Morpholino

MO1-spi1b

ID
ZDB-MRPHLNO-050224-1
Name
MO1-spi1b
Previous Names
  • MO1-spi1
  • pU1-MO (1)
  • pu.1 morpholino (1)
Target
Sequence
5' - GATATACTGATACTCCATTGGTGGT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-spi1b
Expressed Gene Anatomy Figures
alox5ap Fig. 2 from Zakrzewska et al., 2010
apoeb Fig. 4 with image from Peri et al., 2008
cebp1 Fig. 3 with image from Kitaguchi et al., 2009
cxcl8a Figure 2 with image from Hassan-Abdi et al., 2019
cxcr3.2 Fig. 2Fig. 3 from Zakrzewska et al., 2010
drl Fig. 6 with image from Pimtong et al., 2014
drll.1 Fig. 6 with image from Pimtong et al., 2014
drll.2 Fig. 6 with image from Pimtong et al., 2014
drll.3 Fig. 6 with image from Pimtong et al., 2014
gata1a Fig. 3 from Bukrinsky et al., 2009
Fig. 3 from Sumanas et al., 2008
Fig. 3 from Rhodes et al., 2005
grap2b Fig. 2 from Zakrzewska et al., 2010
hbae1.1 Fig. 2Fig. 3 from Rhodes et al., 2005
il1b Figure 2 with image from Hassan-Abdi et al., 2019
lcp1 Fig. 6 with image from Pimtong et al., 2014
Fig. 1 from Zakrzewska et al., 2010
Fig. 3Fig. 5 from Bukrinsky et al., 2009
Fig. 6 from Clatworthy et al., 2009
Fig. 6 with image from Carney et al., 2007
Fig. 2Fig. 3 from Rhodes et al., 2005
lgals9l1 Fig. 2 from Zakrzewska et al., 2010
lmo2 Fig. 5 from Rhodes et al., 2005
lyz Fig. 3 with image from Kitaguchi et al., 2009
text only from Rhodes et al., 2005
marco Fig. 2 from Zakrzewska et al., 2010
mfap4.1 Fig. 2Fig. 3 from Zakrzewska et al., 2010
mpeg1.1 Fig. 2Fig. 3 from Zakrzewska et al., 2010
mpx Fig. 3Fig. 5 from Bukrinsky et al., 2009
Fig. 8 with image from Walters et al., 2009
Fig. 4 from Mathias et al., 2007
Fig. 2 from Rhodes et al., 2005
nkx2.5 Fig. 2 from Rhodes et al., 2005
plek Fig. 2 from Zakrzewska et al., 2010
pls1 Fig. S1 from Mathias et al., 2007
ptpn6 Fig. 2Fig. 3 from Zakrzewska et al., 2010
runx1 Fig. 3 with image from Kitaguchi et al., 2009
Fig. 5 from Rhodes et al., 2005
slc4a1a Fig. 6 with image from Pimtong et al., 2014
slc7a7 Fig. 3 with image from Rossi et al., 2015
spi1a Fig. 4 from Bukrinsky et al., 2009
spi1b Fig. 4 from Bukrinsky et al., 2009
Fig. 2 from Rhodes et al., 2005
tal1 Fig. 5Fig. S3 from Rhodes et al., 2005
tnfa Fig. 7 from Espín-Palazón et al., 2014
vegfc Fig. 8 with image from Helker et al., 2013
zgc:64051 Fig. 2 from Zakrzewska et al., 2010
Phenotype
Phenotype resulting from MO1-spi1b
Phenotype Fish Figures
blood island lacks parts or has fewer parts of type granulocyte, abnormal WT + MO1-spi1b Fig. 3Fig. 5 from Bukrinsky et al., 2009
blood island lacks parts or has fewer parts of type macrophage, abnormal WT + MO1-spi1b Fig. 3Fig. 5 from Bukrinsky et al., 2009
blood island macrophage decreased amount, abnormal WT + MO1-spi1b Fig. 1 from Tenor et al., 2015
blood island neutrophil decreased amount, abnormal nz117Tg + MO1-spi1b Fig. 1 from Tenor et al., 2015
brain lacks all parts of type microglial cell, abnormal WT + MO1-spi1b Fig. 1 with image from Villani et al., 2019
Fig. 3 with image from Rossi et al., 2015
Fig. S7 from Flinn et al., 2013
brain apoptotic cell clearance decreased occurrence, abnormal WT + MO1-spi1b Fig. 2 from Mazaheri et al., 2014
brain phagocytosis decreased occurrence, abnormal WT + MO1-spi1b Fig. 1 with image from Villani et al., 2019
common cardinal vein blood vessel endothelial cell increased amount, abnormal WT + MO1-spi1b Fig. 8 with image from Helker et al., 2013
