Morpholino

MO1-tbx5a

ID
ZDB-MRPHLNO-060328-2
Name
MO1-tbx5a
Previous Names
  • MO1-tbx5 (1)
  • tbx-MO (1)
  • tbx5 MO (1)
  • tbx5-MO(1) (1)
Target
Sequence
5' - GAAAGGTGTCTTCACTGTCCGCCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-tbx5a
Expressed Gene Anatomy Figures
akt2 Fig. 2 with image from Tsai et al., 2012
atp1a2a Fig. 2 from D'Aurizio et al., 2016
badb Fig. 4 with image from Tsai et al., 2012
Fig. 2 with image from Lu et al., 2011
baxa Fig. 2 with image from Lu et al., 2011
bcl2a Fig. 4 with image from Tsai et al., 2012
Fig. 2 with image from Lu et al., 2011
camk2d1 Fig. 2 from D'Aurizio et al., 2016
casp8 Fig. 4 with image from Lu et al., 2011
cdk2 Fig. 5 with image from Tsai et al., 2012
cdkn1bb Fig. 5 with image from Tsai et al., 2012
dre-mir-7ba Fig. 2 from D'Aurizio et al., 2016
dre-mir-19a Fig. 2 from D'Aurizio et al., 2016
efnb2a Fig. 4 with image from Pi-Roig et al., 2014
ephb2a Fig. 4 with image from Pi-Roig et al., 2014
fgf24 Fig. 6 with image from Fischer et al., 2003
ghra Fig. 2 with image from Tsai et al., 2012
ghrb Fig. 2 with image from Tsai et al., 2012
hand2 Fig. 2 from D'Aurizio et al., 2016
Fig. 6 from Lu et al., 2008
has2 Fig. 4 from Tong et al., 2014
igf1 Fig. 2 with image from Tsai et al., 2012
Fig. 6 from Lu et al., 2008
mef2aa Fig. 2 from D'Aurizio et al., 2016
mir10d Fig. 2 from D'Aurizio et al., 2016
mir30a Fig. 2 from D'Aurizio et al., 2016
mir34a Fig. 2 from D'Aurizio et al., 2016
mstnb Fig. 6 from Lu et al., 2008
myh6 Fig. 6 with image from Tsai et al., 2012
Fig. 5,  Fig. 6 from Lu et al., 2008
myh7 Fig. 6 with image from Tsai et al., 2012
Fig. 5,  Fig. 6 from Lu et al., 2008
myl7 Fig. 2 with image from Pi-Roig et al., 2014
Fig. 6 with image from Tsai et al., 2012
Fig. 1 with image from Lou et al., 2011
Fig. 5,  Fig. 6 from Lu et al., 2008
myod1 Fig. 6 from Lu et al., 2008
ndrg4 Fig. 2 from D'Aurizio et al., 2016
Fig. 9 with image from Qu et al., 2008
nkx2.5 Fig. 1 with image from Lou et al., 2011
Fig. 6 from Lu et al., 2008
prdm1a Fig. 5 with image from Lee et al., 2006
robo1 Fig. 2 from D'Aurizio et al., 2016
sall1a Fig. 4 with image from Harvey et al., 2006
sall4 Fig. 2 with image from Harvey et al., 2006
srfa Fig. 2 from D'Aurizio et al., 2016
tbx5a Fig. 6 from Lu et al., 2008
Fig. 2 with image from Harvey et al., 2006
Phenotype
Phenotype resulting from MO1-tbx5a
Phenotype Fish Figures
apoptotic process increased occurrence, abnormal WT + MO1-tbx5a Fig. 3 with image from Tsai et al., 2012
Fig. 1 with image from Lu et al., 2011
atrium myh6 expression decreased amount, abnormal WT + MO1-tbx5a Fig. 6 with image from Tsai et al., 2012
atrium morphology, abnormal WT + MO1-tbx5a Fig. 4 from Ghosh et al., 2017
atrium size, abnormal WT + MO1-tbx5a Fig. 4 from Ghosh et al., 2017
cardiac muscle cell bicellular tight junction dissociated from cardiac muscle cell bicellular tight junction, abnormal WT + MO1-tbx5a Fig. 7 with image from Lu et al., 2011
cardiac muscle cell mitochondrion increased amount, abnormal WT + MO1-tbx5a Fig. 7 with image from Lu et al., 2011
cardiac muscle cell mitochondrion swollen, abnormal WT + MO1-tbx5a Fig. 7 with image from Lu et al., 2011
cardiac ventricle myl7 expression decreased amount, abnormal WT + MO1-tbx5a Fig. 6 with image from Tsai et al., 2012
cardiac ventricle myh7 expression decreased amount, abnormal WT + MO1-tbx5a Fig. 6 with image from Tsai et al., 2012
