header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-070118-1
Morpholino Name: MO1-myod1
Target: myod1 (1)
Previous Name: MO1-myod

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - ATATCCGACAACTCCATCTTTTTTG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-myod1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-myod1
Expressed Gene Anatomy Figures
acta1b Fig. 1 with imageFig. 3 with image from Hinits et al., 2009
cdkn1ca Fig. 4 with image from Osborn et al., 2011
cited4b Fig. 1 with image from Devakanmalai et al., 2013
en1a Fig. 7 with image from Hinits et al., 2009
en2a Fig. 2 with image from Osborn et al., 2011
Fig. 7 with image from Hinits et al., 2009
fgf8a Fig. 6 with image from Hammond et al., 2007
hsp90aa1.1 Fig. 3 with image from Hinits et al., 2009
lbx2 Fig. 3 with image from Hinits et al., 2009
mef2ca Fig. 3 with image from Hinits et al., 2009
mef2d Fig. 4 with image from Hinits et al., 2009
meox1 Fig. 3 with image from Hinits et al., 2009
met Fig. 7 with imageFig. 8 with image from Lin et al., 2006
msc Fig. 6 from Lee et al., 2011
myf5 Fig. 1 with imageFig. 3 with imageFig. 7 with image from Hinits et al., 2009
Fig. 2 with imageFig. 4 with imageFig. 6 with image from Lin et al., 2006
myf6 Fig. 1 with imageFig. 5 with image from Hinits et al., 2009
Fig. 3 from Schnapp et al., 2009
myhz1.1 Fig. 6 with image from Osborn et al., 2011
Fig. 3 with imageFig. 4 with imageFig. 7 with image from Hinits et al., 2009
mylpfa Fig. 6 with image from Osborn et al., 2011
Fig. 4 with image from Hinits et al., 2009
Fig. 6 with image from Hammond et al., 2007
myod1 Fig. 1 with image from Hinits et al., 2009
Fig. 7 from Schnapp et al., 2009
Fig. 6 with image from Hammond et al., 2007
myog Fig. 4 with image from Minchin et al., 2013
Fig. 2 with image from Osborn et al., 2011
Fig. 1 with imageFig. 3 with imageFig. 5 with image from Hinits et al., 2009
Fig. 3 from Schnapp et al., 2009
Fig. 4 with imageFig. 6 with imageFig. 8 with image from Lin et al., 2006
noto Fig. 7 from Lin et al., 2013
pax3a Fig. 7 with image from Hammond et al., 2007
pax7a Fig. 7 with image from Hammond et al., 2007
prdm1a Fig. 3 with image from Hinits et al., 2009
ptch2 Fig. 3 with image from Hinits et al., 2009
smyhc1 Fig. 4 with image from Osborn et al., 2011
Fig. 1 with imageFig. 3 with image from Hinits et al., 2009
tcf21 Fig. 6 from Lee et al., 2011
tpma Fig. 1 with imageFig. 3 with imageFig. 4 with image from Hinits et al., 2009
twist2 Fig. 4 with image from Hinits et al., 2009
PHENOTYPE
Phenotype resulting from MO1-myod1
Phenotype of all Fish created by or utilizing MO1-myod1
Phenotype Fish Conditions Figures
fast muscle cell decreased amount, abnormal WT + MO1-myod1 standard conditions Fig. 6 with image from Osborn et al., 2011
cephalic musculature aplastic, abnormal WT + MO1-myod1 standard conditions Fig. 3 with image from Hinits et al., 2009
head muscle poorly differentiated, abnormal WT + MO1-myod1 standard conditions Fig. 4 with image from Minchin et al., 2013
head muscle hypoplastic, abnormal WT + MO1-myod1 standard conditions Fig. 6 with image from Osborn et al., 2011
cephalic musculature decreased amount, abnormal WT + MO1-myod1 standard conditions Fig. 4 with imageFig. 7 with imageFig. 8 with image from Lin et al., 2006
esophagus skeletal muscle cell poorly differentiated, abnormal WT + MO1-myod1 standard conditions Fig. 4 with image from Minchin et al., 2013