head macrophage mCherry expression decreased distribution, abnormal gl23Tg + MO1-spi1b Fig. 4 with image from Chernyavskaya et al., 2017
head neutrophil DsRed2 expression decreased distribution, abnormal nz50Tg + MO1-spi1b Fig. 4 with image from Chernyavskaya et al., 2017
intermediate cell mass of mesoderm drll.1 expression increased amount, abnormal AB + MO1-spi1b Fig. 6 with image from Pimtong et al., 2014
intermediate cell mass of mesoderm drl expression increased amount, abnormal AB + MO1-spi1b Fig. 6 with image from Pimtong et al., 2014
intermediate cell mass of mesoderm drll.3 expression increased amount, abnormal AB + MO1-spi1b Fig. 6 with image from Pimtong et al., 2014
intermediate cell mass of mesoderm drll.2 expression increased amount, abnormal AB + MO1-spi1b Fig. 6 with image from Pimtong et al., 2014
macrophage absent, abnormal AB + MO1-spi1b Fig. 9 from Mathew et al., 2007
macrophage decreased amount, abnormal WT + MO1-spi1b Fig. 8 with image from Helker et al., 2013
microglia development arrested, abnormal WT + MO1-spi1b Fig. S7 from Flinn et al., 2013
microglia development decreased occurrence, abnormal WT + MO1-spi1b Fig. 3 with image from Rossi et al., 2015
microglial cell absent, abnormal WT + MO1-spi1b Fig. 2 from Mazaheri et al., 2014
Fig. 4 with image from Peri et al., 2008
midbrain blood vasculature has fewer parts of type macrophage, abnormal la4Tg; zf149Tg + MO1-spi1b Fig. 7 with image from Chen et al., 2012
monocyte lcp1 expression decreased amount, abnormal AB + MO1-spi1b Fig. 6 with image from Pimtong et al., 2014
muscle degenerate, abnormal WT + MO1-spi1b Fig. 8 with image from Walters et al., 2009
myeloid cell absent, abnormal WT + MO1-spi1b Fig. 1Fig. 3 from Zakrzewska et al., 2010
neuron axon decreased amount, abnormal WT + MO1-spi1b Fig. 4 from Mikdache et al., 2019
neutrophil absent, abnormal AB + MO1-spi1b Fig. 2 from Yoo et al., 2012
Fig. 9 from Mathew et al., 2007
Fig. 4 from Mathias et al., 2007
neutrophil decreased amount, abnormal WT + MO1-spi1b Fig. 8 with image from Walters et al., 2009
optic tectum microglial cell absent, abnormal WT + MO1-spi1b Figure 2 with image from Hassan-Abdi et al., 2019
optic tectum microglial cell ab2-lcp1 labeling absent, abnormal WT + MO1-spi1b Figure 2 with image from Hassan-Abdi et al., 2019
phagocytosis decreased occurrence, abnormal AB + MO1-spi1b Fig. 1 with image from van der Vaart et al., 2013
posterior lateral line ganglion has fewer parts of type neuron, abnormal WT + MO1-spi1b Fig. 4 from Mikdache et al., 2019
posterior lateral line ganglion apoptotic process increased occurrence, abnormal WT + MO1-spi1b Fig. 4 from Mikdache et al., 2019
regulation of myeloid leukocyte differentiation disrupted, abnormal WT + MO1-spi1b Fig. 3Fig. 4Fig. 5 from Bukrinsky et al., 2009
whole organism tnfa expression decreased amount, abnormal WT + MO1-spi1b Fig. 7 from Espín-Palazón et al., 2014
whole organism il1b expression decreased amount, abnormal WT + MO1-spi1b Figure 2 with image from Hassan-Abdi et al., 2019
whole organism cxcl8a expression decreased amount, abnormal WT + MO1-spi1b Figure 2 with image from Hassan-Abdi et al., 2019
yolk lacks parts or has fewer parts of type macrophage, abnormal WT + MO1-spi1b Fig. 3Fig. 5 from Bukrinsky et al., 2009
yolk lacks parts or has fewer parts of type granulocyte, abnormal WT + MO1-spi1b Fig. 3Fig. 5 from Bukrinsky et al., 2009
Phenotype of all Fish created by or utilizing MO1-spi1b
