Morpholino

MO1-irf8

ID
ZDB-MRPHLNO-111212-2
Name
MO1-irf8
Previous Names
  • irf8 MOsp (1)
Target
Sequence
5' - AATGTTTCGCTTACTTTGAAAATGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-irf8
No data available
Phenotype
Phenotype resulting from MO1-irf8
Phenotype of all Fish created by or utilizing MO1-irf8
Phenotype Fish Conditions Figures
whole organism decreased life span, exacerbated AB + MO1-irf8 bacterial treatment by injection: Streptococcus iniae Fig. 5 with image from Vincent et al., 2017
whole organism decreased life span, exacerbated AB/TL + MO1-irf8 bacterial treatment by injection: Salmonella enterica subsp. enterica serovar Typhimurium Fig. 4 from Masud et al., 2019
whole organism has extra parts of type neutrophil, abnormal TU + MO1-irf8 bacterial treatment by injection: Acinetobacter baumannii ATCC 17978 Fig. S2 with image from Bhuiyan et al., 2016
whole organism has fewer parts of type macrophage, abnormal TU + MO1-irf8 bacterial treatment by injection: Acinetobacter baumannii ATCC 17978 Fig. S2 with image from Bhuiyan et al., 2016
head epidermis irg1l expression position, ameliorated WT + MO1-irf8 bacterial treatment by injection: Salmonella enterica subsp. enterica serovar Typhimurium Fig. 2 from Hall et al., 2014
caudal fin regenerating fin il1b expression increased amount, abnormal WT + MO1-irf8 amputation: caudal fin Fig. 5 with image from Hasegawa et al., 2017
epithelial cell irg1l expression position, ameliorated WT + MO1-irf8 bacterial treatment by injection: Salmonella enterica subsp. enterica serovar Typhimurium Fig. 2 from Hall et al., 2014
defense response to fungus increased process quality, abnormal WT + MO1-irf8 fungal treatment by injection: Aspergillus fumigatus Fig. 7 with image from Rosowski et al., 2018
trunk acod1 expression amount, ameliorated WT + MO1-irf8 bacterial treatment by injection: Salmonella enterica subsp. enterica serovar Typhimurium Fig. 1 with image from Hall et al., 2013
defense response to fungus process quality, abnormal WT + MO1-irf8 standard conditions Fig. 5 from Knox et al., 2014
microglial cell decreased amount, abnormal WT + MO1-irf8 standard conditions Fig. 2 from Li et al., 2011
vasculature acod1 expression amount, ameliorated WT + MO1-irf8 bacterial treatment by injection: Salmonella enterica subsp. enterica serovar Typhimurium Fig. 1 with image from Hall et al., 2013
macrophage absent, abnormal WT + MO1-irf8 standard conditions Fig. 2 from Li et al., 2011
regenerating fin apoptotic process occurrence, ameliorated WT + MO1-irf8 chemical treatment by environment: dexamethasone, amputation: caudal fin Fig. 5 with image from Hasegawa et al., 2017
neuromast epithelium irg1l expression position, ameliorated WT + MO1-irf8 bacterial treatment by injection: Salmonella enterica subsp. enterica serovar Typhimurium Fig. 2 from Hall et al., 2014
macrophage decreased amount, abnormal WT + MO1-irf8 standard conditions Fig. 2 from Li et al., 2011
olfactory epithelium irg1l expression position, ameliorated WT + MO1-irf8 bacterial treatment by injection: Salmonella enterica subsp. enterica serovar Typhimurium Fig. 2 from Hall et al., 2014
blood cebpb expression amount, ameliorated WT + MO1-irf8 bacterial treatment by injection: Salmonella enterica subsp. enterica serovar Typhimurium Fig. 2 with image from Hall et al., 2013
neutrophil increased amount, abnormal WT + MO1-irf8 standard conditions Fig. 3Fig. 4 from Li et al., 2011
whole organism lacks all parts of type macrophage, abnormal WT + MO1-irf8 standard conditions Fig. 6 with image from Shiau et al., 2013
