Morpholino

MO1-tbx5a

ID
ZDB-MRPHLNO-060328-2
Name
MO1-tbx5a
Previous Names
  • MO1-tbx5 (1)
  • tbx-MO (1)
  • tbx5 MO (1)
  • tbx5-MO(1) (1)
Target
Sequence
5' - GAAAGGTGTCTTCACTGTCCGCCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-tbx5a
No data available
Phenotype
Phenotype resulting from MO1-tbx5a
Phenotype Fish Figures
apoptotic process increased occurrence, abnormal WT + MO1-tbx5a Fig. 3 with image from Tsai et al., 2012
Fig. 1 with image from Lu et al., 2011
atrium myh6 expression decreased amount, abnormal WT + MO1-tbx5a Fig. 6 with image from Tsai et al., 2012
atrium morphology, abnormal WT + MO1-tbx5a Fig. 4 from Ghosh et al., 2017
atrium size, abnormal WT + MO1-tbx5a Fig. 4 from Ghosh et al., 2017
cardiac muscle cell bicellular tight junction dissociated from cardiac muscle cell bicellular tight junction, abnormal WT + MO1-tbx5a Fig. 7 with image from Lu et al., 2011
cardiac muscle cell mitochondrion increased amount, abnormal WT + MO1-tbx5a Fig. 7 with image from Lu et al., 2011
cardiac muscle cell mitochondrion swollen, abnormal WT + MO1-tbx5a Fig. 7 with image from Lu et al., 2011
cardiac ventricle myl7 expression decreased amount, abnormal WT + MO1-tbx5a Fig. 6 with image from Tsai et al., 2012
cardiac ventricle myh7 expression decreased amount, abnormal WT + MO1-tbx5a Fig. 6 with image from Tsai et al., 2012
cardiac ventricle decreased contractility, abnormal WT + MO1-tbx5a Fig. 1 with image from Tsai et al., 2012
cardiac ventricle morphology, abnormal WT + MO1-tbx5a Fig. 4 from Ghosh et al., 2017
cardiac ventricle size, abnormal WT + MO1-tbx5a Fig. 4 from Ghosh et al., 2017
fin agenesis, abnormal s849Tg; uto1Tg + MO1-tbx5a Fig. S8 with image from Chiavacci et al., 2012
heart decreased size, abnormal WT + MO1-tbx5a Fig. 4 from Tong et al., 2014
Fig. 2 from Lu et al., 2008
heart edematous, abnormal WT + MO1-tbx5a Fig. 1 with image from Tsai et al., 2012
heart malformed, abnormal WT + MO1-tbx5a Fig. 1 with image from Pi-Roig et al., 2014
Fig. 1 with image from Lu et al., 2011
heart morphology, abnormal WT + MO1-tbx5a Fig. 6 with image from Guzzolino et al., 2018
Fig. 4 from Ghosh et al., 2017
Fig. 2 with image from Chiavacci et al., 2015
Fig. 6 from Li et al., 2014
Fig. 1 with image from Tsai et al., 2012
Fig. 1Fig. 2Fig. 5 from Lu et al., 2008
Fig. 9 with image from Qu et al., 2008
heart straight, abnormal twu34Tg + MO1-tbx5a Fig. 6 with image from Guzzolino et al., 2018
heart contraction decreased rate, abnormal twu34Tg + MO1-tbx5a Fig. 6 with image from Guzzolino et al., 2018
Fig. 4 from Ghosh et al., 2017
heart development disrupted, abnormal twu34Tg + MO1-tbx5a Fig. 2 with image from Chiavacci et al., 2015
Fig. 9 with image from Qu et al., 2008
heart jogging disrupted, abnormal WT + MO1-tbx5a Fig. 2 with image from Pi-Roig et al., 2014
heart looping arrested, abnormal WT + MO1-tbx5a Fig. 1 with image from Pi-Roig et al., 2014
Fig. 4 with image from Garrity et al., 2002
heart looping decreased occurrence, abnormal twu34Tg + MO1-tbx5a Fig. 6 with image from Guzzolino et al., 2018
heart looping disrupted, abnormal WT + MO1-tbx5a Fig. 1 with image from Pi-Roig et al., 2014