cardiac ventricle decreased contractility, abnormal WT + MO1-tbx5a Fig. 1 with image from Tsai et al., 2012
cardiac ventricle morphology, abnormal WT + MO1-tbx5a Fig. 4 from Ghosh et al., 2017
cardiac ventricle size, abnormal WT + MO1-tbx5a Fig. 4 from Ghosh et al., 2017
fin agenesis, abnormal s849Tg; uto1Tg + MO1-tbx5a Fig. S8 with image from Chiavacci et al., 2012
heart decreased size, abnormal WT + MO1-tbx5a Fig. 4 from Tong et al., 2014
Fig. 2 from Lu et al., 2008
heart edematous, abnormal WT + MO1-tbx5a Fig. 1 with image from Tsai et al., 2012
heart malformed, abnormal WT + MO1-tbx5a Fig. 1 with image from Pi-Roig et al., 2014
Fig. 1 with image from Lu et al., 2011
heart morphology, abnormal WT + MO1-tbx5a Fig. 6 with image from Guzzolino et al., 2018
Fig. 4 from Ghosh et al., 2017
Fig. 2 with image from Chiavacci et al., 2015
Fig. 6 from Li et al., 2014
Fig. 1 with image from Tsai et al., 2012
Fig. 1,  Fig. 2,  Fig. 5 from Lu et al., 2008
Fig. 9 with image from Qu et al., 2008
heart straight, abnormal twu34Tg + MO1-tbx5a Fig. 6 with image from Guzzolino et al., 2018
heart contraction decreased rate, abnormal twu34Tg + MO1-tbx5a Fig. 6 with image from Guzzolino et al., 2018
Fig. 4 from Ghosh et al., 2017
heart development disrupted, abnormal twu34Tg + MO1-tbx5a Fig. 2 with image from Chiavacci et al., 2015
Fig. 9 with image from Qu et al., 2008
heart jogging disrupted, abnormal WT + MO1-tbx5a Fig. 2 with image from Pi-Roig et al., 2014
heart looping arrested, abnormal WT + MO1-tbx5a Fig. 1 with image from Pi-Roig et al., 2014
Fig. 4 with image from Garrity et al., 2002
heart looping decreased occurrence, abnormal twu34Tg + MO1-tbx5a Fig. 6 with image from Guzzolino et al., 2018
heart looping disrupted, abnormal WT + MO1-tbx5a Fig. 1 with image from Pi-Roig et al., 2014
Fig. 1 with image from Lu et al., 2011
Fig. 6 from Ghosh et al., 2009
Fig. 1,  Fig. 2,  Fig. 5 from Lu et al., 2008
heart looping process quality, abnormal WT + MO1-tbx5a Fig. 4 from Ghosh et al., 2017
heart tube linear, abnormal WT + MO1-tbx5a Fig. 4 with image from Garrity et al., 2002
myocardium disorganized, abnormal WT + MO1-tbx5a Fig. 7 with image from Lu et al., 2011
myocardium myofibril disorganized, abnormal WT + MO1-tbx5a Fig. 7 with image from Lu et al., 2011
paired fin absent, abnormal WT + MO1-tbx5a Fig. 6 from Ghosh et al., 2017
paired fin decreased size, abnormal WT + MO1-tbx5a Fig. 6 from Ghosh et al., 2017
paired fin morphology, abnormal WT + MO1-tbx5a Fig. 6 from Ghosh et al., 2017
pectoral fin absent, abnormal WT + MO1-tbx5a Fig. 6 with image from Guzzolino et al., 2018
Fig. 4 with image from Garrity et al., 2002
pectoral fin aplastic, abnormal WT + MO1-tbx5a Fig. 5 with image from Pi-Roig et al., 2014
Fig. 1 with image from Tsai et al., 2012
Fig. 6 from Ghosh et al., 2009
pectoral fin hypoplastic, abnormal WT + MO1-tbx5a Fig. 1 with image from Lu et al., 2011
pectoral fin morphology, abnormal twu34Tg + MO1-tbx5a Fig. 2 with image from Chiavacci et al., 2015
Fig. 6 from Li et al., 2014
pectoral fin truncated, abnormal WT + MO1-tbx5a Fig. 1 with image from Tsai et al., 2012
pectoral fin upturned, abnormal WT + MO1-tbx5a Fig. 4 with image from Garrity et al., 2002
pectoral fin bud absent, abnormal WT + MO1-tbx5a Fig. 6 with image from Fischer et al., 2003
pectoral fin development disrupted, abnormal WT + MO1-tbx5a Fig. 5 with image from Pi-Roig et al., 2014
