Morpholino

MO1-wnt8a

ID
ZDB-MRPHLNO-041217-12
Name
MO1-wnt8a
Previous Names
  • wnt8-1MO (1)
  • wnt8-MO1 (1)
  • wnt8-orf1 (1)
Target
Sequence
5' - ACGCAAAAATCTGGCAAGGGTTCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-wnt8a
Phenotype
Phenotype resulting from MO1-wnt8a
Phenotype of all Fish created by or utilizing MO1-wnt8a
Phenotype Fish Conditions Figures
whole organism decreased length, abnormal AB + MO1-wnt8a + MO2-wnt8a standard conditions Fig. 1 with image from Thorpe et al., 2005
tail bud decreased length, abnormal AB + MO1-wnt8a + MO2-wnt8a standard conditions Fig. 1 with image from Thorpe et al., 2005
tail bud morphology, abnormal AB + MO1-wnt8a + MO2-wnt8a standard conditions Fig. 4 with image from Thorpe et al., 2005
post-vent region decreased length, abnormal AB + MO1-wnt8a + MO2-wnt8a standard conditions Fig. 1 with image from Thorpe et al., 2005
post-anal tail morphogenesis disrupted, abnormal AB + MO1-wnt8a + MO2-wnt8a standard conditions Fig. 1 with image from Thorpe et al., 2005
heart looping disrupted, abnormal TL + MO1-wnt8a standard conditions Fig. 1 with image from Lin et al., 2009
Kupffer's vesicle cilium decreased length, abnormal TL + MO1-wnt8a standard conditions Fig. 2 with image from Lin et al., 2009
embryonic heart tube left/right pattern formation disrupted, abnormal TL + MO1-wnt8a standard conditions Fig. 1 with imageFig. 3 with image from Lin et al., 2009
telencephalon increased size, abnormal TU + MO1-wnt8a + MO2-wnt8a standard conditions Fig. 3 with image from Li et al., 2011
Fig. 3 from Ding et al., 2008
Fig. 3 from Gan et al., 2008
pronephric tubule cell increased distance pronephric tubule cell, abnormal TU + MO1-wnt8a + MO2-wnt8a chemical treatment by environment: aphidicolin, chemical treatment by environment: hydroxyurea Fig. 7 with image from Naylor et al., 2017
tail bud protruding, abnormal TU + MO1-wnt8a + MO2-wnt8a standard conditions Fig. 3 from Ding et al., 2008
pronephric tubule distal region slc12a3 expression decreased distribution, abnormal TU + MO1-wnt8a + MO2-wnt8a control Fig. 7 with image from Naylor et al., 2017
common myeloid progenitor spi1b expression decreased amount, abnormal TU + MO1-wnt8a + MO2-wnt8a control Fig. 8 with image from Naylor et al., 2017
pronephric tubule cell increased distance pronephric tubule cell, abnormal TU + MO1-wnt8a + MO2-wnt8a control Fig. 7 with image from Naylor et al., 2017
pronephric tubule distal region slc12a3 expression decreased amount, abnormal TU + MO1-wnt8a + MO2-wnt8a control Fig. 7 with image from Naylor et al., 2017
pronephric tubule proximal region has number of cell, ameliorated TU + MO1-wnt8a + MO2-wnt8a chemical treatment by environment: 6-bromoindirubin-3'-oxime Fig. 3 with image from Naylor et al., 2017
post-vent region decreased length, abnormal TU + MO1-wnt8a + MO2-wnt8a standard conditions Fig. 3 with image from Li et al., 2011
pronephric tubule cell population proliferation decreased occurrence, abnormal TU + MO1-wnt8a + MO2-wnt8a control Fig. 6 with image from Naylor et al., 2017
whole organism decreased size, abnormal TU + MO1-wnt8a + MO2-wnt8a standard conditions Fig. 2 with image from Naylor et al., 2017
whole organism wholly dorsalized, abnormal TU + MO1-wnt8a + MO2-wnt8a standard conditions Fig. 3 from Ding et al., 2008
presumptive ventral mesoderm cdx4 expression decreased amount, abnormal TU + MO1-wnt8a + MO2-wnt8a control Fig. 4 with image from He et al., 2017
whole organism shape, abnormal TU + MO1-wnt8a + MO2-wnt8a standard conditions Fig. 3 from Ding et al., 2008
shield increased width, abnormal TU + MO1-wnt8a + MO2-wnt8a standard conditions Fig. 4 with image from Li et al., 2011
