header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-110201-2
Morpholino Name: MO2-setdb2
Target: setdb2 (1)
Previous Name: MO2 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TTGCTGTGTCGGCTTCAGTCTCCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-setdb2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-setdb2
Expressed Gene Anatomy Figures
cebpa Fig. 2 with image from Xu et al., 2010
chrd Fig. 4 with image from Xu et al., 2010
dand5 Fig. 3 with image from Xu et al., 2010
dnah9 Fig. 3 with image from Xu et al., 2010
fgf8a Fig. 4 with image from Xu et al., 2010
gsc Fig. 4 with image from Xu et al., 2010
ins Fig. 2 with image from Xu et al., 2010
lft1 Fig. 2 with image from Xu et al., 2010
lft2 Fig. 3 with image from Xu et al., 2010
myl7 Fig. 2 with image from Xu et al., 2010
noto Fig. 4 with image from Xu et al., 2010
pitx2 Fig. 3 with image from Xu et al., 2010
shha Fig. S5 with image from Xu et al., 2010
spaw Fig. 3 with image from Xu et al., 2010
tbxta Fig. S5 with image from Xu et al., 2010
tdgf1 Fig. S5 with image from Xu et al., 2010
PHENOTYPE
Phenotype resulting from MO2-setdb2
Phenotype Figures
axis decreased length, abnormal Fig. S5 with image from Xu et al., 2010
axis increased width, abnormal Fig. S5 with image from Xu et al., 2010
determination of digestive tract left/right asymmetry disrupted, abnormal Fig. 2 with image from Xu et al., 2010
determination of heart left/right asymmetry disrupted, abnormal Fig. 2 with imageFig. 3 with image from Xu et al., 2010
determination of left/right asymmetry in diencephalon disrupted, abnormal Fig. 2 with image from Xu et al., 2010
determination of left/right asymmetry in lateral mesoderm disrupted, abnormal Fig. 3 with image from Xu et al., 2010
determination of left/right symmetry disrupted, abnormal Fig. 4 with image from Xu et al., 2010
determination of liver left/right asymmetry disrupted, abnormal Fig. 2 with image from Xu et al., 2010
determination of pancreatic left/right asymmetry disrupted, abnormal Fig. 2 with image from Xu et al., 2010
diencephalon structure, abnormal Fig. 2 with image from Xu et al., 2010
gut centered, abnormal Fig. 2 with image from Xu et al., 2010
gut mislocalised radially, abnormal Fig. 2 with image from Xu et al., 2010
heart tube centered, abnormal Fig. 2 with image from Xu et al., 2010
heart tube mislocalised radially, abnormal Fig. 2 with image from Xu et al., 2010
Kupffer's vesicle cilium decreased amount, abnormal Fig. 3 with image from Xu et al., 2010
lateral plate mesoderm structure, abnormal Fig. 3 with image from Xu et al., 2010
liver centered, abnormal Fig. 2 with image from Xu et al., 2010
liver mislocalised radially, abnormal Fig. 2 with image from Xu et al., 2010
notochord undulate, abnormal Fig. S5 with image from Xu et al., 2010
pancreas centered, abnormal Fig. 2 with image from Xu et al., 2010
pancreas mislocalised radially, abnormal Fig. 2 with image from Xu et al., 2010
primitive heart tube centered, abnormal Fig. 3 with image from Xu et al., 2010
primitive heart tube mislocalised radially, abnormal Fig. 3 with image from Xu et al., 2010
shield distended, abnormal Fig. 4 with image from Xu et al., 2010

Phenotype of all Fish created by or utilizing MO2-setdb2
Phenotype Fish Conditions Figures
gut centered, abnormal WT + MO2-setdb2 standard conditions Fig. 2 with image from Xu et al., 2010
heart tube mislocalised radially, abnormal WT + MO2-setdb2 standard conditions Fig. 2 with image from Xu et al., 2010
primitive heart tube mislocalised radially, abnormal WT + MO2-setdb2 standard conditions Fig. 3 with image from Xu et al., 2010
diencephalon structure, abnormal WT + MO2-setdb2 standard conditions Fig. 2 with image from Xu et al., 2010
pancreas centered, abnormal WT + MO2-setdb2 standard conditions Fig. 2 with image from Xu et al., 2010
primitive heart tube centered, abnormal WT + MO2-setdb2 standard conditions Fig. 3 with image from Xu et al., 2010
determination of left/right asymmetry in diencephalon disrupted, abnormal WT + MO2-setdb2 standard conditions Fig. 2 with image from Xu et al., 2010
axis increased width, abnormal WT + MO2-setdb2 standard conditions Fig. S5 with image from Xu et al., 2010
pancreas mislocalised radially, abnormal WT + MO2-setdb2 standard conditions Fig. 2 with image from Xu et al., 2010
liver mislocalised radially, abnormal WT + MO2-setdb2 standard conditions Fig. 2 with image from Xu et al., 2010
determination of pancreatic left/right asymmetry disrupted, abnormal WT + MO2-setdb2 standard conditions Fig. 2 with image from Xu et al., 2010
lateral plate mesoderm structure, abnormal WT + MO2-setdb2 standard conditions Fig. 3 with image from Xu et al., 2010
determination of left/right asymmetry in lateral mesoderm disrupted, abnormal WT + MO2-setdb2 standard conditions Fig. 3 with image from Xu et al., 2010
determination of liver left/right asymmetry disrupted, abnormal WT + MO2-setdb2 standard conditions Fig. 2 with image from Xu et al., 2010
determination of left/right symmetry disrupted, abnormal WT + MO2-setdb2 standard conditions Fig. 4 with image from Xu et al., 2010
notochord undulate, abnormal WT + MO2-setdb2 standard conditions Fig. S5 with image from Xu et al., 2010
Kupffer's vesicle cilium decreased amount, abnormal WT + MO2-setdb2 standard conditions Fig. 3 with image from Xu et al., 2010
gut mislocalised radially, abnormal WT + MO2-setdb2 standard conditions Fig. 2 with image from Xu et al., 2010
determination of digestive tract left/right asymmetry disrupted, abnormal WT + MO2-setdb2 standard conditions Fig. 2 with image from Xu et al., 2010
shield distended, abnormal WT + MO2-setdb2 standard conditions Fig. 4 with image from Xu et al., 2010
heart tube centered, abnormal WT + MO2-setdb2 standard conditions Fig. 2 with image from Xu et al., 2010
determination of heart left/right asymmetry disrupted, abnormal WT + MO2-setdb2 standard conditions Fig. 2 with imageFig. 3 with image from Xu et al., 2010
liver centered, abnormal WT + MO2-setdb2 standard conditions Fig. 2 with image from Xu et al., 2010
axis decreased length, abnormal WT + MO2-setdb2 standard conditions Fig. S5 with image from Xu et al., 2010
OTHER MO2-setdb2 MORPHOLINO PAGES No links to external sites
CITATIONS (1)