Morpholino
MO1-tbx5a
- ID
- ZDB-MRPHLNO-060328-2
- Name
- MO1-tbx5a
- Previous Names
- Target
- Sequence
-
5' - GAAAGGTGTCTTCACTGTCCGCCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-tbx5a
No data available
Phenotype
Phenotype resulting from MO1-tbx5a
1 - 5 of 67 Show all
Phenotype of all Fish created by or utilizing MO1-tbx5a
1 - 5 of 132 Show all
Citations
- Lu, J.K., Tsai, T.C., Lee, H., Hsia, K., Lin, C.H., Lu, J.H. (2019) Pectoral Fin Anomalies in tbx5a Knockdown Zebrafish Embryos Related to the Cascade Effect of N-Cadherin and Extracellular Matrix Formation. Journal of developmental biology. 7(3)
- Guzzolino, E., Chiavacci, E., Ahuja, N., Mariani, L., Evangelista, M., Ippolito, C., Rizzo, M., Garrity, D., Cremisi, F., Pitto, L. (2018) Post-transcriptional Modulation of Sphingosine-1-Phosphate Receptor 1 by miR-19a Affects Cardiovascular Development in Zebrafish. Frontiers in cell and developmental biology. 6:58
- Tsai, T.C., Shih, C.C., Chien, H.P., Yang, A.H., Lu, J.K., Lu, J.H. (2018) Anti-apoptotic effects of IGF-I on mortality and dysmorphogenesis in tbx5-deficient zebrafish embryos. BMC Developmental Biology. 18:5
- Ghosh, T.K., Aparicio-Sánchez, J.J., Buxton, S., Ketley, A., Mohamed, T., Rutland, C.S., Loughna, S., David Brook, J. (2017) Acetylation of TBX5 by KAT2B and KAT2A regulates heart and limb development. Journal of Molecular and Cellular Cardiology. 114:185-198
- Wang, F., Liu, D., Zhang, R.R., Yu, L.W., Zhao, J.Y., Yang, X.Y., Jiang, S.S., Ma, D., Qiao, B., Zhang, F., Jin, L., Gui, Y.H., Wang, H.Y. (2017) A TBX5 3'UTR variant increases the risk of congenital heart disease in the Han Chinese population. Cell discovery. 3:17026
- D'Aurizio, R., Russo, F., Chiavacci, E., Baumgart, M., Groth, M., D'Onofrio, M., Arisi, I., Rainaldi, G., Pitto, L., Pellegrini, M. (2016) Discovering miRNA Regulatory Networks in Holt-Oram Syndrome Using a Zebrafish Model. Frontiers in bioengineering and biotechnology. 4:60
- Chiavacci, E., D'Aurizio, R., Guzzolino, E., Russo, F., Baumgart, M., Groth, M., Mariani, L., D'Onofrio, M., Arisi, I., Pellegrini, M., Cellerino, A., Cremisi, F., Pitto, L. (2015) MicroRNA 19a replacement partially rescues fin and cardiac defects in zebrafish model of Holt Oram syndrome. Scientific Reports. 5:18240
- Yue, M.S., Plavicki, J.S., Li, X.Y., Peterson, R.E., Heideman, W. (2015) A co-culture assay of embryonic zebrafish hearts to assess migration of epicardial cells in vitro. BMC Developmental Biology. 15:50
- Li, M., Gao, Z., Ji, D., Zhang, S. (2014) Functional characterization of GH-like homolog in amphioxus reveals an ancient origin of GH/GH receptor system. Endocrinology. 155:4818-30
- Pi-Roig, A., Martin-Blanco, E., Minguillón, C. (2014) Distinct tissue-specific requirements for the zebrafish tbx5 genes during heart, retina and pectoral fin development. Open Biology. 4:140014
1 - 10 of 26
Show