erythroid lineage cell gata1a expression decreased amount, abnormal TU + MO1-wnt8a + MO2-wnt8a control Fig. 8 with image from Naylor et al., 2017
pronephric tubule proximal region has fewer parts of type cell, abnormal TU + MO1-wnt8a + MO2-wnt8a control Fig. 3 with image from Naylor et al., 2017
post-vent region decreased size, abnormal TU + MO1-wnt8a + MO2-wnt8a standard conditions Fig. 3 from Ding et al., 2008
Fig. 3 from Gan et al., 2008
pronephros pax2a expression decreased amount, abnormal TU + MO1-wnt8a + MO2-wnt8a control Fig. 3 with image from Naylor et al., 2017
pronephric tubule Ab1-hnf1b labeling decreased amount, abnormal TU + MO1-wnt8a + MO2-wnt8a control Fig. 3 with image from Naylor et al., 2017
canonical Wnt signaling pathway decreased process quality, abnormal TU + MO1-wnt8a + MO2-wnt8a control Fig. 4 with image from He et al., 2017
trunk decreased length, abnormal TU + MO1-wnt8a + MO2-wnt8a standard conditions Fig. 3 with image from Li et al., 2011
pronephric tubule Ab1-hnf1b labeling amount, ameliorated TU + MO1-wnt8a + MO2-wnt8a chemical treatment by environment: 6-bromoindirubin-3'-oxime Fig. 3 with image from Naylor et al., 2017
whole organism wholly anteriorized, abnormal TU + MO1-wnt8a + MO2-wnt8a standard conditions Fig. 3 from Gan et al., 2008
caudal fin morphology, abnormal TU + MO1-wnt8a + MO2-wnt8a standard conditions Fig. 2 with image from Naylor et al., 2017
head increased size, abnormal TU + MO1-wnt8a + MO2-wnt8a standard conditions Fig. 3 from Gan et al., 2008
trunk posterior region absent, abnormal TU + MO1-wnt8a + MO2-wnt8a standard conditions Fig. 2 with image from Naylor et al., 2017
pronephros pax2a expression amount, ameliorated TU + MO1-wnt8a + MO2-wnt8a chemical treatment by environment: 6-bromoindirubin-3'-oxime Fig. 3 with image from Naylor et al., 2017
caudal fin absent, abnormal TU + MO1-wnt8a + MO2-wnt8a standard conditions Fig. 2 with image from Naylor et al., 2017
presumptive ventral mesoderm tbx6 expression decreased amount, abnormal TU + MO1-wnt8a + MO2-wnt8a control Fig. 4 with image from He et al., 2017
pronephric tubule slc12a3 expression decreased amount, abnormal TU + MO1-wnt8a + MO2-wnt8a standard conditions Fig. 4 with image from Naylor et al., 2017
histone H4K20 methyltransferase activity disrupted, abnormal TU + MO1-wnt8a + MO2-wnt8a standard conditions Fig. 3 with image from Li et al., 2011
apoptotic process decreased occurrence, abnormal TU + MO1-wnt8a + MO2-wnt8a + MO4-tp53 standard conditions Fig. 4 with image from Naylor et al., 2017
pronephric tubule slc12a3 expression decreased amount, abnormal TU + MO1-wnt8a + MO2-wnt8a + MO4-tp53 standard conditions Fig. 4 with image from Naylor et al., 2017
whole organism posterior region ab1-casp3 labeling decreased amount, abnormal TU + MO1-wnt8a + MO2-wnt8a + MO4-tp53 standard conditions Fig. 4 with image from Naylor et al., 2017
whole organism znf703 expression absent, abnormal WT + MO1-wnt8a standard conditions Fig. 4 with image from Dutta et al., 2015
neural crest cell morphology, abnormal WT + MO1-wnt8a standard conditions Fig. 3 with image from Dutta et al., 2010
presumptive neural plate wholly anteriorized, abnormal WT + MO1-wnt8a standard conditions Fig. 3 with image from Rhinn et al., 2009
neural keel wholly anteriorized, abnormal WT + MO1-wnt8a standard conditions Fig. 3 with image from Rhinn et al., 2009
neural crest cell differentiation disrupted, abnormal WT + MO1-wnt8a standard conditions Fig. 3 with image from Dutta et al., 2010
midbrain decreased size, abnormal WT + MO1-wnt8a + MO2-wnt8a standard conditions Fig. 7 from Lekven et al., 2001
