header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-170223-2
Morpholino Name: MO3-setb
Target: setb (1)
Previous Name: E3I3 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TGAGTTATATTCCCTCTCACCTTGT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-setb No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-setb
Expressed Gene Anatomy Figures
akt3b Fig. 8 from Serifi et al., 2016
atoh1a Fig. 8 from Serifi et al., 2016
atoh1b Fig. 8 from Serifi et al., 2016
atoh7 Fig. 8 from Serifi et al., 2016
cdkn1a Fig. 8 from Serifi et al., 2016
crx Fig. 8 from Serifi et al., 2016
cryaa Fig. 8 from Serifi et al., 2016
foxi1 Fig. 8 from Serifi et al., 2016
foxj1a Fig. 8 from Serifi et al., 2016
junba Fig. 8 from Serifi et al., 2016
neurod1 Fig. 8 from Serifi et al., 2016
neurod4 Fig. 8 from Serifi et al., 2016
oc90 Fig. 8 from Serifi et al., 2016
optc Fig. 8 from Serifi et al., 2016
otpa Fig. 8 from Serifi et al., 2016
otpb Fig. 8 from Serifi et al., 2016
ovol1a Fig. 8 from Serifi et al., 2016
six7 Fig. 8 from Serifi et al., 2016
slc12a3 Fig. 8 from Serifi et al., 2016
PHENOTYPE
Phenotype resulting from MO3-setb
Phenotype Figures
eye decreased size, abnormal Fig. 5 from Serifi et al., 2016
eye deformed, abnormal Fig. 5 from Serifi et al., 2016
head Ab1-set labeling decreased distribution, abnormal Fig. 5 from Serifi et al., 2016
head decreased size, abnormal Fig. 5 from Serifi et al., 2016
head shape, abnormal Fig. 5 from Serifi et al., 2016
lateral line system development disrupted, abnormal Fig. 7 from Serifi et al., 2016
neuromast decreased amount, abnormal Fig. 7 from Serifi et al., 2016
post-vent region curved, abnormal Fig. 5 from Serifi et al., 2016
post-vent region Ab1-set labeling decreased distribution, abnormal Fig. 5 from Serifi et al., 2016
trunk bent, abnormal Fig. 5 from Serifi et al., 2016
trunk Ab1-set labeling decreased distribution, abnormal Fig. 5 from Serifi et al., 2016
whole organism otpb expression decreased amount, abnormal Fig. 8 from Serifi et al., 2016
whole organism neurod4 expression decreased amount, abnormal Fig. 8 from Serifi et al., 2016
whole organism Ab2-set labeling decreased amount, abnormal Fig. 5 from Serifi et al., 2016
whole organism neurod1 expression decreased amount, abnormal Fig. 8 from Serifi et al., 2016
whole organism atoh7 expression decreased amount, abnormal Fig. 8 from Serifi et al., 2016
whole organism six7 expression decreased amount, abnormal Fig. 8 from Serifi et al., 2016
whole organism crx expression decreased amount, abnormal Fig. 8 from Serifi et al., 2016
whole organism akt3b expression decreased amount, abnormal Fig. 8 from Serifi et al., 2016
whole organism otpa expression decreased amount, abnormal Fig. 8 from Serifi et al., 2016
whole organism oc90 expression increased amount, abnormal Fig. 8 from Serifi et al., 2016
whole organism atoh1a expression increased amount, abnormal Fig. 8 from Serifi et al., 2016
whole organism junba expression increased amount, abnormal Fig. 8 from Serifi et al., 2016
whole organism foxj1a expression increased amount, abnormal Fig. 8 from Serifi et al., 2016
whole organism cdkn1a expression increased amount, abnormal Fig. 8 from Serifi et al., 2016
whole organism anterior-posterior axis decreased length, abnormal Fig. 5 from Serifi et al., 2016

Phenotype of all Fish created by or utilizing MO3-setb
Phenotype Fish Conditions Figures
post-vent region curved, abnormal WT + MO3-setb standard conditions Fig. 5 from Serifi et al., 2016
whole organism foxj1a expression increased amount, abnormal WT + MO3-setb standard conditions Fig. 8 from Serifi et al., 2016
trunk bent, abnormal WT + MO3-setb standard conditions Fig. 5 from Serifi et al., 2016
whole organism six7 expression decreased amount, abnormal WT + MO3-setb standard conditions Fig. 8 from Serifi et al., 2016
whole organism crx expression decreased amount, abnormal WT + MO3-setb standard conditions Fig. 8 from Serifi et al., 2016
head shape, abnormal WT + MO3-setb standard conditions Fig. 5 from Serifi et al., 2016
trunk Ab1-set labeling decreased distribution, abnormal WT + MO3-setb standard conditions Fig. 5 from Serifi et al., 2016
eye deformed, abnormal WT + MO3-setb standard conditions Fig. 5 from Serifi et al., 2016
whole organism Ab2-set labeling decreased amount, abnormal WT + MO3-setb standard conditions Fig. 5 from Serifi et al., 2016
whole organism oc90 expression increased amount, abnormal WT + MO3-setb standard conditions Fig. 8 from Serifi et al., 2016
head Ab1-set labeling decreased distribution, abnormal WT + MO3-setb standard conditions Fig. 5 from Serifi et al., 2016
whole organism cdkn1a expression increased amount, abnormal WT + MO3-setb standard conditions Fig. 8 from Serifi et al., 2016
whole organism junba expression increased amount, abnormal WT + MO3-setb standard conditions Fig. 8 from Serifi et al., 2016
whole organism anterior-posterior axis decreased length, abnormal WT + MO3-setb standard conditions Fig. 5 from Serifi et al., 2016
whole organism neurod1 expression decreased amount, abnormal WT + MO3-setb standard conditions Fig. 8 from Serifi et al., 2016
lateral line system development disrupted, abnormal WT + MO3-setb standard conditions Fig. 7 from Serifi et al., 2016
whole organism otpb expression decreased amount, abnormal WT + MO3-setb standard conditions Fig. 8 from Serifi et al., 2016
whole organism otpa expression decreased amount, abnormal WT + MO3-setb standard conditions Fig. 8 from Serifi et al., 2016
post-vent region Ab1-set labeling decreased distribution, abnormal WT + MO3-setb standard conditions Fig. 5 from Serifi et al., 2016
whole organism atoh7 expression decreased amount, abnormal WT + MO3-setb standard conditions Fig. 8 from Serifi et al., 2016
head decreased size, abnormal WT + MO3-setb standard conditions Fig. 5 from Serifi et al., 2016
eye decreased size, abnormal WT + MO3-setb standard conditions Fig. 5 from Serifi et al., 2016
whole organism akt3b expression decreased amount, abnormal WT + MO3-setb standard conditions Fig. 8 from Serifi et al., 2016
neuromast decreased amount, abnormal WT + MO3-setb standard conditions Fig. 7 from Serifi et al., 2016
whole organism atoh1a expression increased amount, abnormal WT + MO3-setb standard conditions Fig. 8 from Serifi et al., 2016
whole organism neurod4 expression decreased amount, abnormal WT + MO3-setb standard conditions Fig. 8 from Serifi et al., 2016
OTHER MO3-setb MORPHOLINO PAGESNo links to external sites
CITATIONS (1)