Morpholino

MO4-rbpja,rbpjb

ID
ZDB-MRPHLNO-060626-6
Name
MO4-rbpja,rbpjb
Previous Names
  • MO2-rbpj (1)
  • MO2-rbpja (1)
  • MO2-rbpsuh (1)
  • MO4-rbpja+rbpjb
  • Su(H)-ORF-Mo (1)
Targets
Sequence
5' - CAAACTTCCCTGTCACAACAGGCGC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
This morpholino is predicted to target 2 genes.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-rbpja,rbpjb
Expressed Gene Anatomy Figures
cdh17 Fig. 3 with image from O'Brien et al., 2011
dlc Fig. 5 with image from Sacilotto et al., 2013
dll4 Fig. 4 with image from Sacilotto et al., 2013
efnb2a Fig. 5 with image from Sacilotto et al., 2013
Fig. S2 from Siekmann et al., 2007
flt1 Fig. S8 with image from Sacilotto et al., 2013
flt4 Fig. 5 with image from Sacilotto et al., 2013
Fig. 3 from Siekmann et al., 2007
foxb1a Fig. 2 from Qiu et al., 2009
her4.1 Fig. 2 from Qiu et al., 2009
Fig. 4Fig. 5 from Yeo et al., 2007
Fig. 6 with image from Zhang et al., 2007
her12 Fig. 5 with image from Shankaran et al., 2007
her15.1 Fig. 5 with image from Shankaran et al., 2007
hes6 Fig. 1 with image from Sieger et al., 2006
hey1 Fig. 3 with image from O'Brien et al., 2011
hey2 Fig. S8 with image from Sacilotto et al., 2013
mib1 Fig. 6 with image from Zhang et al., 2007
neurod1 Fig. 1 from Mizoguchi et al., 2011
notch1b Fig. S8 with image from Sacilotto et al., 2013
notch3 Fig. S8 with image from Sacilotto et al., 2013
nphs1 Fig. 3 with image from O'Brien et al., 2011
nr2f1a Fig. 9 with image from Wu et al., 2014
nr2f1b Fig. 6 with image from Li et al., 2015
nr5a1a Fig. 3 with image from O'Brien et al., 2011
pax2a Fig. 3 with image from O'Brien et al., 2011
podxl Fig. 3 with image from O'Brien et al., 2011
rfng Fig. 2 from Qiu et al., 2009
slc20a1a Fig. 3 with image from O'Brien et al., 2011
wt1b Fig. 3 with image from O'Brien et al., 2011
wu:fj67h05 Fig. 6 with image from Covassin et al., 2006
Phenotype
Phenotype resulting from MO4-rbpja,rbpjb
No data available
Phenotype of all Fish created by or utilizing MO4-rbpja,rbpjb
Phenotype Fish Conditions Figures
blood vessel nr2f1b expression increased distribution, abnormal TL + MO4-rbpja,rbpjb control Fig. 6 with image from Li et al., 2015
whole organism nr2f1b expression increased distribution, abnormal TL + MO4-rbpja,rbpjb control Fig. 6 with image from Li et al., 2015
pronephric tubule morphology, abnormal TU + MO4-rbpja,rbpjb standard conditions Fig. 3 with image from O'Brien et al., 2011
interrenal primordium increased size, abnormal TU + MO4-rbpja,rbpjb standard conditions Fig. 3 with image from O'Brien et al., 2011
pronephric podocyte decreased amount, abnormal TU + MO4-rbpja,rbpjb standard conditions Fig. 3 with image from O'Brien et al., 2011
central nervous system cellular quality, abnormal WT + MO4-rbpja,rbpjb standard conditions Fig. 5 from Yeo et al., 2007
angiogenic sprout increased amount, abnormal WT + MO4-rbpja,rbpjb standard conditions Fig. 4 with image from Sacilotto et al., 2013
nucleate erythrocyte mislocalised, abnormal WT + MO4-rbpja,rbpjb standard conditions Fig. S2 from Siekmann et al., 2007
fin regeneration decreased process quality, abnormal WT + MO4-rbpja,rbpjb physical alteration: anatomical structure Fig. 3 with image from Münch et al., 2013
ventricular system distended, abnormal WT + MO4-rbpja,rbpjb standard conditions Fig. S2 from Siekmann et al., 2007
posterior lateral line ganglion neuron increased amount, abnormal WT + MO4-rbpja,rbpjb standard conditions Fig. 1 from Mizoguchi et al., 2011
ventricular system increased accumulation nucleate erythrocyte, abnormal WT + MO4-rbpja,rbpjb standard conditions Fig. S2 from Siekmann et al., 2007
hindbrain epithelium disorganized, abnormal WT + MO4-rbpja,rbpjb standard conditions Fig. 2 from Qiu et al., 2009
cranial vasculature broken, abnormal WT + MO4-rbpja,rbpjb standard conditions Fig. S2 from Siekmann et al., 2007
