Morpholino
MO1-spi1b
- ID
- ZDB-MRPHLNO-050224-1
- Name
- MO1-spi1b
- Previous Names
- Target
- Sequence
-
5' - GATATACTGATACTCCATTGGTGGT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-spi1b
No data available
Phenotype
Phenotype resulting from MO1-spi1b
1 - 5 of 39 Show all
Phenotype of all Fish created by or utilizing MO1-spi1b
1 - 5 of 150 Show all
Citations
- El Omar, R., Abdellaoui, N., Coulibaly, S.T., Fontenille, L., Lanza, F., Gachet, C., Freund, J.N., Negroni, M., Kissa, K., Tavian, M. (2024) Macrophage depletion overcomes human hematopoietic cell engraftment failure in zebrafish embryo. Cell Death & Disease. 15:305305
- Thrikawala, S.U., Anderson, M.H., Rosowski, E.E. (2024) Glucocorticoids Suppress NF-κB-Mediated Neutrophil Control of Aspergillus fumigatus Hyphal Growth. Journal of immunology (Baltimore, Md. : 1950). 213(7):971-987
- Ellett, F., Kacamak, N.I., Alvarez, C.R., Oliveira, E.H.S., Hasturk, H., Paster, B.J., Kantarci, A., Irimia, D. (2023) Fusobacterium nucleatum dissemination by neutrophils. Journal of oral microbiology. 15:22170672217067
- Lensen, A., Gomes, M.C., López-Jiménez, A.T., Mostowy, S. (2023) An automated microscopy workflow to study Shigella-neutrophil interactions and antibiotic efficacy in vivo. Disease models & mechanisms. 16(6):
- Viana, F., Boucontet, L., Laghi, V., Schator, D., Ibranosyan, M., Jarraud, S., Colucci-Guyon, E., Buchrieser, C. (2023) Hiding in the yolk: A unique feature of Legionella pneumophila infection of zebrafish. PLoS pathogens. 19:e1011375e1011375
- Capon, S.J., Uribe, V., Dominado, N., Ehrlich, O., Smith, K.A. (2022) Endocardial identity is established during early somitogenesis by Bmp signalling acting upstream of npas4l and etv2. Development (Cambridge, England). 149(9):
- Chen, X.K., Kwan, J.S., Wong, G.T., Yi, Z.N., Ma, A.C., Chang, R.C. (2022) Leukocyte invasion of the brain after peripheral trauma in zebrafish (Danio rerio). Experimental & molecular medicine. 54(7):973-987
- Demy, D.L., Touret, A.L., Lancino, M., Tauzin, M., Capuana, L., Pierre, C., Herbomel, P. (2022) Trim33 conditions the lifespan of primitive macrophages and onset of definitive macrophage production. Development (Cambridge, England). 149(18):
- Forn-Cuní, G., Welvaarts, L., Stel, F.M., van den Hondel, C.J., Arentshorst, M., Ram, A., Meijer, A.H. (2022) Stimulating the autophagic-lysosomal axis enhances host defense against fungal infection in a zebrafish model of invasive Aspergillosis. Autophagy. 19(1):324-337
- Haraoka, Y., Akieda, Y., Nagai, Y., Mogi, C., Ishitani, T. (2022) Zebrafish imaging reveals TP53 mutation switching oncogene-induced senescence from suppressor to driver in primary tumorigenesis. Nature communications. 13:1417
1 - 10 of 112
Show