Fig. 1 with image from Lu et al., 2011
Fig. 6 from Ghosh et al., 2009
Fig. 1Fig. 2Fig. 5 from Lu et al., 2008
heart looping process quality, abnormal WT + MO1-tbx5a Fig. 4 from Ghosh et al., 2017
heart tube linear, abnormal WT + MO1-tbx5a Fig. 4 with image from Garrity et al., 2002
myocardium disorganized, abnormal WT + MO1-tbx5a Fig. 7 with image from Lu et al., 2011
myocardium myofibril disorganized, abnormal WT + MO1-tbx5a Fig. 7 with image from Lu et al., 2011
paired fin absent, abnormal WT + MO1-tbx5a Fig. 6 from Ghosh et al., 2017
paired fin decreased size, abnormal WT + MO1-tbx5a Fig. 6 from Ghosh et al., 2017
paired fin morphology, abnormal WT + MO1-tbx5a Fig. 6 from Ghosh et al., 2017
pectoral fin absent, abnormal twu34Tg + MO1-tbx5a Fig. 6 with image from Guzzolino et al., 2018
Fig. 4 with image from Garrity et al., 2002
pectoral fin aplastic, abnormal WT + MO1-tbx5a Fig. 5 with image from Pi-Roig et al., 2014
Fig. 1 with image from Tsai et al., 2012
Fig. 6 from Ghosh et al., 2009
pectoral fin hypoplastic, abnormal WT + MO1-tbx5a Fig. 1 with image from Lu et al., 2011
pectoral fin morphology, abnormal WT + MO1-tbx5a Fig. 2 with image from Chiavacci et al., 2015
Fig. 6 from Li et al., 2014
pectoral fin truncated, abnormal WT + MO1-tbx5a Fig. 1 with image from Tsai et al., 2012
pectoral fin upturned, abnormal WT + MO1-tbx5a Fig. 4 with image from Garrity et al., 2002
pectoral fin bud absent, abnormal WT + MO1-tbx5a Fig. 6 with image from Fischer et al., 2003
pectoral fin development disrupted, abnormal WT + MO1-tbx5a Fig. 5 with image from Pi-Roig et al., 2014
pericardium edematous, abnormal twu34Tg + MO1-tbx5a Fig. 6 with image from Guzzolino et al., 2018
Fig. 4 from Ghosh et al., 2017
Fig. S8 with image from Chiavacci et al., 2012
Fig. 6 from Ghosh et al., 2009
Fig. 1Fig. 2 from Lu et al., 2008
somite U-shaped, abnormal WT + MO1-tbx5a Fig. 6 from Li et al., 2014
Fig. 1 with image from Tsai et al., 2012
trunk bent, abnormal WT + MO1-tbx5a Fig. 1 with image from Tsai et al., 2012
trunk curled, abnormal WT + MO1-tbx5a Fig. 1 with image from Lu et al., 2011
trunk decreased length, abnormal WT + MO1-tbx5a Fig. 1 with image from Lu et al., 2011
whole organism dead, abnormal twu34Tg + MO1-tbx5a Fig. 2 with image from Chiavacci et al., 2015
whole organism ghrb expression decreased amount, abnormal WT + MO1-tbx5a Fig. 2 with image from Tsai et al., 2012
whole organism ghra expression decreased amount, abnormal WT + MO1-tbx5a Fig. 2 with image from Tsai et al., 2012
whole organism akt2 expression decreased amount, abnormal WT + MO1-tbx5a Fig. 2 with image from Tsai et al., 2012
whole organism igf1 expression decreased amount, abnormal WT + MO1-tbx5a Fig. 2 with image from Tsai et al., 2012
whole organism robo1 expression increased amount, abnormal AB + MO1-tbx5a Fig. 2 from D'Aurizio et al., 2016
whole organism dre-mir-7ba expression increased amount, abnormal AB + MO1-tbx5a Fig. 2 from D'Aurizio et al., 2016
whole organism mef2aa expression increased amount, abnormal AB + MO1-tbx5a Fig. 2 from D'Aurizio et al., 2016
whole organism camk2d1 expression increased amount, abnormal AB + MO1-tbx5a Fig. 2 from D'Aurizio et al., 2016
