header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-070614-5
Morpholino Name: MO6-notch3
Target: notch3 (1)
Sequence:
5' - AAGGATCAGTCATCTTACCTTCGCT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO6-notch3 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO6-notch3
Expressed Gene Anatomy Figures
dlc Fig. 2 from Kim et al., 2014
efnb2a Fig. 2 from Kim et al., 2014
foxc1b Fig. 2Fig. 6Fig. S2 from Kim et al., 2014
her9 Fig. 5 with image from Ma et al., 2007
kdrl Fig. 2 from Kim et al., 2014
myb Fig. 1 from Kim et al., 2014
myod1 Fig. 2 from Kim et al., 2014
runx1 Fig. 1Fig. 3Fig. 5Fig. 6 from Kim et al., 2014
twist1a Fig. S2 from Kim et al., 2014
twist1b Fig. 2Fig. 6Fig. S2 from Kim et al., 2014
PHENOTYPE
Phenotype resulting from MO6-notch3
Phenotype of all Fish created by or utilizing MO6-notch3
Phenotype Fish Conditions Figures
dorsal telencephalon radial glial cell proliferative, abnormal AB + MO6-notch3 standard conditions Fig. 5 with image from Alunni et al., 2013
hematopoietic stem cell differentiation process quality, abnormal AB + MO6-notch3 standard conditions Fig. 1 from Kim et al., 2014
radial glial cell division in pallium increased occurrence, abnormal AB + MO6-notch3 standard conditions Fig. 5 with image from Alunni et al., 2013
hematopoietic progenitor cell differentiation process quality, abnormal AB + MO6-notch3 standard conditions Fig. 1Fig. 6 from Kim et al., 2014
hemopoiesis process quality, abnormal AB + MO6-notch3 standard conditions Fig. 1 from Kim et al., 2014
sclerotome development process quality, abnormal AB + MO6-notch3 standard conditions Fig. 2Fig. 6 from Kim et al., 2014
sclerotome development process quality, abnormal WT + MO6-notch3 standard conditions Fig. S2 from Kim et al., 2014
thymus development process quality, abnormal zdf8Tg + MO6-notch3 standard conditions Fig. 1 from Kim et al., 2014
hematopoietic progenitor cell differentiation process quality, abnormal bw9Tg; kca3Tg + MO6-notch3 standard conditions Fig. 5 from Kim et al., 2014
hematopoietic progenitor cell differentiation process quality, abnormal hzm7Et; kca3Tg + MO6-notch3 standard conditions Fig. 5 from Kim et al., 2014
hematopoietic multipotent progenitor cell decreased amount, abnormal kca3Tg; kca4Tg + MO6-notch3 standard conditions Fig. 3 from Kim et al., 2014
hematopoietic progenitor cell differentiation process quality, abnormal kca3Tg; kca4Tg + MO6-notch3 standard conditions Fig. 3 from Kim et al., 2014
hemopoiesis process quality, abnormal la4Tg; zf169Tg + MO6-notch3 standard conditions Fig. 1 from Kim et al., 2014
hematopoietic stem cell differentiation process quality, abnormal la4Tg; zf169Tg + MO6-notch3 standard conditions Fig. 1 from Kim et al., 2014
hematopoietic progenitor cell differentiation process quality, abnormal la4Tg; zf169Tg + MO6-notch3 standard conditions Fig. 1 from Kim et al., 2014
sclerotome development process quality, abnormal dlctit446/+ + MO6-notch3(AB) standard conditions Fig. 6 from Kim et al., 2014
hematopoietic progenitor cell differentiation process quality, abnormal dlctit446/+ + MO6-notch3(AB) standard conditions Fig. 6 from Kim et al., 2014
sclerotome development process quality, abnormal AB + MO2-dld + MO6-notch3 standard conditions Fig. 6 from Kim et al., 2014
hematopoietic progenitor cell differentiation process quality, abnormal AB + MO2-dld + MO6-notch3 standard conditions Fig. 6 from Kim et al., 2014
dorsal aorta development process quality, abnormal AB + MO6-notch1b + MO6-notch3 standard conditions Fig. S5 from Kim et al., 2014
hematopoietic progenitor cell differentiation process quality, abnormal AB + MO6-notch1b + MO6-notch3 standard conditions Fig. S5 from Kim et al., 2014
OTHER MO6-notch3 MORPHOLINO PAGESNo links to external sites
CITATIONS (3)