Phenotype Fish Conditions Figures
intermediate cell mass of mesoderm drll.3 expression increased amount, abnormal AB + MO1-spi1b standard conditions Fig. 6 with image from Pimtong et al., 2014
intermediate cell mass of mesoderm drll.1 expression increased amount, abnormal AB + MO1-spi1b standard conditions Fig. 6 with image from Pimtong et al., 2014
macrophage absent, abnormal AB + MO1-spi1b standard conditions Fig. 9 from Mathew et al., 2007
neutrophil absent, abnormal AB + MO1-spi1b standard conditions Fig. 9 from Mathew et al., 2007
Fig. 4 from Mathias et al., 2007
phagocytosis decreased occurrence, abnormal AB + MO1-spi1b standard conditions Fig. 1 with image from van der Vaart et al., 2013
monocyte lcp1 expression decreased amount, abnormal AB + MO1-spi1b standard conditions Fig. 6 with image from Pimtong et al., 2014
intermediate cell mass of mesoderm drl expression increased amount, abnormal AB + MO1-spi1b standard conditions Fig. 6 with image from Pimtong et al., 2014
intermediate cell mass of mesoderm drll.2 expression increased amount, abnormal AB + MO1-spi1b standard conditions Fig. 6 with image from Pimtong et al., 2014
myeloid cell absent, abnormal WT + MO1-spi1b standard conditions Fig. 1Fig. 3 from Zakrzewska et al., 2010
common cardinal vein blood vessel endothelial cell increased amount, abnormal WT + MO1-spi1b standard conditions Fig. 8 with image from Helker et al., 2013
brain apoptotic cell clearance decreased occurrence, abnormal WT + MO1-spi1b control Fig. 2 from Mazaheri et al., 2014
whole organism dead, abnormal WT + MO1-spi1b fungal treatment: Aspergillus fumigatus Fig. 1 from Knox et al., 2014
defense response to fungus process quality, abnormal WT + MO1-spi1b fungal treatment: Aspergillus fumigatus Fig. 1 from Knox et al., 2014
whole organism decreased life span, abnormal WT + MO1-spi1b fungal treatment: Aspergillus fumigatus Fig. 1 from Knox et al., 2014
regulation of myeloid leukocyte differentiation disrupted, abnormal WT + MO1-spi1b standard conditions Fig. 3Fig. 4Fig. 5 from Bukrinsky et al., 2009
macrophage decreased amount, abnormal WT + MO1-spi1b amputation: caudal fin Fig. 4 with image from Hasegawa et al., 2017
regenerating fin decreased length, abnormal WT + MO1-spi1b physical alteration: anatomical structure, chemical treatment: dibenziodolium Fig. 2 from Yoo et al., 2012
regenerating fin decreased length, abnormal WT + MO1-spi1b physical alteration: anatomical structure, chemical treatment: EC 2.7.10.2 (non-specific protein-tyrosine kinase) inhibitor Fig. 2 from Yoo et al., 2012
regenerating fin apoptotic process increased occurrence, abnormal WT + MO1-spi1b amputation: caudal fin Fig. 4 with imageFig. 5 with image from Hasegawa et al., 2017
muscle degenerate, abnormal WT + MO1-spi1b standard conditions Fig. 8 with image from Walters et al., 2009
neutrophil decreased amount, abnormal WT + MO1-spi1b standard conditions Fig. 8 with image from Walters et al., 2009
caudal fin regenerating fin il1b expression increased amount, abnormal WT + MO1-spi1b amputation: caudal fin Fig. 5 with image from Hasegawa et al., 2017
macrophage decreased amount, abnormal WT + MO1-spi1b standard conditions Fig. 8 with image from Helker et al., 2013
blood island lacks parts or has fewer parts of type macrophage, abnormal WT + MO1-spi1b standard conditions Fig. 3Fig. 5 from Bukrinsky et al., 2009
brain lacks all parts of type microglial cell, abnormal WT + MO1-spi1b standard conditions Fig. 1 with image from Villani et al., 2019