whole organism cdkn1bb expression increased amount, abnormal WT + MO1-tbx5a Fig. 5 with image from Tsai et al., 2012
whole organism bcl2a expression increased amount, abnormal WT + MO1-tbx5a Fig. 4 with image from Tsai et al., 2012
whole organism dre-mir-19a expression increased amount, abnormal AB + MO1-tbx5a Fig. 2 from D'Aurizio et al., 2016
whole organism srfa expression increased amount, abnormal AB + MO1-tbx5a Fig. 2 from D'Aurizio et al., 2016
whole organism badb expression increased amount, abnormal WT + MO1-tbx5a Fig. 4 with image from Tsai et al., 2012
whole organism atp1a2a expression increased amount, abnormal AB + MO1-tbx5a Fig. 2 from D'Aurizio et al., 2016
whole organism mir34a expression increased amount, abnormal AB + MO1-tbx5a Fig. 2 from D'Aurizio et al., 2016
whole organism ndrg4 expression increased amount, abnormal AB + MO1-tbx5a Fig. 2 from D'Aurizio et al., 2016
whole organism hand2 expression increased amount, abnormal AB + MO1-tbx5a Fig. 2 from D'Aurizio et al., 2016
whole organism mir10d expression increased amount, abnormal AB + MO1-tbx5a Fig. 2 from D'Aurizio et al., 2016
whole organism mir30a expression increased amount, abnormal AB + MO1-tbx5a Fig. 2 from D'Aurizio et al., 2016
whole organism cdk2 expression increased amount, abnormal WT + MO1-tbx5a Fig. 5 with image from Tsai et al., 2012
whole organism lacks parts or has fewer parts of type pectoral fin, abnormal WT + MO1-tbx5a Fig. 4 with image from Garrity et al., 2002
whole organism semi-lethal (sensu genetics), abnormal WT + MO1-tbx5a Fig. 2 from Lu et al., 2008
Phenotype of all Fish created by or utilizing MO1-tbx5a
Phenotype Fish Conditions Figures
whole organism camk2d1 expression increased amount, abnormal AB + MO1-tbx5a standard conditions Fig. 2 from D'Aurizio et al., 2016
whole organism mir34a expression increased amount, abnormal AB + MO1-tbx5a standard conditions Fig. 2 from D'Aurizio et al., 2016
whole organism mir30a expression increased amount, abnormal AB + MO1-tbx5a standard conditions Fig. 2 from D'Aurizio et al., 2016
whole organism atp1a2a expression increased amount, abnormal AB + MO1-tbx5a standard conditions Fig. 2 from D'Aurizio et al., 2016
whole organism hand2 expression increased amount, abnormal AB + MO1-tbx5a standard conditions Fig. 2 from D'Aurizio et al., 2016
whole organism mef2aa expression increased amount, abnormal AB + MO1-tbx5a standard conditions Fig. 2 from D'Aurizio et al., 2016
whole organism dre-mir-19a expression increased amount, abnormal AB + MO1-tbx5a standard conditions Fig. 2 from D'Aurizio et al., 2016
whole organism dre-mir-7ba expression increased amount, abnormal AB + MO1-tbx5a standard conditions Fig. 2 from D'Aurizio et al., 2016
whole organism robo1 expression increased amount, abnormal AB + MO1-tbx5a standard conditions Fig. 2 from D'Aurizio et al., 2016
whole organism ndrg4 expression increased amount, abnormal AB + MO1-tbx5a standard conditions Fig. 2 from D'Aurizio et al., 2016
whole organism mir10d expression increased amount, abnormal AB + MO1-tbx5a standard conditions Fig. 2 from D'Aurizio et al., 2016