presumptive mesoderm wholly dorsalized, abnormal WT + MO1-wnt8a + MO2-wnt8a standard conditions Fig. 6 from Lekven et al., 2001
forebrain increased size, abnormal WT + MO1-wnt8a + MO2-wnt8a standard conditions Fig. S1 from Kagermeier-Schenk et al., 2011
forebrain prominent, abnormal WT + MO1-wnt8a + MO2-wnt8a standard conditions Fig. 7 from Lekven et al., 2001
whole organism wholly dorsalized, abnormal WT + MO1-wnt8a + MO2-wnt8a standard conditions Fig. 6 with image from Wylie et al., 2014
somite decreased amount, abnormal WT + MO1-wnt8a + MO2-wnt8a standard conditions Fig. 7 from Lekven et al., 2001
post-vent region decreased size, abnormal WT + MO1-wnt8a + MO2-wnt8a standard conditions Fig. 7 from Lekven et al., 2001
post-vent region decreased length, abnormal WT + MO1-wnt8a + MO2-wnt8a standard conditions Fig. Table 1 from Shimizu et al., 2005
Fig. 7 from Lekven et al., 2001
whole organism dorsal region gsc expression increased distribution, abnormal WT + MO1-wnt8a + MO2-wnt8a standard conditions Fig. 3 with image from Kagermeier-Schenk et al., 2011
head increased size, abnormal WT + MO1-wnt8a + MO2-wnt8a standard conditions Fig. Table 1 from Shimizu et al., 2005
telencephalon increased size, abnormal WT + MO1-wnt8a + MO2-wnt8a standard conditions Fig. 4 with image from Waxman et al., 2004
eye increased size, abnormal WT + MO1-wnt8a + MO2-wnt8a standard conditions Fig. S1 from Kagermeier-Schenk et al., 2011
embryonic pattern specification disrupted, abnormal WT + MO1-wnt8a + MO2-wnt8a standard conditions Fig. 6 from Lekven et al., 2001
presumptive neural plate wholly anteriorized, abnormal WT + MO1-wnt8a + MO2-wnt8a standard conditions Fig. 6 from Lekven et al., 2001
margin tpbga expression decreased distribution, abnormal WT + MO1-wnt8a + MO2-wnt8a standard conditions Fig. S1 from Kagermeier-Schenk et al., 2011
post-vent region kinked, abnormal WT + MO1-wnt8a + MO2-wnt8a standard conditions Fig. Table 1 from Shimizu et al., 2005
post-vent region has fewer parts of type somite, abnormal WT + MO1-wnt8a + MO2-wnt8a standard conditions Fig. Table 1 from Shimizu et al., 2005
trunk decreased size, abnormal WT + MO1-wnt8a + MO2-wnt8a standard conditions Fig. 7 from Lekven et al., 2001
forebrain distended, abnormal WT + MO1-wnt8a + MO2-wnt8a standard conditions Fig. 7 from Lekven et al., 2001
whole organism posterior region absent, abnormal WT + MO1-wnt8a + MO2-wnt8a standard conditions Fig. S1 from Kagermeier-Schenk et al., 2011
presumptive telencephalon foxg1a expression increased distribution, abnormal WT + MO1-wnt8a + MO2-wnt8a standard conditions Fig. 3 with image from Kagermeier-Schenk et al., 2011
post-vent region curved ventral, abnormal WT + MO1-wnt8a + MO2-wnt8a standard conditions Fig. Table 1 from Shimizu et al., 2005
whole organism dead, abnormal WT + MO1-wnt8a + MO2-wnt8a + MO7-wnt8a standard conditions Fig. 6 with image from Wylie et al., 2014
whole organism wholly dorsalized, abnormal WT + MO1-wnt8a + MO2-wnt8a + MO7-wnt8a standard conditions Fig. 6 with image from Wylie et al., 2014
canonical Wnt signaling pathway decreased process quality, abnormal cdkn2aipcas009/cas009 + MO1-wnt8a + MO2-wnt8a control Fig. 4 with image from He et al., 2017
presumptive ventral mesoderm tbx6 expression decreased amount, abnormal cdkn2aipcas009/cas009 + MO1-wnt8a + MO2-wnt8a control Fig. 4 with image from He et al., 2017
presumptive ventral mesoderm cdx4 expression decreased amount, abnormal cdkn2aipcas009/cas009 + MO1-wnt8a + MO2-wnt8a control Fig. 4 with image from He et al., 2017
canonical Wnt signaling pathway decreased process quality, abnormal cdkn2aipcas009/cas009 + MO1-wnt8a + MO2-wnt8a + MO7-tp53 control Fig. 4 with image from He et al., 2017