skeletal muscle tissue development delayed, abnormal WT + MO1-myod1 standard conditions Fig. 2 with image from Osborn et al., 2011
head decreased size, abnormal twu3Tg + MO1-myod1 standard conditions Fig. 1 from Lin et al., 2013
head lacks parts or has fewer parts of type cephalic musculature, abnormal twu3Tg + MO1-myod1 standard conditions Fig. 1 from Lin et al., 2013
fast muscle cell decreased amount, abnormal myf5hu2022/hu2022 + MO1-myod1 standard conditions Fig. 6 with image from Osborn et al., 2011
skeletal muscle tissue development arrested, abnormal shhatbx392/tbx392 + MO1-myod1 standard conditions Fig. 2 with image from Osborn et al., 2011
muscle sarcomere disorganized, abnormal AB + MO1-myf5 + MO1-myod1 standard conditions Fig. 5 from Schnapp et al., 2009
muscle disorganized, abnormal AB + MO1-myf5 + MO1-myod1 standard conditions Fig. 5 from Schnapp et al., 2009
whole organism movement quality, abnormal AB + MO1-myf5 + MO1-myod1 standard conditions Fig. 1 from Schnapp et al., 2009
muscle sarcomere disoriented, abnormal AB + MO1-myf5 + MO1-myod1 standard conditions Fig. 5 from Schnapp et al., 2009
muscle apoptotic, abnormal AB + MO1-myf5 + MO1-myod1 standard conditions Fig. 5 from Schnapp et al., 2009
cephalic musculature decreased amount, abnormal WT + MO1-myf5 + MO1-myod1 standard conditions Fig. 5 with image from Lin et al., 2006
fast muscle cell absent, abnormal WT + MO1-myod1 + MO1-myog standard conditions Fig. 6 with image from Hinits et al., 2009
fast muscle cell decreased amount, abnormal WT + MO1-myod1 + MO3-cdkn1ca standard conditions Fig. 6 with image from Osborn et al., 2011
head muscle hypoplastic, abnormal WT + MO1-myod1 + MO3-cdkn1ca standard conditions Fig. 6 with image from Osborn et al., 2011
slow muscle cell muscle fiber development decreased process quality, abnormal WT + MO1-myod1 + MO3-myf5 standard conditions Fig. 4 with image from Nord et al., 2013
somite nucleus apoptotic, abnormal WT + MO1-myod1 + MO3-myf5 standard conditions Fig. 7 with image from Hammond et al., 2007
fast muscle cell muscle fiber development decreased process quality, abnormal WT + MO1-myod1 + MO3-myf5 standard conditions Fig. 4 with image from Nord et al., 2013
ceratohyal cartilage chondrocyte morphology, abnormal WT + MO1-myod1 + MO3-myf5 standard conditions Fig. 3 with image from Shwartz et al., 2012
embryonic cranial skeleton morphogenesis disrupted, abnormal WT + MO1-myod1 + MO3-myf5 standard conditions Fig. 1 with image from Shwartz et al., 2012
ceratohyal cartilage chondrocyte decreased size, abnormal WT + MO1-myod1 + MO3-myf5 standard conditions Fig. 3 with image from Shwartz et al., 2012
ceratohyal cartilage decreased length, abnormal WT + MO1-myod1 + MO3-myf5 standard conditions Fig. 1 with image from Shwartz et al., 2012
chondrocyte stacked, abnormal WT + MO1-myod1 + MO3-myf5 standard conditions Fig. 3 with image from Shwartz et al., 2012
muscle aplastic, abnormal myf5hu2022/hu2022 + MO1-myod1 + MO1-myog standard conditions Fig. 6 with image from Hinits et al., 2009
fast muscle cell absent, abnormal myf5hu2022/hu2022 + MO1-myod1 + MO3-cdkn1ca standard conditions Fig. 6 with image from Osborn et al., 2011
fast muscle cell absent, abnormal zf13Tg + MO1-myod1 + MO1-myog standard conditions Fig. 6 with image from Hinits et al., 2009
OTHER MO1-myod1 MORPHOLINO PAGESNo links to external sites
CITATIONS (21)