whole organism srfa expression increased amount, abnormal AB + MO1-tbx5a standard conditions Fig. 2 from D'Aurizio et al., 2016
atrium myh6 expression decreased amount, abnormal WT + MO1-tbx5a standard conditions Fig. 6 with image from Tsai et al., 2012
trunk bent, abnormal WT + MO1-tbx5a standard conditions Fig. 1 with image from Tsai et al., 2012
whole organism badb expression amount, ameliorated WT + MO1-tbx5a chemical treatment by injection: growth hormone Fig. 4 with image from Tsai et al., 2012
cardiac ventricle decreased contractility, abnormal WT + MO1-tbx5a standard conditions Fig. 1 with image from Tsai et al., 2012
somite U-shaped, abnormal WT + MO1-tbx5a standard conditions Fig. 6 from Li et al., 2014
Fig. 1 with image from Tsai et al., 2012
heart morphology, ameliorated WT + MO1-tbx5a chemical treatment by injection: growth hormone Fig. 6 from Li et al., 2014
cardiac ventricle morphology, abnormal WT + MO1-tbx5a standard conditions Fig. 4 from Ghosh et al., 2017
whole organism ghra expression decreased amount, abnormal WT + MO1-tbx5a standard conditions Fig. 2 with image from Tsai et al., 2012
paired fin morphology, abnormal WT + MO1-tbx5a standard conditions Fig. 6 from Ghosh et al., 2017
myocardium disorganized, abnormal WT + MO1-tbx5a standard conditions Fig. 7 with image from Lu et al., 2011
cardiac ventricle myl7 expression amount, ameliorated WT + MO1-tbx5a chemical treatment by injection: growth hormone Fig. 6 with image from Tsai et al., 2012
heart decreased size, abnormal WT + MO1-tbx5a standard conditions Fig. 2 from Lu et al., 2008
heart malformed, abnormal WT + MO1-tbx5a standard conditions Fig. 1 with image from Pi-Roig et al., 2014
Fig. 1 with image from Lu et al., 2011
cardiac ventricle myh7 expression decreased amount, abnormal WT + MO1-tbx5a standard conditions Fig. 6 with image from Tsai et al., 2012
paired fin absent, abnormal WT + MO1-tbx5a standard conditions Fig. 6 from Ghosh et al., 2017
pectoral fin morphology, abnormal WT + MO1-tbx5a standard conditions Fig. 6 from Li et al., 2014
trunk decreased length, abnormal WT + MO1-tbx5a standard conditions Fig. 1 with image from Lu et al., 2011
cardiac muscle cell bicellular tight junction dissociated from cardiac muscle cell bicellular tight junction, abnormal WT + MO1-tbx5a standard conditions Fig. 7 with image from Lu et al., 2011
cardiac ventricle size, abnormal WT + MO1-tbx5a standard conditions Fig. 4 from Ghosh et al., 2017
trunk curled, abnormal WT + MO1-tbx5a standard conditions Fig. 1 with image from Lu et al., 2011
atrium morphology, abnormal WT + MO1-tbx5a standard conditions Fig. 4 from Ghosh et al., 2017
heart morphology, abnormal WT + MO1-tbx5a standard conditions Fig. 4 from Ghosh et al., 2017
Fig. 6 from Li et al., 2014
Fig. 1 with image from Tsai et al., 2012
Fig. 1Fig. 2Fig. 5 from Lu et al., 2008
Fig. 9 with image from Qu et al., 2008
whole organism cdkn1bb expression amount, ameliorated WT + MO1-tbx5a chemical treatment by injection: growth hormone Fig. 5 with image from Tsai et al., 2012
cardiac muscle cell mitochondrion increased amount, abnormal WT + MO1-tbx5a standard conditions Fig. 7 with image from Lu et al., 2011