presumptive ventral mesoderm tbx6 expression decreased amount, abnormal cdkn2aipcas009/cas009 + MO1-wnt8a + MO2-wnt8a + MO7-tp53 control Fig. 4 with image from He et al., 2017
presumptive ventral mesoderm cdx4 expression decreased amount, abnormal cdkn2aipcas009/cas009 + MO1-wnt8a + MO2-wnt8a + MO7-tp53 control Fig. 4 with image from He et al., 2017
post-vent region aplastic, abnormal tbx16b104/b104 + MO1-wnt8a + MO2-wnt8a (AB) standard conditions Fig. 7 from Lekven et al., 2001
somite aplastic, abnormal tbx16b104/b104 + MO1-wnt8a + MO2-wnt8a (AB) standard conditions Fig. 7 from Lekven et al., 2001
trunk aplastic, abnormal tbx16b104/b104 + MO1-wnt8a + MO2-wnt8a (AB) standard conditions Fig. 7 from Lekven et al., 2001
trunk aplastic, abnormal tbxtab160/b160 + MO1-wnt8a + MO2-wnt8a (AB) standard conditions Fig. 7 from Lekven et al., 2001
somite structure, abnormal tbxtab160/b160 + MO1-wnt8a + MO2-wnt8a (AB) standard conditions Fig. 7 from Lekven et al., 2001
somite decreased amount, abnormal tbxtab160/b160 + MO1-wnt8a + MO2-wnt8a (AB) standard conditions Fig. 7 from Lekven et al., 2001
somite fused with somite, abnormal tbxtab160/b160 + MO1-wnt8a + MO2-wnt8a (AB) standard conditions Fig. 7 from Lekven et al., 2001
post-vent region aplastic, abnormal tbxtab160/b160 + MO1-wnt8a + MO2-wnt8a (AB) standard conditions Fig. 7 from Lekven et al., 2001
tail bud decreased length, abnormal AB + MO1-wnt3a + MO1-wnt8a + MO2-wnt8a standard conditions Fig. 1 with image from Thorpe et al., 2005
somite decreased amount, abnormal AB + MO1-wnt3a + MO1-wnt8a + MO2-wnt8a standard conditions Fig. 4 with image from Thorpe et al., 2005
post-anal tail morphogenesis disrupted, abnormal AB + MO1-wnt3a + MO1-wnt8a + MO2-wnt8a standard conditions Fig. 1 with image from Thorpe et al., 2005
notochord truncated, abnormal AB + MO1-wnt3a + MO1-wnt8a + MO2-wnt8a standard conditions Fig. 4 with image from Thorpe et al., 2005
central canal dilated, abnormal AB + MO1-wnt3a + MO1-wnt8a + MO2-wnt8a standard conditions Fig. 4 with image from Thorpe et al., 2005
tail bud bent, abnormal AB + MO1-wnt3a + MO1-wnt8a + MO2-wnt8a standard conditions Fig. 4 with image from Thorpe et al., 2005
post-vent region decreased length, abnormal AB + MO1-wnt3a + MO1-wnt8a + MO2-wnt8a standard conditions Fig. 1 with image from Thorpe et al., 2005
whole organism decreased length, abnormal AB + MO1-wnt3a + MO1-wnt8a + MO2-wnt8a standard conditions Fig. 1 with image from Thorpe et al., 2005
tail bud morphology, abnormal AB + MO1-wnt3a + MO1-wnt8a + MO2-wnt8a standard conditions Fig. 4 with image from Thorpe et al., 2005
Kupffer's vesicle cilium decreased length, abnormal TL + MO1-wnt3a + MO1-wnt8a standard conditions Fig. 2 with image from Lin et al., 2009
embryonic heart tube left/right pattern formation disrupted, abnormal TL + MO1-wnt3a + MO1-wnt8a standard conditions Fig. 1 with image from Lin et al., 2009
heart looping disrupted, abnormal TL + MO1-wnt3a + MO1-wnt8a standard conditions Fig. 1 with image from Lin et al., 2009
canonical Wnt signaling pathway decreased process quality, abnormal TU + MO1-cdkn2aip + MO1-wnt8a + MO2-wnt8a control Fig. 4 with image from He et al., 2017
presumptive ventral mesoderm tbx6 expression decreased amount, abnormal TU + MO1-cdkn2aip + MO1-wnt8a + MO2-wnt8a control Fig. 4 with image from He et al., 2017
presumptive ventral mesoderm cdx4 expression decreased amount, abnormal TU + MO1-cdkn2aip + MO1-wnt8a + MO2-wnt8a control Fig. 4 with image from He et al., 2017
canonical Wnt signaling pathway decreased process quality, abnormal TU + MO1-cdkn2aip + MO1-wnt8a + MO2-wnt8a + MO7-tp53 control Fig. 4 with image from He et al., 2017