Fig. 3 with image from Rossi et al., 2015
Fig. S7 from Flinn et al., 2013
optic tectum microglial cell absent, abnormal WT + MO1-spi1b control Figure 2 with image from Hassan-Abdi et al., 2019
neutrophil decreased amount, abnormal WT + MO1-spi1b amputation: caudal fin Fig. 4 with image from Hasegawa et al., 2017
yolk lacks parts or has fewer parts of type granulocyte, abnormal WT + MO1-spi1b standard conditions Fig. 3Fig. 5 from Bukrinsky et al., 2009
optic tectum microglial cell ab2-lcp1 labeling absent, abnormal WT + MO1-spi1b control Figure 2 with image from Hassan-Abdi et al., 2019
whole organism il1b expression decreased amount, abnormal WT + MO1-spi1b control Figure 2 with image from Hassan-Abdi et al., 2019
posterior lateral line ganglion apoptotic process increased occurrence, abnormal WT + MO1-spi1b standard conditions Fig. 4 from Mikdache et al., 2019
whole organism decreased life span, abnormal WT + MO1-spi1b viral treatment: Sprivivirus cyprinus Fig. 6 from Varela et al., 2014
blood island macrophage decreased amount, abnormal WT + MO1-spi1b control Fig. 1 from Tenor et al., 2015
posterior lateral line ganglion has fewer parts of type neuron, abnormal WT + MO1-spi1b standard conditions Fig. 4 from Mikdache et al., 2019
brain phagocytosis decreased occurrence, abnormal WT + MO1-spi1b standard conditions Fig. 1 with image from Villani et al., 2019
yolk lacks parts or has fewer parts of type macrophage, abnormal WT + MO1-spi1b standard conditions Fig. 3Fig. 5 from Bukrinsky et al., 2009
whole organism cxcl8a expression decreased amount, abnormal WT + MO1-spi1b control Figure 2 with image from Hassan-Abdi et al., 2019
microglia development arrested, abnormal WT + MO1-spi1b standard conditions Fig. S7 from Flinn et al., 2013
blood island lacks parts or has fewer parts of type granulocyte, abnormal WT + MO1-spi1b standard conditions Fig. 3Fig. 5 from Bukrinsky et al., 2009
microglia development decreased occurrence, abnormal WT + MO1-spi1b standard conditions Fig. 3 with image from Rossi et al., 2015
regenerating fin apoptotic process occurrence, ameliorated WT + MO1-spi1b chemical treatment by environment: dexamethasone, amputation: caudal fin Fig. 5 with image from Hasegawa et al., 2017
neuron axon decreased amount, abnormal WT + MO1-spi1b standard conditions Fig. 4 from Mikdache et al., 2019
whole organism decreased life span, abnormal WT + MO1-spi1b fungal treatment by injection Fig. 1 from Tenor et al., 2015
whole organism decreased life span, abnormal WT + MO1-spi1b viral treatment: Chikungunya virus Fig. 7 with image from Palha et al., 2013
response to virus process quality, abnormal WT + MO1-spi1b viral treatment: Chikungunya virus Fig. 7 with image from Palha et al., 2013
microglial cell absent, abnormal WT + MO1-spi1b control Fig. 2 from Mazaheri et al., 2014
Fig. 4 with image from Peri et al., 2008
whole organism tnfa expression decreased amount, abnormal WT + MO1-spi1b standard conditions Fig. 7 from Espín-Palazón et al., 2014
head macrophage mCherry expression decreased distribution, abnormal gl23Tg + MO1-spi1b standard conditions Fig. 4 with image from Chernyavskaya et al., 2017
granuloma formation increased occurrence, abnormal i114Tg + MO1-spi1b bacterial treatment by injection: Mycobacterium marinum E11 Fig. 2 with image from Carvalho et al., 2011