pericardium edematous, abnormal WT + MO1-tbx5a Fig. 6 with image from Guzzolino et al., 2018
Fig. 4 from Ghosh et al., 2017
Fig. S8 with image from Chiavacci et al., 2012
Fig. 6 from Ghosh et al., 2009
Fig. 1,  Fig. 2 from Lu et al., 2008
somite U-shaped, abnormal WT + MO1-tbx5a Fig. 6 from Li et al., 2014
Fig. 1 with image from Tsai et al., 2012
trunk bent, abnormal WT + MO1-tbx5a Fig. 1 with image from Tsai et al., 2012
trunk curled, abnormal WT + MO1-tbx5a Fig. 1 with image from Lu et al., 2011
trunk decreased length, abnormal WT + MO1-tbx5a Fig. 1 with image from Lu et al., 2011
whole organism dead, abnormal twu34Tg + MO1-tbx5a Fig. 2 with image from Chiavacci et al., 2015
whole organism ghrb expression decreased amount, abnormal WT + MO1-tbx5a Fig. 2 with image from Tsai et al., 2012
whole organism ghra expression decreased amount, abnormal WT + MO1-tbx5a Fig. 2 with image from Tsai et al., 2012
whole organism akt2 expression decreased amount, abnormal WT + MO1-tbx5a Fig. 2 with image from Tsai et al., 2012
whole organism igf1 expression decreased amount, abnormal WT + MO1-tbx5a Fig. 2 with image from Tsai et al., 2012
whole organism robo1 expression increased amount, abnormal AB + MO1-tbx5a Fig. 2 from D'Aurizio et al., 2016
whole organism dre-mir-7ba expression increased amount, abnormal AB + MO1-tbx5a Fig. 2 from D'Aurizio et al., 2016
whole organism mef2aa expression increased amount, abnormal AB + MO1-tbx5a Fig. 2 from D'Aurizio et al., 2016
whole organism camk2d1 expression increased amount, abnormal AB + MO1-tbx5a Fig. 2 from D'Aurizio et al., 2016
whole organism cdkn1bb expression increased amount, abnormal WT + MO1-tbx5a Fig. 5 with image from Tsai et al., 2012
whole organism bcl2a expression increased amount, abnormal WT + MO1-tbx5a Fig. 4 with image from Tsai et al., 2012
whole organism dre-mir-19a expression increased amount, abnormal AB + MO1-tbx5a Fig. 2 from D'Aurizio et al., 2016
whole organism srfa expression increased amount, abnormal AB + MO1-tbx5a Fig. 2 from D'Aurizio et al., 2016
whole organism badb expression increased amount, abnormal WT + MO1-tbx5a Fig. 4 with image from Tsai et al., 2012
whole organism atp1a2a expression increased amount, abnormal AB + MO1-tbx5a Fig. 2 from D'Aurizio et al., 2016
whole organism ndrg4 expression increased amount, abnormal AB + MO1-tbx5a Fig. 2 from D'Aurizio et al., 2016
whole organism mir34a expression increased amount, abnormal AB + MO1-tbx5a Fig. 2 from D'Aurizio et al., 2016
whole organism hand2 expression increased amount, abnormal AB + MO1-tbx5a Fig. 2 from D'Aurizio et al., 2016
whole organism mir10d expression increased amount, abnormal AB + MO1-tbx5a Fig. 2 from D'Aurizio et al., 2016
whole organism mir30a expression increased amount, abnormal AB + MO1-tbx5a Fig. 2 from D'Aurizio et al., 2016
whole organism cdk2 expression increased amount, abnormal WT + MO1-tbx5a Fig. 5 with image from Tsai et al., 2012
whole organism lacks parts or has fewer parts of type pectoral fin, abnormal WT + MO1-tbx5a Fig. 4 with image from Garrity et al., 2002
whole organism semi-lethal (sensu genetics), abnormal WT + MO1-tbx5a Fig. 2 from Lu et al., 2008
Phenotype of all Fish created by or utilizing MO1-tbx5a
Phenotype Fish Conditions Figures
whole organism camk2d1 expression increased amount, abnormal AB + MO1-tbx5a standard conditions Fig. 2 from D'Aurizio et al., 2016