presumptive ventral mesoderm tbx6 expression decreased amount, abnormal TU + MO1-cdkn2aip + MO1-wnt8a + MO2-wnt8a + MO7-tp53 control Fig. 4 with image from He et al., 2017
presumptive ventral mesoderm cdx4 expression decreased amount, abnormal TU + MO1-cdkn2aip + MO1-wnt8a + MO2-wnt8a + MO7-tp53 control Fig. 4 with image from He et al., 2017
post-vent region decreased length, abnormal TU + MO1-kmt5aa + MO1-wnt8a + MO2-wnt8a standard conditions Fig. 3 with image from Li et al., 2011
telencephalon increased size, abnormal TU + MO1-kmt5aa + MO1-wnt8a + MO2-wnt8a standard conditions Fig. 3 with image from Li et al., 2011
trunk decreased length, abnormal TU + MO1-kmt5aa + MO1-wnt8a + MO2-wnt8a standard conditions Fig. 3 with image from Li et al., 2011
telencephalon increased size, abnormal WT + MO1-dact1 + MO1-wnt8a + MO2-wnt8a standard conditions Fig. 4 with image from Waxman et al., 2004
head decreased size, abnormal WT + MO1-dact1 + MO1-wnt8a + MO2-wnt8a standard conditions Fig. 4 with image from Waxman et al., 2004
post-vent region decreased size, abnormal WT + MO1-dact1 + MO1-wnt8a + MO2-wnt8a standard conditions Fig. 4 with image from Waxman et al., 2004
whole organism wholly anteriorized, abnormal WT + MO1-dact1 + MO1-wnt8a + MO2-wnt8a standard conditions Fig. 4 with image from Waxman et al., 2004
whole organism frzb expression amount, ameliorated WT + MO1-nanog + MO1-wnt8a + MO2-wnt8a standard conditions Fig 3 with image from He et al., 2020
whole organism emx1 expression amount, ameliorated WT + MO1-nanog + MO1-wnt8a + MO2-wnt8a standard conditions Fig 3 with image from He et al., 2020
whole organism dkk1b expression amount, ameliorated WT + MO1-nanog + MO1-wnt8a + MO2-wnt8a standard conditions Fig 3 with image from He et al., 2020
whole organism six3b expression increased amount, abnormal WT + MO1-nanog + MO1-wnt8a + MO2-wnt8a standard conditions Fig 3 with image from He et al., 2020
whole organism sp5l expression position, ameliorated WT + MO1-nanog + MO1-wnt8a + MO2-wnt8a standard conditions Fig 3 with image from He et al., 2020
post-vent region has fewer parts of type somite, abnormal WT + MO1-wnt3a + MO1-wnt8a + MO2-wnt8a standard conditions Fig. Table 1 from Shimizu et al., 2005
post-vent region truncated, abnormal WT + MO1-wnt3a + MO1-wnt8a + MO2-wnt8a standard conditions Fig. Table 1 from Shimizu et al., 2005
head increased size, abnormal WT + MO1-wnt3a + MO1-wnt8a + MO2-wnt8a standard conditions Fig. Table 1 from Shimizu et al., 2005
post-vent region decreased length, abnormal WT + MO1-wnt3a + MO1-wnt8a + MO2-wnt8a standard conditions Fig. Table 1 from Shimizu et al., 2005
post-vent region kinked, abnormal WT + MO1-wnt3a + MO1-wnt8a + MO2-wnt8a standard conditions Fig. Table 1 from Shimizu et al., 2005
post-vent region decreased length, abnormal WT + MO1-wnt8a + MO2-wnt3a + MO2-wnt8a standard conditions Fig. Table 1 from Shimizu et al., 2005
head increased size, abnormal WT + MO1-wnt8a + MO2-wnt3a + MO2-wnt8a standard conditions Fig. Table 1 from Shimizu et al., 2005
post-vent region has fewer parts of type somite, abnormal WT + MO1-wnt8a + MO2-wnt3a + MO2-wnt8a standard conditions Fig. Table 1 from Shimizu et al., 2005
post-vent region kinked, abnormal WT + MO1-wnt8a + MO2-wnt3a + MO2-wnt8a standard conditions Fig. Table 1 from Shimizu et al., 2005
post-vent region truncated, abnormal WT + MO1-wnt8a + MO2-wnt3a + MO2-wnt8a standard conditions Fig. Table 1 from Shimizu et al., 2005
head truncated, abnormal WT + MO1-foxa3 + MO1-gsc + MO1-wnt8a standard conditions Fig. 6 with image from Seiliez et al., 2006
eye fused with eye, abnormal WT + MO1-foxa3 + MO1-gsc + MO1-wnt8a standard conditions Fig. 6 with image from Seiliez et al., 2006
Citations