macrophage activation involved in immune response disrupted, abnormal i114Tg + MO1-spi1b bacterial treatment by injection: Mycobacterium marinum E11 Fig. 2 with image from Carvalho et al., 2011
head neutrophil DsRed2 expression decreased distribution, abnormal nz50Tg + MO1-spi1b standard conditions Fig. 4 with image from Chernyavskaya et al., 2017
blood island neutrophil decreased amount, abnormal nz117Tg + MO1-spi1b control Fig. 1 from Tenor et al., 2015
neutrophil absent, abnormal uwm4Tg + MO1-spi1b standard conditions Fig. 2 from Yoo et al., 2012
midbrain blood vasculature has fewer parts of type macrophage, abnormal la4Tg; zf149Tg + MO1-spi1b standard conditions Fig. 7 with image from Chen et al., 2012
macrophage decreased amount, abnormal hey2m145/m145 + MO1-spi1b standard conditions Fig. 5 from Gray et al., 2007
dorsal aorta closed, abnormal hey2m145/m145 + MO1-spi1b standard conditions Fig. 5 from Gray et al., 2007
blood circulation disrupted, abnormal hey2m145/m145 + MO1-spi1b standard conditions Fig. 5 from Gray et al., 2007
muscle degenerate, abnormal noc3lhi1019Tg/hi1019Tg + MO1-spi1b standard conditions Fig. 8 with image from Walters et al., 2009
neutrophil decreased amount, abnormal noc3lhi1019Tg/hi1019Tg + MO1-spi1b standard conditions Fig. 8 with image from Walters et al., 2009
dopaminergic neuron decreased amount, abnormal pink1sh397/sh397 + MO1-spi1b standard conditions text only from Flinn et al., 2013
dopaminergic neuron differentiation process quality, abnormal pink1sh397/sh397 + MO1-spi1b standard conditions text only from Flinn et al., 2013
brain lacks all parts of type microglial cell, abnormal slc37a2t30301/t30301 + MO1-spi1b standard conditions Fig. 1 with image from Villani et al., 2019
brain phagocytosis decreased occurrence, abnormal slc37a2t30301/t30301 + MO1-spi1b standard conditions Fig. 1 with image from Villani et al., 2019
leukocyte absent, abnormal spint1ahi2217Tg/hi2217Tg + MO1-spi1b standard conditions Fig. 6 with image from Carney et al., 2007
epidermis development disrupted, abnormal spint1ahi2217Tg/hi2217Tg + MO1-spi1b standard conditions Fig. 6 with image from Carney et al., 2007
epidermis development disrupted, abnormal spint1ahi2217Tg/hi2217Tg + MO1-spi1b (AB) standard conditions Fig. 4 from Mathias et al., 2007
epidermis disorganized, abnormal spint1ahi2217Tg/hi2217Tg + MO1-spi1b (AB) standard conditions Fig. 4 from Mathias et al., 2007
macrophage absent, abnormal spint1ahi2217Tg/hi2217Tg + MO1-spi1b (AB) standard conditions Fig. S1 from Mathias et al., 2007
median fin fold degenerate, abnormal spint1ahi2217Tg/hi2217Tg + MO1-spi1b (AB) standard conditions Fig. 4 from Mathias et al., 2007
neutrophil absent, abnormal spint1ahi2217Tg/hi2217Tg + MO1-spi1b (AB) standard conditions Fig. 4 from Mathias et al., 2007
extension degenerate, abnormal spint1ahi2217Tg/hi2217Tg + MO1-spi1b (AB) standard conditions Fig. 4 from Mathias et al., 2007
median fin fold morphology, abnormal spint1ahi2217Tg/hi2217Tg + MO1-spi1b (AB) standard conditions Fig. S1 from Mathias et al., 2007
cell population proliferation increased rate, abnormal spint1ahi2217Tg/hi2217Tg + MO1-spi1b (AB) standard conditions Fig. 4 from Mathias et al., 2007
brain apoptotic process decreased occurrence, abnormal WT + MO1-casp3a + MO1-spi1b chemical treatment: Z-Val-Ala-Asp(OMe)-CH2F Fig. 2 with image from Casano et al., 2016
regenerating fin apoptotic process occurrence, ameliorated WT + MO1-il1b + MO1-spi1b amputation: caudal fin Fig. 5 with image from Hasegawa et al., 2017