whole organism mir34a expression increased amount, abnormal AB + MO1-tbx5a standard conditions Fig. 2 from D'Aurizio et al., 2016
whole organism mir30a expression increased amount, abnormal AB + MO1-tbx5a standard conditions Fig. 2 from D'Aurizio et al., 2016
whole organism atp1a2a expression increased amount, abnormal AB + MO1-tbx5a standard conditions Fig. 2 from D'Aurizio et al., 2016
whole organism hand2 expression increased amount, abnormal AB + MO1-tbx5a standard conditions Fig. 2 from D'Aurizio et al., 2016
whole organism mef2aa expression increased amount, abnormal AB + MO1-tbx5a standard conditions Fig. 2 from D'Aurizio et al., 2016
whole organism dre-mir-19a expression increased amount, abnormal AB + MO1-tbx5a standard conditions Fig. 2 from D'Aurizio et al., 2016
whole organism dre-mir-7ba expression increased amount, abnormal AB + MO1-tbx5a standard conditions Fig. 2 from D'Aurizio et al., 2016
whole organism robo1 expression increased amount, abnormal AB + MO1-tbx5a standard conditions Fig. 2 from D'Aurizio et al., 2016
whole organism ndrg4 expression increased amount, abnormal AB + MO1-tbx5a standard conditions Fig. 2 from D'Aurizio et al., 2016
whole organism mir10d expression increased amount, abnormal AB + MO1-tbx5a standard conditions Fig. 2 from D'Aurizio et al., 2016
whole organism srfa expression increased amount, abnormal AB + MO1-tbx5a standard conditions Fig. 2 from D'Aurizio et al., 2016
atrium myh6 expression decreased amount, abnormal WT + MO1-tbx5a standard conditions Fig. 6 with image from Tsai et al., 2012
trunk bent, abnormal WT + MO1-tbx5a standard conditions Fig. 1 with image from Tsai et al., 2012
whole organism badb expression amount, ameliorated WT + MO1-tbx5a chemical treatment by injection: growth hormone Fig. 4 with image from Tsai et al., 2012
cardiac ventricle decreased contractility, abnormal WT + MO1-tbx5a standard conditions Fig. 1 with image from Tsai et al., 2012
somite U-shaped, abnormal WT + MO1-tbx5a standard conditions Fig. 6 from Li et al., 2014
Fig. 1 with image from Tsai et al., 2012
heart morphology, ameliorated WT + MO1-tbx5a chemical treatment by injection: growth hormone Fig. 6 from Li et al., 2014
cardiac ventricle morphology, abnormal WT + MO1-tbx5a standard conditions Fig. 4 from Ghosh et al., 2017
whole organism ghra expression decreased amount, abnormal WT + MO1-tbx5a standard conditions Fig. 2 with image from Tsai et al., 2012
paired fin morphology, abnormal WT + MO1-tbx5a standard conditions Fig. 6 from Ghosh et al., 2017
myocardium disorganized, abnormal WT + MO1-tbx5a standard conditions Fig. 7 with image from Lu et al., 2011
cardiac ventricle myl7 expression amount, ameliorated WT + MO1-tbx5a chemical treatment by injection: growth hormone Fig. 6 with image from Tsai et al., 2012
heart decreased size, abnormal WT + MO1-tbx5a standard conditions Fig. 2 from Lu et al., 2008
heart malformed, abnormal WT + MO1-tbx5a standard conditions Fig. 1 with image from Pi-Roig et al., 2014
Fig. 1 with image from Lu et al., 2011
cardiac ventricle myh7 expression decreased amount, abnormal WT + MO1-tbx5a standard conditions Fig. 6 with image from Tsai et al., 2012
paired fin absent, abnormal WT + MO1-tbx5a standard conditions Fig. 6 from Ghosh et al., 2017
pectoral fin morphology, abnormal WT + MO1-tbx5a standard conditions Fig. 6 from Li et al., 2014
trunk decreased length, abnormal WT + MO1-tbx5a standard conditions Fig. 1 with image from Lu et al., 2011