pectoral fin bud absent, abnormal WT + MO1-tbx5a standard conditions Fig. 6 with image from Fischer et al., 2003
paired fin decreased size, abnormal WT + MO1-tbx5a standard conditions Fig. 6 from Ghosh et al., 2017
cardiac ventricle myl7 expression decreased amount, abnormal WT + MO1-tbx5a standard conditions Fig. 6 with image from Tsai et al., 2012
pectoral fin upturned, abnormal WT + MO1-tbx5a standard conditions Fig. 4 with image from Garrity et al., 2002
heart looping arrested, abnormal WT + MO1-tbx5a standard conditions Fig. 1 with image from Pi-Roig et al., 2014
Fig. 4 with image from Garrity et al., 2002
whole organism cdk2 expression amount, ameliorated WT + MO1-tbx5a chemical treatment by injection: growth hormone Fig. 5 with image from Tsai et al., 2012
whole organism bcl2a expression increased amount, abnormal WT + MO1-tbx5a standard conditions Fig. 4 with image from Tsai et al., 2012
cardiac ventricle myh7 expression amount, ameliorated WT + MO1-tbx5a chemical treatment by injection: growth hormone Fig. 6 with image from Tsai et al., 2012
pericardium edematous, abnormal WT + MO1-tbx5a standard conditions Fig. 4 from Ghosh et al., 2017
Fig. 6 from Ghosh et al., 2009
Fig. 1Fig. 2 from Lu et al., 2008
whole organism ghrb expression decreased amount, abnormal WT + MO1-tbx5a standard conditions Fig. 2 with image from Tsai et al., 2012
whole organism cdkn1bb expression increased amount, abnormal WT + MO1-tbx5a standard conditions Fig. 5 with image from Tsai et al., 2012
somite shape, ameliorated WT + MO1-tbx5a chemical treatment by injection: growth hormone Fig. 6 from Li et al., 2014
cardiac muscle cell mitochondrion swollen, abnormal WT + MO1-tbx5a standard conditions Fig. 7 with image from Lu et al., 2011
pectoral fin aplastic, abnormal WT + MO1-tbx5a standard conditions Fig. 5 with image from Pi-Roig et al., 2014
Fig. 1 with image from Tsai et al., 2012
Fig. 6 from Ghosh et al., 2009
heart development disrupted, abnormal WT + MO1-tbx5a standard conditions Fig. 9 with image from Qu et al., 2008
heart edematous, abnormal WT + MO1-tbx5a standard conditions Fig. 1 with image from Tsai et al., 2012
pectoral fin hypoplastic, abnormal WT + MO1-tbx5a standard conditions Fig. 1 with image from Lu et al., 2011
pectoral fin truncated, abnormal WT + MO1-tbx5a standard conditions Fig. 1 with image from Tsai et al., 2012
atrium size, abnormal WT + MO1-tbx5a standard conditions Fig. 4 from Ghosh et al., 2017
whole organism semi-lethal (sensu genetics), abnormal WT + MO1-tbx5a standard conditions Fig. 2 from Lu et al., 2008
whole organism cdk2 expression increased amount, abnormal WT + MO1-tbx5a standard conditions Fig. 5 with image from Tsai et al., 2012
heart jogging disrupted, abnormal WT + MO1-tbx5a standard conditions Fig. 2 with image from Pi-Roig et al., 2014
heart contraction decreased rate, abnormal WT + MO1-tbx5a standard conditions Fig. 4 from Ghosh et al., 2017
whole organism lacks parts or has fewer parts of type pectoral fin, abnormal WT + MO1-tbx5a standard conditions Fig. 4 with image from Garrity et al., 2002
