Morpholino

MO1-rbms3

ID
ZDB-MRPHLNO-121108-1
Name
MO1-rbms3
Previous Names
None
Target
Sequence
5' - CGTTTGCCCATGTAGCTGGAATCCT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-rbms3
Expressed Gene Anatomy Figures
barx1 Fig. 5 with image from Jayasena et al., 2012
col2a1a Fig. 5 with image from Jayasena et al., 2012
dlx2a Fig. 5 with image from Jayasena et al., 2012
fgf3 Fig. 4 with image from Jayasena et al., 2012
foxd3 Fig. 4 with image from Jayasena et al., 2012
hoxa2b Fig. 4 with image from Jayasena et al., 2012
pax2a Fig. 4 with image from Jayasena et al., 2012
pax6a Fig. 4 with image from Jayasena et al., 2012
prrx1a Fig. 5 with image from Jayasena et al., 2012
runx2b Fig. 5 with image from Jayasena et al., 2012
smad2 Fig. 7 with image from Jayasena et al., 2012
snai1b Fig. 4 with image from Jayasena et al., 2012
sox9a Fig. 5 with image from Jayasena et al., 2012
sox10 Fig. 4 with image from Jayasena et al., 2012
tgfbr2b Fig. 7 with image from Jayasena et al., 2012
Phenotype
Phenotype resulting from MO1-rbms3
Phenotype Fish Figures
chondrocranium cartilage malformed, abnormal ba4Tg + MO1-rbms3 Fig. 3 with image,  Fig. 6 with image from Jayasena et al., 2012
embryonic neurocranium morphogenesis decreased process quality, abnormal AB + MO1-rbms3 Fig. 3 with image from Jayasena et al., 2012
embryonic viscerocranium morphogenesis decreased process quality, abnormal ba4Tg + MO1-rbms3 Fig. 3 with image,  Fig. 6 with image from Jayasena et al., 2012
head malformed, abnormal AB + MO1-rbms3 Fig. 3 with image from Jayasena et al., 2012
heart edematous, abnormal AB + MO1-rbms3 Fig. 3 with image from Jayasena et al., 2012
pharyngeal arch cell population proliferation decreased occurrence, abnormal ba4Tg + MO1-rbms3 Fig. 6 with image from Jayasena et al., 2012
pharyngeal arch chondrocyte differentiated, abnormal WT + MO1-rbms3 Fig. 5 with image from Jayasena et al., 2012
pharyngeal arch chondrocyte differentiation decreased process quality, abnormal WT + MO1-rbms3 Fig. 5 with image from Jayasena et al., 2012
pharyngeal arch transforming growth factor beta receptor signaling pathway decreased process quality, abnormal AB + MO1-rbms3 Fig. 7 with image from Jayasena et al., 2012
pharyngeal arch cartilage malformed, abnormal AB + MO1-rbms3 Fig. 3 with image from Jayasena et al., 2012
Phenotype of all Fish created by or utilizing MO1-rbms3
Phenotype Fish Conditions Figures
embryonic neurocranium morphogenesis decreased process quality, abnormal AB + MO1-rbms3 standard conditions Fig. 3 with image from Jayasena et al., 2012
pharyngeal arch transforming growth factor beta receptor signaling pathway decreased process quality, abnormal AB + MO1-rbms3 standard conditions Fig. 7 with image from Jayasena et al., 2012
embryonic viscerocranium morphogenesis decreased process quality, abnormal AB + MO1-rbms3 standard conditions Fig. 3 with image from Jayasena et al., 2012
pharyngeal arch cartilage malformed, abnormal AB + MO1-rbms3 standard conditions Fig. 3 with image from Jayasena et al., 2012
heart edematous, abnormal AB + MO1-rbms3 standard conditions Fig. 3 with image from Jayasena et al., 2012
head malformed, abnormal AB + MO1-rbms3 standard conditions Fig. 3 with image from Jayasena et al., 2012
chondrocranium cartilage malformed, abnormal AB + MO1-rbms3 standard conditions Fig. 3 with image from Jayasena et al., 2012
pharyngeal arch chondrocyte differentiated, abnormal WT + MO1-rbms3 standard conditions Fig. 5 with image from Jayasena et al., 2012
pharyngeal arch chondrocyte differentiation decreased process quality, abnormal WT + MO1-rbms3 standard conditions Fig. 5 with image from Jayasena et al., 2012
pharyngeal arch cell population proliferation decreased occurrence, abnormal ba4Tg + MO1-rbms3 standard conditions Fig. 6 with image from Jayasena et al., 2012
embryonic viscerocranium morphogenesis decreased process quality, abnormal ba4Tg + MO1-rbms3 standard conditions Fig. 6 with image from Jayasena et al., 2012
chondrocranium cartilage malformed, abnormal ba4Tg + MO1-rbms3 standard conditions Fig. 6 with image from Jayasena et al., 2012
chondrocranium cartilage malformed, abnormal ba4Tg + MO1-rbms3 + MO4-tp53 standard conditions Fig. 6 with image from Jayasena et al., 2012
embryonic viscerocranium morphogenesis decreased process quality, abnormal ba4Tg + MO1-rbms3 + MO4-tp53 standard conditions Fig. 6 with image from Jayasena et al., 2012
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.