cardiac muscle cell bicellular tight junction dissociated from cardiac muscle cell bicellular tight junction, abnormal WT + MO1-tbx5a standard conditions Fig. 7 with image from Lu et al., 2011
cardiac ventricle size, abnormal WT + MO1-tbx5a standard conditions Fig. 4 from Ghosh et al., 2017
trunk curled, abnormal WT + MO1-tbx5a standard conditions Fig. 1 with image from Lu et al., 2011
atrium morphology, abnormal WT + MO1-tbx5a standard conditions Fig. 4 from Ghosh et al., 2017
heart morphology, abnormal WT + MO1-tbx5a standard conditions Fig. 4 from Ghosh et al., 2017
Fig. 6 from Li et al., 2014
Fig. 1 with image from Tsai et al., 2012
Fig. 1,  Fig. 2,  Fig. 5 from Lu et al., 2008
Fig. 9 with image from Qu et al., 2008
whole organism cdkn1bb expression amount, ameliorated WT + MO1-tbx5a chemical treatment by injection: growth hormone Fig. 5 with image from Tsai et al., 2012
cardiac muscle cell mitochondrion increased amount, abnormal WT + MO1-tbx5a standard conditions Fig. 7 with image from Lu et al., 2011
paired fin decreased size, abnormal WT + MO1-tbx5a standard conditions Fig. 6 from Ghosh et al., 2017
pectoral fin bud absent, abnormal WT + MO1-tbx5a standard conditions Fig. 6 with image from Fischer et al., 2003
cardiac ventricle myl7 expression decreased amount, abnormal WT + MO1-tbx5a standard conditions Fig. 6 with image from Tsai et al., 2012
pectoral fin upturned, abnormal WT + MO1-tbx5a standard conditions Fig. 4 with image from Garrity et al., 2002
heart looping arrested, abnormal WT + MO1-tbx5a standard conditions Fig. 1 with image from Pi-Roig et al., 2014
Fig. 4 with image from Garrity et al., 2002
whole organism cdk2 expression amount, ameliorated WT + MO1-tbx5a chemical treatment by injection: growth hormone Fig. 5 with image from Tsai et al., 2012
whole organism bcl2a expression increased amount, abnormal WT + MO1-tbx5a standard conditions Fig. 4 with image from Tsai et al., 2012
cardiac ventricle myh7 expression amount, ameliorated WT + MO1-tbx5a chemical treatment by injection: growth hormone Fig. 6 with image from Tsai et al., 2012
whole organism ghrb expression decreased amount, abnormal WT + MO1-tbx5a standard conditions Fig. 2 with image from Tsai et al., 2012
pericardium edematous, abnormal WT + MO1-tbx5a standard conditions Fig. 4 from Ghosh et al., 2017
Fig. 6 from Ghosh et al., 2009
Fig. 1,  Fig. 2 from Lu et al., 2008
whole organism cdkn1bb expression increased amount, abnormal WT + MO1-tbx5a standard conditions Fig. 5 with image from Tsai et al., 2012
somite shape, ameliorated WT + MO1-tbx5a chemical treatment by injection: growth hormone Fig. 6 from Li et al., 2014
cardiac muscle cell mitochondrion swollen, abnormal WT + MO1-tbx5a standard conditions Fig. 7 with image from Lu et al., 2011
pectoral fin aplastic, abnormal WT + MO1-tbx5a standard conditions Fig. 5 with image from Pi-Roig et al., 2014
Fig. 1 with image from Tsai et al., 2012
Fig. 6 from Ghosh et al., 2009
heart development disrupted, abnormal WT + MO1-tbx5a standard conditions Fig. 9 with image from Qu et al., 2008
heart edematous, abnormal WT + MO1-tbx5a standard conditions Fig. 1 with image from Tsai et al., 2012
pectoral fin hypoplastic, abnormal WT + MO1-tbx5a standard conditions Fig. 1 with image from Lu et al., 2011
pectoral fin truncated, abnormal WT + MO1-tbx5a standard conditions Fig. 1 with image from Tsai et al., 2012