whole organism badb expression increased amount, abnormal WT + MO1-tbx5a standard conditions Fig. 4 with image from Tsai et al., 2012
heart looping disrupted, abnormal WT + MO1-tbx5a standard conditions Fig. 1 with image from Pi-Roig et al., 2014
Fig. 1 with image from Lu et al., 2011
Fig. 6 from Ghosh et al., 2009
Fig. 1Fig. 2Fig. 5 from Lu et al., 2008
pectoral fin development disrupted, abnormal WT + MO1-tbx5a standard conditions Fig. 5 with image from Pi-Roig et al., 2014
whole organism igf1 expression decreased amount, abnormal WT + MO1-tbx5a standard conditions Fig. 2 with image from Tsai et al., 2012
apoptotic process occurrence, ameliorated WT + MO1-tbx5a chemical treatment by injection: growth hormone Fig. 3 with image from Tsai et al., 2012
pectoral fin absent, abnormal WT + MO1-tbx5a standard conditions Fig. 4 with image from Garrity et al., 2002
atrium myh6 expression amount, ameliorated WT + MO1-tbx5a chemical treatment by injection: growth hormone Fig. 6 with image from Tsai et al., 2012
heart tube linear, abnormal WT + MO1-tbx5a standard conditions Fig. 4 with image from Garrity et al., 2002
apoptotic process increased occurrence, abnormal WT + MO1-tbx5a standard conditions Fig. 3 with image from Tsai et al., 2012
Fig. 1 with image from Lu et al., 2011
myocardium myofibril disorganized, abnormal WT + MO1-tbx5a standard conditions Fig. 7 with image from Lu et al., 2011
pectoral fin morphology, ameliorated WT + MO1-tbx5a chemical treatment by injection: growth hormone Fig. 6 from Li et al., 2014
heart looping process quality, abnormal WT + MO1-tbx5a standard conditions Fig. 4 from Ghosh et al., 2017
whole organism akt2 expression decreased amount, abnormal WT + MO1-tbx5a standard conditions Fig. 2 with image from Tsai et al., 2012
whole organism bcl2a expression amount, ameliorated WT + MO1-tbx5a chemical treatment by injection: growth hormone Fig. 4 with image from Tsai et al., 2012
heart decreased size, abnormal f1Tg + MO1-tbx5a standard conditions Fig. 4 from Tong et al., 2014
heart morphology, abnormal twu34Tg + MO1-tbx5a standard conditions Fig. 6 with image from Guzzolino et al., 2018
Fig. 2 with image from Chiavacci et al., 2015
heart contraction rate, ameliorated twu34Tg + MO1-tbx5a chemical treatment by environment: sphingosine-1-phosphate receptor 1 antagonist Fig. 6 with image from Guzzolino et al., 2018
pericardium edematous, abnormal twu34Tg + MO1-tbx5a standard conditions Fig. 6 with image from Guzzolino et al., 2018
pectoral fin absent, abnormal twu34Tg + MO1-tbx5a chemical treatment by environment: sphingosine-1-phosphate receptor 1 antagonist Fig. 6 with image from Guzzolino et al., 2018
heart development disrupted, abnormal twu34Tg + MO1-tbx5a standard conditions Fig. 2 with image from Chiavacci et al., 2015
whole organism dead, abnormal twu34Tg + MO1-tbx5a standard conditions Fig. 2 with image from Chiavacci et al., 2015
heart contraction decreased rate, abnormal twu34Tg + MO1-tbx5a control Fig. 6 with image from Guzzolino et al., 2018
heart looping decreased occurrence, abnormal twu34Tg + MO1-tbx5a control Fig. 6 with image from Guzzolino et al., 2018