caudal hematopoietic tissue hematopoietic multipotent progenitor cell decreased amount, abnormal WT + MO1-spi1b + MO2-spi1a chemical treatment by environment: nigericin Fig. 5 from Frame et al., 2020
caudal hematopoietic tissue hematopoietic multipotent progenitor cell decreased amount, abnormal WT + MO1-spi1b + MO2-spi1a standard conditions Fig. 5 from Frame et al., 2020
whole organism runx1 expression decreased amount, abnormal WT + MO1-spi1b + MO2-spi1a standard conditions Fig. 5 from Frame et al., 2020
regulation of hydrogen peroxide metabolic process disrupted, abnormal WT + MO1-spi1b + MO3-csf3r standard conditions Fig. 1 with image from Pase et al., 2012
head epidermis irg1l expression position, ameliorated WT + MO1-spi1b + MO4-csf3r bacterial treatment by injection: Salmonella enterica subsp. enterica serovar Typhimurium Fig. 2 from Hall et al., 2014
neuromast epithelium irg1l expression position, ameliorated WT + MO1-spi1b + MO4-csf3r bacterial treatment by injection: Salmonella enterica subsp. enterica serovar Typhimurium Fig. 2 from Hall et al., 2014
epithelial cell irg1l expression position, ameliorated WT + MO1-spi1b + MO4-csf3r bacterial treatment by injection: Salmonella enterica subsp. enterica serovar Typhimurium Fig. 2 from Hall et al., 2014
olfactory epithelium irg1l expression position, ameliorated WT + MO1-spi1b + MO4-csf3r bacterial treatment by injection: Salmonella enterica subsp. enterica serovar Typhimurium Fig. 2 from Hall et al., 2014
axon regeneration occurrence, ameliorated irf8st95/st95 + MO1-csf3r + MO1-spi1b transection: spinal cord Fig. 9 from Tsarouchas et al., 2018
whole organism tnfa expression decreased amount, abnormal irf8st95/st95 + MO1-csf3r + MO1-spi1b transection: spinal cord Fig. 9 from Tsarouchas et al., 2018
regenerating tissue neutrophil increased amount, abnormal irf8st95/st95 + MO1-csf3r + MO1-spi1b transection: spinal cord Fig. 9 from Tsarouchas et al., 2018
whole organism il1b expression decreased amount, abnormal irf8st95/st95 + MO1-csf3r + MO1-spi1b transection: spinal cord Fig. 9 from Tsarouchas et al., 2018
locomotion process quality, ameliorated irf8st95/st95 + MO1-csf3r + MO1-spi1b transection: spinal cord Fig. 9 from Tsarouchas et al., 2018
macrophage decreased amount, abnormal gl23Tg + MO1-spi1b + MO3-csf3r standard conditions Fig. S4 with image from Gauert et al., 2020
liver size, ameliorated gz32Tg + MO1-spi1b chemical treatment: doxycycline Fig. 3 from Yan et al., 2017
brain apoptotic cell clearance decreased occurrence, abnormal hdb6Tg + MO1-spi1b control Fig. 2 from Mazaheri et al., 2014
microglial cell absent, abnormal hdb6Tg + MO1-spi1b control Fig. 2 from Mazaheri et al., 2014
macrophage differentiation disrupted, abnormal nz50Tg + MO1-spi1b + MO3-csf3r standard conditions Fig. S4 with image from Feng et al., 2012
neutrophil decreased amount, abnormal nz50Tg + MO1-spi1b + MO3-csf3r chemical treatment: prostaglandin E2 Fig. S4 with image from Feng et al., 2012
neutrophil decreased amount, abnormal nz50Tg + MO1-spi1b + MO3-csf3r standard conditions Fig. S3 with imageFig. S4 with image from Feng et al., 2012
neutrophil differentiation disrupted, abnormal nz50Tg + MO1-spi1b + MO3-csf3r standard conditions Fig. S4 with image from Feng et al., 2012
macrophage decreased amount, abnormal nz50Tg + MO1-spi1b + MO3-csf3r chemical treatment: prostaglandin E2 Fig. S4 with image from Feng et al., 2012
