO1-tnnt2a standard conditions Figure 4 with image from Li et al., 2021
blood circulation disrupted, abnormal zf169Tg + MO1-tnnt2a standard conditions Fig. S4 with image from Bertrand et al., 2008
endothelial cell apoptotic process increased occurrence, ameliorated ubs1Tg + MO1-pdcd2l + MO1-tnnt2a + MO2-perp control Fig. 6 from Serbanovic-Canic et al., 2017
blood vessel collapsed, abnormal acvrl1y6/y6; pt505Tg; y7Tg + MO1-tnnt2a standard conditions Fig. 1 with image from Corti et al., 2011
ventricular myocardium cardiac muscle cell increased amount, abnormal bns140Tg; s883Tg + MO1-tnnt2a standard conditions Fig. 6 with image from Rasouli et al., 2017
atrial myocardium cardiac muscle cell increased amount, abnormal bns140Tg; s883Tg + MO1-tnnt2a standard conditions Fig. 6 with image from Rasouli et al., 2017
blood circulation arrested, abnormal bns607Tg; rk8Tg; ubs4Tg + MO1-tnnt2a standard conditions Fig. 5. with image from da Silva et al., 2024
atrioventricular canal endocardium Tomato expression mislocalised, abnormal bns607Tg; rk8Tg; ubs4Tg + MO1-tnnt2a standard conditions Fig. 5. with image from da Silva et al., 2024
atrioventricular canal endocardium alcama expression mislocalised, abnormal bns607Tg; rk8Tg; ubs4Tg + MO1-tnnt2a standard conditions Fig. 5. with image from da Silva et al., 2024
ventricular endocardium alcama expression mislocalised, abnormal bns607Tg; rk8Tg; ubs4Tg + MO1-tnnt2a standard conditions Fig. 5. with image from da Silva et al., 2024
atrioventricular valve formation decreased process quality, abnormal bns607Tg; rk8Tg; ubs4Tg + MO1-tnnt2a standard conditions Fig. 5. with image from da Silva et al., 2024
atrioventricular canal endothelial cell migration decreased process quality, abnormal bns607Tg; rk8Tg; ubs4Tg + MO1-tnnt2a standard conditions Fig. 5. with image from da Silva et al., 2024
heart contraction arrested, abnormal bns607Tg; rk8Tg; ubs4Tg + MO1-tnnt2a standard conditions Fig. 5. with image from da Silva et al., 2024
atrial endocardium alcama expression mislocalised, abnormal bns607Tg; rk8Tg; ubs4Tg + MO1-tnnt2a standard conditions Fig. 5. with image from da Silva et al., 2024
endocardium proliferative, abnormal ccm2m201/m201; s843Tg + MO1-tnnt2a standard conditions Fig. 5 with image from Renz et al., 2015
heart increased size, abnormal ccm2m201/m201; twu34Tg + MO1-tnnt2a standard conditions Fig. 5 with image from Renz et al., 2015
heart edematous, abnormal ccm2m201/m201; twu34Tg + MO1-tnnt2a standard conditions Fig. 5 with image from Renz et al., 2015
blood circulation decreased rate, abnormal hu10049Tg; kca3Tg + MO1-tnnt2a control Fig. 4 with image from Chen et al., 2017
dorsal aorta vascular associated smooth muscle cell amount, ameliorated hu10049Tg; kca3Tg + MO1-tnnt2a control Fig. 4 with image from Chen et al., 2017
endothelial cell nucleus EGFP expression increased amount, abnormal ig11Tg/ig11Tg; is5Tg/is5Tg + CRISPR1-ccm2 + CRISPR2-ccm2 + CRISPR3-ccm2 + CRISPR4-ccm2 + MO1-tnnt2a standard conditions Fig. 4 with image from Li et al., 2025
caudal vein plexus endothelial cell EGFP expression increased amount, abnormal ig11Tg; is5Tg + CRISPR1-ccm2 + CRISPR2-ccm2 + CRISPR3-ccm2 + CRISPR4-ccm2 + MO1-tnnt2a standard conditions Figure 4 with image from Li et al., 2021
heart efnb2a expression increased amount, abnormal kca3Tg; kca4Tg; um14Tg; vc6Tg + MO1-tnnt2a heat shock Fig. 5 with image from Samsa et al., 2015
heart EGFP expression absent, abnormal kca3Tg; kca4Tg; um14Tg; vc6Tg + MO1-tnnt2a control Fig. 5 with image from Samsa et al., 2015
heart EGFP expression amount, ameliorated kca3Tg; kca4Tg; um14Tg; vc6Tg + MO1-tnnt2a heat shock Fig. 5 with image from Samsa et al., 2015
trabecular layer absent, abnormal kca3Tg; kca4Tg; um14Tg; vc6Tg + MO1-tnnt2a control Fig. 5 with image from Samsa et al., 2015
heart contraction absent, abnormal kca3Tg; kca4Tg; um14Tg; vc6Tg + MO1-tnnt2a control Fig. 5 with image from Samsa et al., 2015
Notch signaling involved in heart development decreased occurrence, abnormal kca3Tg; kca4Tg; um14Tg; vc6Tg + MO1-tnnt2a control Fig. 5 with image from Samsa et al., 2015