pectoral fin morphology, abnormal twu34Tg + MO1-tbx5a standard conditions Fig. 2 with image from Chiavacci et al., 2015
heart morphology, ameliorated twu34Tg + MO1-tbx5a chemical treatment by environment: sphingosine-1-phosphate receptor 1 antagonist Fig. 6 with image from Guzzolino et al., 2018
heart straight, abnormal twu34Tg + MO1-tbx5a control Fig. 6 with image from Guzzolino et al., 2018
pectoral fin absent, abnormal twu34Tg + MO1-tbx5a standard conditions Fig. 6 with image from Guzzolino et al., 2018
pericardium edematous, abnormal s849Tg; uto1Tg + MO1-tbx5a standard conditions Fig. S8 with image from Chiavacci et al., 2012
fin agenesis, abnormal s849Tg; uto1Tg + MO1-tbx5a standard conditions Fig. S8 with image from Chiavacci et al., 2012
fin absent, abnormal AB + MO1-tbx5a + MO2-tbx5b standard conditions Fig. 1 with image from Chiavacci et al., 2015
heart morphology, abnormal AB + MO1-tbx5a + MO2-tbx5b standard conditions Fig. 1 with image from Chiavacci et al., 2015
fin morphology, abnormal AB + MO1-tbx5a + MO2-tbx5b standard conditions Fig. 1 with image from Chiavacci et al., 2015
heart looping disrupted, abnormal TL + MO1-tbx5a + MO3-atoh8 standard conditions Fig. 3 from Rawnsley et al., 2013
heart tube shape, abnormal TL + MO1-tbx5a + MO3-atoh8 standard conditions Fig. 3 from Rawnsley et al., 2013
heart tube bifurcated, abnormal WT + MO1-gata5 + MO1-tbx5a standard conditions Fig. 1 with image from Lou et al., 2011
heart morphogenesis disrupted, abnormal WT + MO1-gata5 + MO1-tbx5a standard conditions Fig. 1 with image from Lou et al., 2011
cardiac muscle cell differentiation disrupted, abnormal WT + MO1-gata5 + MO1-tbx5a standard conditions Fig. 1 with image from Lou et al., 2011
cardiac muscle cell decreased amount, abnormal WT + MO1-gata5 + MO1-tbx5a standard conditions Fig. 1 with image from Lou et al., 2011
heart morphology, abnormal WT + MO1-smarcd3b + MO1-tbx5a standard conditions Fig. 1 with image from Lou et al., 2011
heart morphogenesis disrupted, abnormal WT + MO1-smarcd3b + MO1-tbx5a standard conditions Fig. 1 with image from Lou et al., 2011
heart jogging disrupted, abnormal WT + MO1-tbx5a + MO1-tbx5b standard conditions Fig. 2 with image from Pi-Roig et al., 2014
heart looping disrupted, abnormal WT + MO1-tbx5a + MO1-tbx5b standard conditions Fig. 1 with image from Pi-Roig et al., 2014
cranial nerve II decreased thickness, abnormal WT + MO1-tbx5a + MO1-tbx5b standard conditions Fig. 4 with image from Pi-Roig et al., 2014
heart malformed, abnormal WT + MO1-tbx5a + MO1-tbx5b standard conditions Fig. 1 with image from Pi-Roig et al., 2014
heart looping arrested, abnormal WT + MO1-tbx5a + MO1-tbx5b standard conditions Fig. 1 with image from Pi-Roig et al., 2014
heart looping disrupted, abnormal WT + MO1-tbx5a + MO5-mef2ca standard conditions Fig. 6Fig. 7 from Ghosh et al., 2009
pericardium edematous, abnormal WT + MO1-tbx5a + MO5-mef2ca standard conditions Fig. 6 from Ghosh et al., 2009
heart morphogenesis arrested, abnormal WT + MO1-gata5 + MO1-smarcd3b + MO1-tbx5a standard conditions Fig. 1 with image from Lou et al., 2011