macrophage decreased amount, abnormal nz50Tg + MO1-spi1b + MO3-csf3r standard conditions Fig. S4 with image from Feng et al., 2012
neutrophil differentiation disrupted, abnormal nz50Tg + MO1-spi1b + MO3-csf3r chemical treatment: prostaglandin E2 Fig. S4 with image from Feng et al., 2012
macrophage differentiation disrupted, abnormal nz50Tg + MO1-spi1b + MO3-csf3r chemical treatment: prostaglandin E2 Fig. S4 with image from Feng et al., 2012
muscle cell cell wall repair process quality, abnormal gl22Tg + MO1-irf8 + MO1-spi1b + MO3-csf3r light damage: sarcolemma: muscle cell Fig. 1 with image from Middel et al., 2016
macrophage absent, abnormal gl22Tg + MO1-irf8 + MO1-spi1b + MO3-csf3r light damage: sarcolemma: muscle cell Fig. 1 with image from Middel et al., 2016
liver size, ameliorated gz32Tg + MO1-spi1b + MO3-csf3r chemical treatment: doxycycline Fig. 3 from Yan et al., 2017
liver macrophage amount, ameliorated gl22Tg; gz32Tg + MO1-spi1b chemical treatment: doxycycline Fig. 3 from Yan et al., 2017
defense response to fungus increased efficacy, abnormal gl23Tg; i113Tg + MO1-spi1b + MO3-csf3r fungal treatment by injection: Talaromyces marneffei Fig. 5 with image from Ellett et al., 2018
macrophage decreased amount, abnormal gl23Tg; i113Tg + MO1-spi1b + MO3-csf3r control Fig. 5 with image from Ellett et al., 2018
neutrophil decreased amount, abnormal gl23Tg; i113Tg + MO1-spi1b + MO3-csf3r control Fig. 5 with image from Ellett et al., 2018
neutrophil decreased amount, abnormal gl23Tg; i114Tg + MO1-spi1b + MO3-csf3r standard conditions Fig. S4 with image from Gauert et al., 2020
macrophage decreased amount, abnormal gl23Tg; i114Tg + MO1-spi1b + MO3-csf3r standard conditions Fig. S4 with image from Gauert et al., 2020
liver neutrophil increased amount, abnormal gz32Tg; nz50Tg + MO1-spi1b chemical treatment: doxycycline Fig. 3 from Yan et al., 2017
mucus secreting cell decreased amount, abnormal hzm1Et; io006Tg + MO1-spi1b standard conditions Fig. 3 with image from Feng et al., 2012
mucus secreting cell proliferative, abnormal hzm1Et; io006Tg + MO1-spi1b chemical treatment: prostaglandin E2 Fig. 3 with image from Feng et al., 2012
macrophage decreased amount, abnormal hzm1Et; io006Tg + MO1-spi1b chemical treatment: prostaglandin E2 Fig. 3 with image from Feng et al., 2012
mucus secreting cell proliferative, abnormal hzm1Et; io006Tg + MO1-spi1b standard conditions Fig. 3 with image from Feng et al., 2012
macrophage decreased amount, abnormal hzm1Et; io006Tg + MO1-spi1b standard conditions Fig. 3 with image from Feng et al., 2012
whole organism Ab11-tau labeling increased amount, abnormal mde3Tg; mde4Tg + MO1-spi1b control Figure 2 with image from Hassan-Abdi et al., 2019
whole organism il1b expression increased amount, abnormal mde3Tg; mde4Tg + MO1-spi1b control Figure 2 with image from Hassan-Abdi et al., 2019
whole organism cxcl8a expression increased amount, abnormal mde3Tg; mde4Tg + MO1-spi1b control Figure 2 with image from Hassan-Abdi et al., 2019
primary motor neuron axon TagBFP expression mislocalised, abnormal mq10Tg; mq14Tg + MO1-spi1b light damage: primary motor neuron Fig. 7 with image from Svahn et al., 2018
primary motor neuron degenerate, abnormal mq10Tg; mq14Tg + MO1-spi1b light damage: primary motor neuron Fig. 4 with imageFig. 5 with imageFig. 7 with image from Svahn et al., 2018