intersegmental vessel structure, abnormal WT + MO4-rbpja,rbpjb standard conditions Fig. 4 with image from Sacilotto et al., 2013
rhombomere boundary formation disrupted, abnormal WT + MO4-rbpja,rbpjb standard conditions Fig. 2 from Qiu et al., 2009
blood vessel endothelial cell proliferation involved in sprouting angiogenesis process quality, abnormal WT + MO4-rbpja,rbpjb standard conditions Fig. 4 with image from Sacilotto et al., 2013
hindbrain development disrupted, abnormal WT + MO4-rbpja,rbpjb standard conditions Fig. 2 from Qiu et al., 2009
pronephric podocyte decreased amount, abnormal TU + MO1-foxc1a + MO4-rbpja,rbpjb standard conditions Fig. 3 with image from O'Brien et al., 2011
pronephric tubule morphology, abnormal TU + MO1-foxc1a + MO4-rbpja,rbpjb standard conditions Fig. 3 with image from O'Brien et al., 2011
interrenal primordium increased size, abnormal TU + MO1-foxc1a + MO4-rbpja,rbpjb standard conditions Fig. 3 with image from O'Brien et al., 2011
pronephric tubule absent, abnormal TU + MO3-wt1a + MO4-rbpja,rbpjb standard conditions Fig. 3 with image from O'Brien et al., 2011
interrenal primordium increased size, abnormal TU + MO3-wt1a + MO4-rbpja,rbpjb standard conditions Fig. 3 with image from O'Brien et al., 2011
pronephric podocyte decreased amount, abnormal TU + MO3-wt1a + MO4-rbpja,rbpjb standard conditions Fig. 3 with image from O'Brien et al., 2011
whole organism lacks all parts of type dorsal aorta, abnormal WT + MO4-rbpja,rbpjb + MO5-sox18 + MO5-sox7 standard conditions Fig. 4 with imageFig. 5 with image from Sacilotto et al., 2013
axial blood vessel decreased amount, abnormal WT + MO4-rbpja,rbpjb + MO5-sox18 + MO5-sox7 standard conditions Fig. 5 with image from Sacilotto et al., 2013
artery development arrested, abnormal WT + MO4-rbpja,rbpjb + MO5-sox18 + MO5-sox7 standard conditions Fig. 4 with imageFig. 5 with imageFig. S8 with image from Sacilotto et al., 2013
pronephros lacks all parts of type pronephric podocyte, abnormal hnf1bahi1843Tg/hi1843Tg + MO1-hnf1bb + MO3-wt1a + MO4-rbpja,rbpjb standard conditions Fig. 4 from Naylor et al., 2013
podocyte differentiation decreased occurrence, abnormal hnf1bahi1843Tg/hi1843Tg + MO1-hnf1bb + MO3-wt1a + MO4-rbpja,rbpjb standard conditions Fig. 4 from Naylor et al., 2013
peripheral neuron decreased length, abnormal knu2Tg + MO4-rbpja,rbpjb standard conditions Fig. 4 from So et al., 2009
blood vessel endothelial cell proliferation involved in sprouting angiogenesis process quality, abnormal lcr1Tg + MO4-rbpja,rbpjb standard conditions Fig. 4 with image from Sacilotto et al., 2013
trunk vasculature EGFP expression decreased amount, abnormal lcr1Tg + MO4-rbpja,rbpjb control Fig. 3 with image from Overman et al., 2017
angiogenic sprout increased amount, abnormal lcr1Tg + MO4-rbpja,rbpjb standard conditions Fig. 4 with image from Sacilotto et al., 2013
intersegmental vessel structure, abnormal lcr1Tg + MO4-rbpja,rbpjb standard conditions Fig. 4 with image from Sacilotto et al., 2013
trunk vasculature EGFP expression decreased amount, abnormal lcr1Tg + MO4-rbpja,rbpjb chemical treatment by environment: pharmaceutical Fig. 3 with image from Overman et al., 2017
whole organism EGFP expression decreased amount, abnormal lcr1Tg + MO4-rbpja,rbpjb chemical treatment by environment: pharmaceutical Fig. 3 with image from Overman et al., 2017
intersegmental vessel increased branchiness, abnormal s843Tg + MO4-rbpja,rbpjb standard conditions Fig. 7 with image from Zhou et al., 2015
intersegmental vessel angiogenesis increased process quality, abnormal s843Tg + MO4-rbpja,rbpjb standard conditions Fig. 7 with image from Zhou et al., 2015
blood circulation disrupted, abnormal y1Tg + MO4-rbpja,rbpjb standard conditions Fig. S1 from Siekmann et al., 2007
intersegmental vessel structure, abnormal y1Tg + MO4-rbpja,rbpjb standard conditions Fig. 1 from Siekmann et al., 2007