heart contraction absent, abnormal kca3Tg; kca4Tg; um14Tg; vc6Tg + MO1-tnnt2a heat shock Fig. 5 with image from Samsa et al., 2015
anatomical structure EGFP expression increased amount, abnormal kca3Tg; kca4Tg; um14Tg; vc6Tg + MO1-tnnt2a heat shock Fig. 5 with image from Samsa et al., 2015
trabecular layer absent, abnormal kca3Tg; kca4Tg; um14Tg; vc6Tg + MO1-tnnt2a heat shock Fig. 5 with image from Samsa et al., 2015
heart nrg1 expression increased amount, abnormal kca3Tg; kca4Tg; um14Tg; vc6Tg + MO1-tnnt2a heat shock Fig. 5 with image from Samsa et al., 2015
heart contraction arrested, abnormal kcnh6as290/s290; s878Tg + MO1-tnnt2a standard conditions Fig. 4 with imagetext only from Arnaout et al., 2007
cardiac ventricle conductivity, abnormal kcnh6as290/s290; s878Tg + MO1-tnnt2a standard conditions Fig. 4 with imagetext only from Arnaout et al., 2007
regulation of secondary heart field cardioblast proliferation normal process quality, ameliorated lamb1ash590/sh590; f2Tg; twu34Tg + MO1-tnnt2a + MO4-tp53 standard conditions Fig. 6 with image from Derrick et al., 2021
atrial endocardium DsRed2 expression amount, ameliorated lamb1ash590/sh590; f2Tg; twu34Tg + MO1-tnnt2a + MO4-tp53 standard conditions Fig. 6 with image from Derrick et al., 2021
atrial endocardium EGFP expression amount, ameliorated lamb1ash590/sh590; f2Tg; twu34Tg + MO1-tnnt2a + MO4-tp53 standard conditions Fig. 6 with image from Derrick et al., 2021
heart contraction arrested, abnormal lmo2vu270/vu270; s843Tg + MO1-tnnt2a standard conditions Fig. 6 from Weiss et al., 2012
nucleate erythrocyte absent, abnormal lmo2vu270/vu270; s843Tg + MO1-tnnt2a standard conditions Fig. 6 from Weiss et al., 2012
ocular blood vessel decreased diameter, abnormal lmo2vu270/vu270; s843Tg + MO1-tnnt2a standard conditions Fig. 6 from Weiss et al., 2012
blood circulation arrested, abnormal lmo2vu270/vu270; s843Tg + MO1-tnnt2a standard conditions Fig. 6 from Weiss et al., 2012
embryonic hemopoiesis decreased process quality, abnormal lmo2vu270/vu270; s843Tg + MO1-tnnt2a standard conditions Fig. 6 from Weiss et al., 2012
tube formation process quality, abnormal nkuasrfp1aTg; ubs3Tg; ubs5Tg + MO1-tnnt2a standard conditions Fig. 4 with image from Herwig et al., 2011
atrial endocardium mRFP1 expression decreased amount, abnormal nrg2amn0237Gt/+; ubs1Tg + MO1-tnnt2a standard conditions Fig. 6 with image from Rasouli et al., 2017
ventricular endocardium mRFP1 expression decreased amount, abnormal nrg2amn0237Gt/+; ubs1Tg + MO1-tnnt2a standard conditions Fig. 6 with image from Rasouli et al., 2017
cardiac muscle cell protruding out of myocardium, ameliorated snai1bbns351/bns351; bns193Tg + MO1-tnnt2a standard conditions Figure 1 with image from Gentile et al., 2021
heart contraction arrested, abnormal snai1bbns351/bns351; bns193Tg + MO1-tnnt2a standard conditions Figure 1 with image from Gentile et al., 2021
endocardium perforate, abnormal fbn3te382a; pku300te382b; s843Tg + MO1-tnnt2a standard conditions Fig. 4 with image from Mellman et al., 2012
endothelial cell nucleus EGFP expression increased amount, abnormal ig11Tg/ig11Tg; is5Tg/is5Tg + CRISPR1-ccm2 + CRISPR2-ccm2 + CRISPR3-ccm2 + CRISPR4-ccm2 + MO1-tnnt2a + MO2-adrb1 standard conditions Fig. 4 with image from Li et al., 2025
intersegmental artery increased diameter, abnormal ka613Tg; s916Tg + MO1-tnnt2a standard conditions Fig. 3 from Klems et al., 2020
cardiac muscle cell located in compact layer of ventricle, ameliorated klf2abns11/bns11; klf2bbns12/bns12; s974Tg + MO1-tnnt2a standard conditions Fig. 2 with image from Rasouli et al., 2018
ventricular myocardium ventricular cardiac muscle tissue morphogenesis process quality, ameliorated klf2abns11/bns11; klf2bbns12/bns12; s974Tg + MO1-tnnt2a standard conditions Fig. 2 with image from Rasouli et al., 2018
cardiac ventricle cardiac muscle contraction arrested, abnormal klf2abns11/bns11; klf2bbns12/bns12; s974Tg + MO1-tnnt2a standard conditions Fig. 2 with image from Rasouli et al., 2018
atrium cardiac muscle contraction arrested, abnormal klf2abns11/bns11; klf2bbns12/bns12; s974Tg + MO1-tnnt2a standard conditions Fig. 2 with image from Rasouli et al., 2018
Citations