primary motor neuron cytoplasm EGFP expression mislocalised, abnormal mq10Tg; mq14Tg + MO1-spi1b light damage: primary motor neuron Fig. 4 with imageFig. 5 with imageFig. 7 with image from Svahn et al., 2018
primary motor neuron axon EGFP expression mislocalised, abnormal mq10Tg; mq14Tg + MO1-spi1b light damage: primary motor neuron Fig. 7 with image from Svahn et al., 2018
microglial cell absent, abnormal mq10Tg; mq14Tg + MO1-spi1b light damage: primary motor neuron Fig. 4 with imageFig. 5 with imageFig. 7 with image from Svahn et al., 2018
ventral wall of dorsal aorta hematopoietic stem cell decreased amount, abnormal s896Tg; zf169Tg + MO1-spi1b standard conditions Fig. 7 from Espín-Palazón et al., 2014
head macrophage mCherry expression decreased distribution, abnormal uhrf1hi272Tg/hi272Tg; gl23Tg + MO1-spi1b standard conditions Fig. 4 with image from Chernyavskaya et al., 2017
head neutrophil DsRed2 expression decreased distribution, abnormal uhrf1hi272Tg/hi272Tg; nz50Tg + MO1-spi1b standard conditions Fig. 4 with image from Chernyavskaya et al., 2017
liver macrophage amount, ameliorated gl22Tg; gz32Tg + MO1-spi1b + MO3-csf3r chemical treatment: doxycycline Fig. 3 from Yan et al., 2017
liver neutrophil amount, ameliorated gz32Tg; nz50Tg + MO1-spi1b + MO3-csf3r chemical treatment: doxycycline Fig. 3 from Yan et al., 2017
neutrophil decreased amount, abnormal hzm1Et; io006Tg + MO1-spi1b + MO3-csf3r standard conditions Fig. 3 with image from Feng et al., 2012
macrophage decreased amount, abnormal hzm1Et; io006Tg + MO1-spi1b + MO3-csf3r standard conditions Fig. 3 with image from Feng et al., 2012
macrophage decreased amount, abnormal hzm1Et; io006Tg + MO1-spi1b + MO3-csf3r chemical treatment: prostaglandin E2 Fig. 3 with image from Feng et al., 2012
mucus secreting cell proliferative, abnormal hzm1Et; io006Tg + MO1-spi1b + MO3-csf3r chemical treatment: prostaglandin E2 Fig. 3 with image from Feng et al., 2012
mucus secreting cell proliferative, abnormal hzm1Et; io006Tg + MO1-spi1b + MO3-csf3r standard conditions Fig. 3 with image from Feng et al., 2012
mucus secreting cell decreased amount, abnormal hzm1Et; io006Tg + MO1-spi1b + MO3-csf3r standard conditions Fig. 3 with image from Feng et al., 2012
neutrophil decreased amount, abnormal hzm1Et; io006Tg + MO1-spi1b + MO3-csf3r chemical treatment: prostaglandin E2 Fig. 3 with image from Feng et al., 2012
mucus secreting cell decreased amount, abnormal hzm1Et; io006Tg + MO1-spi1b + MO3-csf3r chemical treatment: prostaglandin E2 Fig. 3 with image from Feng et al., 2012
macrophage absent, abnormal hzm1Et; io006Tg; nz50Tg + MO1-spi1b + MO3-csf3r control Fig. 3 with image from Antonio et al., 2015
neutrophil absent, abnormal hzm1Et; io006Tg; nz50Tg + MO1-spi1b + MO3-csf3r resection: caudal fin Fig. 3 with image from Antonio et al., 2015
macrophage absent, abnormal hzm1Et; io006Tg; nz50Tg + MO1-spi1b + MO3-csf3r resection: caudal fin Fig. 3 with image from Antonio et al., 2015
neutrophil absent, abnormal hzm1Et; io006Tg; nz50Tg + MO1-spi1b + MO3-csf3r control Fig. 3 with image from Antonio et al., 2015
caudal fin canonical NF-kappaB signal transduction process quality, ameliorated mir223pu18/pu18; nc1Tg + MO1-rac2 + MO1-spi1b transection: caudal fin Fig. 4 with image from Zhou et al., 2018
caudal fin EGFP expression amount, ameliorated mir223pu18/pu18; nc1Tg + MO1-rac2 + MO1-spi1b transection: caudal fin Fig. 4 with image from Zhou et al., 2018
Citations