whole organism semi-lethal (sensu genetics), abnormal WT + MO1-tbx5a standard conditions Fig. 2 from Lu et al., 2008
atrium size, abnormal WT + MO1-tbx5a standard conditions Fig. 4 from Ghosh et al., 2017
whole organism cdk2 expression increased amount, abnormal WT + MO1-tbx5a standard conditions Fig. 5 with image from Tsai et al., 2012
heart jogging disrupted, abnormal WT + MO1-tbx5a standard conditions Fig. 2 with image from Pi-Roig et al., 2014
heart contraction decreased rate, abnormal WT + MO1-tbx5a standard conditions Fig. 4 from Ghosh et al., 2017
whole organism lacks parts or has fewer parts of type pectoral fin, abnormal WT + MO1-tbx5a standard conditions Fig. 4 with image from Garrity et al., 2002
whole organism badb expression increased amount, abnormal WT + MO1-tbx5a standard conditions Fig. 4 with image from Tsai et al., 2012
heart looping disrupted, abnormal WT + MO1-tbx5a standard conditions Fig. 1 with image from Pi-Roig et al., 2014
Fig. 1 with image from Lu et al., 2011
Fig. 6 from Ghosh et al., 2009
Fig. 1,  Fig. 2,  Fig. 5 from Lu et al., 2008
pectoral fin development disrupted, abnormal WT + MO1-tbx5a standard conditions Fig. 5 with image from Pi-Roig et al., 2014
whole organism igf1 expression decreased amount, abnormal WT + MO1-tbx5a standard conditions Fig. 2 with image from Tsai et al., 2012
apoptotic process occurrence, ameliorated WT + MO1-tbx5a chemical treatment by injection: growth hormone Fig. 3 with image from Tsai et al., 2012
pectoral fin absent, abnormal WT + MO1-tbx5a standard conditions Fig. 4 with image from Garrity et al., 2002
atrium myh6 expression amount, ameliorated WT + MO1-tbx5a chemical treatment by injection: growth hormone Fig. 6 with image from Tsai et al., 2012
heart tube linear, abnormal WT + MO1-tbx5a standard conditions Fig. 4 with image from Garrity et al., 2002
apoptotic process increased occurrence, abnormal WT + MO1-tbx5a standard conditions Fig. 3 with image from Tsai et al., 2012
Fig. 1 with image from Lu et al., 2011
myocardium myofibril disorganized, abnormal WT + MO1-tbx5a standard conditions Fig. 7 with image from Lu et al., 2011
pectoral fin morphology, ameliorated WT + MO1-tbx5a chemical treatment by injection: growth hormone Fig. 6 from Li et al., 2014
heart looping process quality, abnormal WT + MO1-tbx5a standard conditions Fig. 4 from Ghosh et al., 2017
whole organism akt2 expression decreased amount, abnormal WT + MO1-tbx5a standard conditions Fig. 2 with image from Tsai et al., 2012
whole organism bcl2a expression amount, ameliorated WT + MO1-tbx5a chemical treatment by injection: growth hormone Fig. 4 with image from Tsai et al., 2012
heart decreased size, abnormal f1Tg + MO1-tbx5a standard conditions Fig. 4 from Tong et al., 2014
heart morphology, abnormal twu34Tg + MO1-tbx5a standard conditions Fig. 6 with image from Guzzolino et al., 2018
Fig. 2 with image from Chiavacci et al., 2015
heart contraction rate, ameliorated twu34Tg + MO1-tbx5a chemical treatment by environment: sphingosine-1-phosphate receptor 1 antagonist Fig. 6 with image from Guzzolino et al., 2018
pericardium edematous, abnormal twu34Tg + MO1-tbx5a standard conditions Fig. 6 with image from Guzzolino et al., 2018
pectoral fin absent, abnormal twu34Tg + MO1-tbx5a chemical treatment by environment: sphingosine-1-phosphate receptor 1 antagonist Fig. 6 with image from Guzzolino et al., 2018