cardiac muscle cell differentiation disrupted, abnormal WT + MO1-gata5 + MO1-smarcd3b + MO1-tbx5a standard conditions Fig. 1 with image from Lou et al., 2011
heart tube bifurcated, abnormal WT + MO1-gata5 + MO1-smarcd3b + MO1-tbx5a standard conditions Fig. 1 with image from Lou et al., 2011
cardiac muscle cell decreased amount, abnormal WT + MO1-gata5 + MO1-smarcd3b + MO1-tbx5a standard conditions Fig. 1 with image from Lou et al., 2011
cardiac muscle cell differentiation disrupted, abnormal twu34Tg + MO1-gata5 + MO1-tbx5a standard conditions Fig. 1 with image from Lou et al., 2011
heart bifurcated, abnormal twu34Tg + MO1-gata5 + MO1-tbx5a standard conditions Fig. 1 with image from Lou et al., 2011
heart morphogenesis disrupted, abnormal twu34Tg + MO1-gata5 + MO1-tbx5a standard conditions Fig. 1 with image from Lou et al., 2011
heart looping disrupted, abnormal twu34Tg + MO1-smarcd3b + MO1-tbx5a standard conditions Fig. 1 with image from Lou et al., 2011
heart development disrupted, abnormal twu34Tg + MO1-tbx5a + MO2-dre-mir-19a standard conditions Fig. 4 with image from Chiavacci et al., 2015
heart morphology, abnormal twu34Tg + MO1-tbx5a + MO2-dre-mir-19a standard conditions Fig. 4 with image from Chiavacci et al., 2015
fin morphology, abnormal twu34Tg + MO1-tbx5a + MO2-dre-mir-19a standard conditions Fig. 4 with image from Chiavacci et al., 2015
pectoral fin absent, exacerbated twu34Tg + MO1-tbx5a + MO2-s1pr1 standard conditions Fig. 6 with image from Guzzolino et al., 2018
pectoral fin amount, ameliorated twu34Tg + MO1-tbx5a + MO2-s1pr1 standard conditions Fig. 6 with image from Guzzolino et al., 2018
heart morphology, ameliorated twu34Tg + MO1-tbx5a + MO2-s1pr1 standard conditions Fig. 6 with image from Guzzolino et al., 2018
heart morphology, abnormal twu34Tg + MO1-tbx5a + MO2-tbx5b standard conditions Fig. 1 with image from Chiavacci et al., 2015
heart morphology, abnormal el133Tg + MO1-gata5 + MO1-smarcd3b + MO1-tbx5a standard conditions Fig. S1 with image from Lou et al., 2011
pharyngeal musculature morphology, abnormal el133Tg + MO1-gata5 + MO1-smarcd3b + MO1-tbx5a standard conditions Fig. S1 with image from Lou et al., 2011
endocardium aplastic, abnormal s843Tg + MO1-gata5 + MO1-smarcd3b + MO1-tbx5a standard conditions Fig. S1 with image from Lou et al., 2011
cardiac muscle cell differentiation disrupted, abnormal twu34Tg + MO1-gata5 + MO1-smarcd3b + MO1-tbx5a standard conditions Fig. 1 with image from Lou et al., 2011
heart morphogenesis disrupted, abnormal twu34Tg + MO1-gata5 + MO1-smarcd3b + MO1-tbx5a standard conditions Fig. 1 with image from Lou et al., 2011
heart bifurcated, abnormal twu34Tg + MO1-gata5 + MO1-smarcd3b + MO1-tbx5a standard conditions Fig. 1 with image from Lou et al., 2011
heart morphology, abnormal s957Tg; s958Tg + MO1-tbx5a control Fig. 4 with image from Wang et al., 2017
heart edematous, abnormal s957Tg; s958Tg + MO1-tbx5a control Fig. 4 with image from Wang et al., 2017
heart looping arrested, abnormal s957Tg; s958Tg + MO1-tbx5a control Fig. 4 with image from Wang et al., 2017
heart development process quality, abnormal s957Tg; s958Tg + MO1-tbx5a control Fig. 4 with image from Wang et al., 2017
Citations