intersegmental vessel increased mass density, abnormal y1Tg + MO4-rbpja,rbpjb standard conditions Fig. 4 with image from Jensen et al., 2012
blood vessel development disrupted, abnormal y1Tg + MO4-rbpja,rbpjb standard conditions Fig. 5 with image from Sacilotto et al., 2013
intersegmental vessel disorganized, abnormal y1Tg + MO4-rbpja,rbpjb standard conditions Fig. 4 with image from Jensen et al., 2012
intersegmental vessel has extra parts of type blood vessel, abnormal y1Tg + MO4-rbpja,rbpjb standard conditions Fig. 4 with image from Jensen et al., 2012
intersegmental vessel mislocalised, abnormal y1Tg + MO4-rbpja,rbpjb standard conditions Fig. 1 from Siekmann et al., 2007
intersegmental vessel has extra parts of type vascular sprouts, abnormal y1Tg + MO4-rbpja,rbpjb standard conditions Fig. 4 with image from Jensen et al., 2012
intersegmental artery structure, abnormal y1Tg + MO4-rbpja,rbpjb standard conditions Fig. S1 from Siekmann et al., 2007
intersegmental vessel structure, abnormal y7Tg + MO4-rbpja,rbpjb standard conditions Fig. 2 from Siekmann et al., 2007
blood vessel endothelial cell increased amount, abnormal y7Tg + MO4-rbpja,rbpjb standard conditions Fig. 2 from Siekmann et al., 2007
cell migration involved in sprouting angiogenesis process quality, abnormal y7Tg + MO4-rbpja,rbpjb standard conditions Fig. 2 from Siekmann et al., 2007
blood vessel endothelial cell proliferation involved in sprouting angiogenesis process quality, abnormal y7Tg + MO4-rbpja,rbpjb standard conditions Fig. 2 from Siekmann et al., 2007
intersegmental artery blood vessel endothelial cell increased amount, abnormal y7Tg + MO4-rbpja,rbpjb control Fig. 5 with image from Lamont et al., 2016
Fig. 3Fig. S5 from Siekmann et al., 2007
dorsal longitudinal anastomotic vessel blood vessel development occurrence, ameliorated s843Tg + MO2-uxt + MO4-rbpja,rbpjb standard conditions Fig. 7 with image from Zhou et al., 2015
intersegmental vessel angiogenesis process quality, ameliorated s843Tg + MO2-uxt + MO4-rbpja,rbpjb standard conditions Fig. 7 with image from Zhou et al., 2015
intersegmental artery blood vessel endothelial cell amount, ameliorated y7Tg + MO4-isl2a + MO4-rbpja,rbpjb + MO5-isl2a control Fig. 5 with image from Lamont et al., 2016
artery development arrested, abnormal lcr1Tg + MO4-rbpja,rbpjb + MO5-sox18 + MO5-sox7 standard conditions Fig. 4 with image from Sacilotto et al., 2013
whole organism lacks all parts of type dorsal aorta, abnormal lcr1Tg + MO4-rbpja,rbpjb + MO5-sox18 + MO5-sox7 standard conditions Fig. 4 with image from Sacilotto et al., 2013
artery development arrested, abnormal y1Tg + MO4-rbpja,rbpjb + MO5-sox18 + MO5-sox7 standard conditions Fig. 5 with image from Sacilotto et al., 2013
axial blood vessel decreased amount, abnormal y1Tg + MO4-rbpja,rbpjb + MO5-sox18 + MO5-sox7 standard conditions Fig. 5 with image from Sacilotto et al., 2013
intersegmental vessel cell increased amount, abnormal ci5Tg; y7Tg + MO4-rbpja,rbpjb standard conditions Fig. 6 with image from Li et al., 2015
intersegmental vessel cell amount, ameliorated ci5Tg; y7Tg + MO4-nr2f1b + MO4-rbpja,rbpjb standard conditions Fig. 6 with image from Li et al., 2015
ventral wall of dorsal aorta endothelial cell EGFP expression absent, abnormal gfi1aaqmc551Gt/+; sd2Tg + MO4-rbpja,rbpjb control Fig. 4 with image from Thambyrajah et al., 2016
hematopoietic multipotent progenitor cell EGFP expression absent, abnormal gfi1aaqmc551Gt/+; sd2Tg + MO4-rbpja,rbpjb control Fig. 4 with image from Thambyrajah et al., 2016
ventral wall of dorsal aorta hematopoietic cell EGFP expression absent, abnormal gfi1aaqmc551Gt/+; sd2Tg + MO4-rbpja,rbpjb control Fig. 4 with image from Thambyrajah et al., 2016
blood circulation arrested, abnormal s843Tg; sd2Tg + MO4-rbpja,rbpjb + MO5-sox18 + MO5-sox7 standard conditions Fig. S7 with image from Sacilotto et al., 2013
Citations