heart development disrupted, abnormal twu34Tg + MO1-tbx5a standard conditions Fig. 2 with image from Chiavacci et al., 2015
whole organism dead, abnormal twu34Tg + MO1-tbx5a standard conditions Fig. 2 with image from Chiavacci et al., 2015
heart contraction decreased rate, abnormal twu34Tg + MO1-tbx5a control Fig. 6 with image from Guzzolino et al., 2018
heart looping decreased occurrence, abnormal twu34Tg + MO1-tbx5a control Fig. 6 with image from Guzzolino et al., 2018
pectoral fin morphology, abnormal twu34Tg + MO1-tbx5a standard conditions Fig. 2 with image from Chiavacci et al., 2015
heart morphology, ameliorated twu34Tg + MO1-tbx5a chemical treatment by environment: sphingosine-1-phosphate receptor 1 antagonist Fig. 6 with image from Guzzolino et al., 2018
heart straight, abnormal twu34Tg + MO1-tbx5a standard conditions Fig. 6 with image from Guzzolino et al., 2018
pectoral fin absent, abnormal twu34Tg + MO1-tbx5a standard conditions Fig. 6 with image from Guzzolino et al., 2018
pericardium edematous, abnormal s849Tg; uto1Tg + MO1-tbx5a standard conditions Fig. S8 with image from Chiavacci et al., 2012
fin agenesis, abnormal s849Tg; uto1Tg + MO1-tbx5a standard conditions Fig. S8 with image from Chiavacci et al., 2012
fin absent, abnormal AB + MO1-tbx5a + MO2-tbx5b standard conditions Fig. 1 with image from Chiavacci et al., 2015
heart morphology, abnormal AB + MO1-tbx5a + MO2-tbx5b standard conditions Fig. 1 with image from Chiavacci et al., 2015
fin morphology, abnormal AB + MO1-tbx5a + MO2-tbx5b standard conditions Fig. 1 with image from Chiavacci et al., 2015
heart looping disrupted, abnormal TL + MO1-tbx5a + MO3-atoh8 standard conditions Fig. 3 from Rawnsley et al., 2013
heart tube shape, abnormal TL + MO1-tbx5a + MO3-atoh8 standard conditions Fig. 3 from Rawnsley et al., 2013
heart tube bifurcated, abnormal WT + MO1-gata5 + MO1-tbx5a standard conditions Fig. 1 with image from Lou et al., 2011
heart morphogenesis disrupted, abnormal WT + MO1-gata5 + MO1-tbx5a standard conditions Fig. 1 with image from Lou et al., 2011
cardiac muscle cell differentiation disrupted, abnormal WT + MO1-gata5 + MO1-tbx5a standard conditions Fig. 1 with image from Lou et al., 2011
cardiac muscle cell decreased amount, abnormal WT + MO1-gata5 + MO1-tbx5a standard conditions Fig. 1 with image from Lou et al., 2011
heart morphology, abnormal WT + MO1-smarcd3b + MO1-tbx5a standard conditions Fig. 1 with image from Lou et al., 2011
heart morphogenesis disrupted, abnormal WT + MO1-smarcd3b + MO1-tbx5a standard conditions Fig. 1 with image from Lou et al., 2011
heart jogging disrupted, abnormal WT + MO1-tbx5a + MO1-tbx5b standard conditions Fig. 2 with image from Pi-Roig et al., 2014
heart looping disrupted, abnormal WT + MO1-tbx5a + MO1-tbx5b standard conditions Fig. 1 with image from Pi-Roig et al., 2014
cranial nerve II decreased thickness, abnormal WT + MO1-tbx5a + MO1-tbx5b standard conditions Fig. 4 with image from Pi-Roig et al., 2014
heart malformed, abnormal WT + MO1-tbx5a + MO1-tbx5b standard conditions Fig. 1 with image from Pi-Roig et al., 2014
heart looping arrested, abnormal WT + MO1-tbx5a + MO1-tbx5b standard conditions Fig. 1 with image from Pi-Roig et al., 2014
heart looping disrupted, abnormal WT + MO1-tbx5a + MO5-mef2ca standard conditions Fig. 6,  Fig. 7 from Ghosh et al., 2009
pericardium edematous, abnormal WT + MO1-tbx5a + MO5-mef2ca standard conditions Fig. 6 from Ghosh et al., 2009
heart morphogenesis arrested, abnormal WT + MO1-gata5 + MO1-smarcd3b + MO1-tbx5a standard conditions Fig. 1 with image from Lou et al., 2011
cardiac muscle cell differentiation disrupted, abnormal WT + MO1-gata5 + MO1-smarcd3b + MO1-tbx5a standard conditions Fig. 1 with image from Lou et al., 2011
heart tube bifurcated, abnormal WT + MO1-gata5 + MO1-smarcd3b + MO1-tbx5a standard conditions Fig. 1 with image from Lou et al., 2011
cardiac muscle cell decreased amount, abnormal WT + MO1-gata5 + MO1-smarcd3b + MO1-tbx5a standard conditions Fig. 1 with image from Lou et al., 2011
cardiac muscle cell differentiation disrupted, abnormal twu34Tg + MO1-gata5 + MO1-tbx5a standard conditions Fig. 1 with image from Lou et al., 2011
heart bifurcated, abnormal twu34Tg + MO1-gata5 + MO1-tbx5a standard conditions Fig. 1 with image from Lou et al., 2011
heart morphogenesis disrupted, abnormal twu34Tg + MO1-gata5 + MO1-tbx5a standard conditions Fig. 1 with image from Lou et al., 2011
heart looping disrupted, abnormal twu34Tg + MO1-smarcd3b + MO1-tbx5a standard conditions Fig. 1 with image from Lou et al., 2011
heart development disrupted, abnormal twu34Tg + MO1-tbx5a + MO2-dre-mir-19a standard conditions Fig. 4 with image from Chiavacci et al., 2015
heart morphology, abnormal twu34Tg + MO1-tbx5a + MO2-dre-mir-19a standard conditions Fig. 4 with image from Chiavacci et al., 2015
fin morphology, abnormal twu34Tg + MO1-tbx5a + MO2-dre-mir-19a standard conditions Fig. 4 with image from Chiavacci et al., 2015
pectoral fin absent, exacerbated twu34Tg + MO1-tbx5a + MO2-s1pr1 standard conditions Fig. 6 with image from Guzzolino et al., 2018
pectoral fin amount, ameliorated twu34Tg + MO1-tbx5a + MO2-s1pr1 standard conditions Fig. 6 with image from Guzzolino et al., 2018
heart morphology, ameliorated twu34Tg + MO1-tbx5a + MO2-s1pr1 standard conditions Fig. 6 with image from Guzzolino et al., 2018
heart morphology, abnormal twu34Tg + MO1-tbx5a + MO2-tbx5b standard conditions Fig. 1 with image from Chiavacci et al., 2015
heart morphology, abnormal el133Tg + MO1-gata5 + MO1-smarcd3b + MO1-tbx5a standard conditions Fig. S1 with image from Lou et al., 2011
pharyngeal musculature morphology, abnormal el133Tg + MO1-gata5 + MO1-smarcd3b + MO1-tbx5a standard conditions Fig. S1 with image from Lou et al., 2011
endocardium aplastic, abnormal s843Tg + MO1-gata5 + MO1-smarcd3b + MO1-tbx5a standard conditions Fig. S1 with image from Lou et al., 2011
cardiac muscle cell differentiation disrupted, abnormal twu34Tg + MO1-gata5 + MO1-smarcd3b + MO1-tbx5a standard conditions Fig. 1 with image from Lou et al., 2011
heart morphogenesis disrupted, abnormal twu34Tg + MO1-gata5 + MO1-smarcd3b + MO1-tbx5a standard conditions Fig. 1 with image from Lou et al., 2011
heart bifurcated, abnormal twu34Tg + MO1-gata5 + MO1-smarcd3b + MO1-tbx5a standard conditions Fig. 1 with image from Lou et al., 2011
heart morphology, abnormal s957Tg; s958Tg + MO1-tbx5a control Fig. 4 with image from Wang et al., 2017
heart edematous, abnormal s957Tg; s958Tg + MO1-tbx5a control Fig. 4 with image from Wang et al., 2017
heart looping arrested, abnormal s957Tg; s958Tg + MO1-tbx5a control Fig. 4 with image from Wang et al., 2017
heart development process quality, abnormal s957Tg; s958Tg + MO1-tbx5a control Fig. 4 with image from Wang et al., 2017
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.