fin regeneration increased duration, abnormal WT + MO1-irf8 physical alteration: anatomical structure Fig. 5 from Li et al., 2012
macrophage decreased amount, abnormal WT + MO1-irf8 amputation: caudal fin Fig. 4 with image from Hasegawa et al., 2017
whole organism decreased life span, abnormal WT + MO1-irf8 standard conditions Fig. 5 from Knox et al., 2014
hindbrain acod1 expression amount, ameliorated WT + MO1-irf8 bacterial treatment by injection: Salmonella enterica subsp. enterica serovar Typhimurium Fig. 1 with image from Hall et al., 2013
regenerating fin apoptotic process increased occurrence, abnormal WT + MO1-irf8 amputation: caudal fin Fig. 4 with imageFig. 5 with image from Hasegawa et al., 2017
midbrain acod1 expression amount, ameliorated WT + MO1-irf8 bacterial treatment by injection: Salmonella enterica subsp. enterica serovar Typhimurium Fig. 1 with image from Hall et al., 2013
macrophage acod1 expression amount, ameliorated WT + MO1-irf8 bacterial treatment by injection: Salmonella enterica subsp. enterica serovar Typhimurium Fig. 1 with image from Hall et al., 2013
macrophage decreased amount, abnormal gl22Tg + MO1-irf8 standard conditions Fig. S1 with image from Yan et al., 2015
neutrophil increased amount, abnormal i113Tg + MO1-irf8 standard conditions Fig. 4 from Li et al., 2011
macrophage decreased amount, abnormal i113Tg + MO1-irf8 standard conditions Fig. 2 from Li et al., 2011
macrophage decreased amount, abnormal nz50Tg + MO1-irf8 chemical treatment: prostaglandin E2 Fig. S4 with image from Feng et al., 2012
neutrophil increased amount, abnormal nz50Tg + MO1-irf8 chemical treatment: prostaglandin E2 Fig. S4 with image from Feng et al., 2012
neutrophil increased amount, abnormal nz50Tg + MO1-irf8 standard conditions Fig. S1 with image from Yan et al., 2015
Fig. S4 with image from Feng et al., 2012
macrophage decreased amount, abnormal nz50Tg + MO1-irf8 standard conditions Fig. S4 with image from Feng et al., 2012
trunk vasculature morphology, ameliorated s843Tg + MO1-irf8 bacterial treatment by injection: Mycobacterium marinum M Fig. 3 with image from Torraca et al., 2017
trunk vasculature response to bacterium process quality, abnormal s843Tg + MO1-irf8 bacterial treatment by injection: Mycobacterium marinum M Fig. 3 with image from Torraca et al., 2017
myelin accumulating cell cell projection amount, ameliorated ue2Tg + MO1-irf8 (AB) bacterial treatment by injection: Mycobacterium leprae, chemical treatment by injection: clondronate(2-), chemical ablation: macrophage Fig. 5 with image from Madigan et al., 2017
neuron myelin sheath disorganized, ameliorated ue2Tg + MO1-irf8 (AB) bacterial treatment by injection: Mycobacterium leprae, chemical treatment by injection: clondronate(2-), chemical ablation: macrophage Fig. 5 with image from Madigan et al., 2017
macrophage decreased amount, abnormal uwm12Tg + MO1-irf8 standard conditions Fig. S2 from Knox et al., 2014
defense response to fungus process quality, abnormal uwm12Tg + MO1-irf8 fungal treatment: Aspergillus fumigatus Fig. 2 from Knox et al., 2014
macrophage aplastic, abnormal uwm12Tg + MO1-irf8 standard conditions Fig. S2 from Knox et al., 2014
whole organism decreased life span, abnormal uwm12Tg + MO1-irf8 fungal treatment: Aspergillus fumigatus Fig. 2 from Knox et al., 2014
whole organism decreased life span, exacerbated uwm12Tg + MO1-irf8 bacterial treatment by injection: Streptococcus iniae Fig. 1 with image from Vincent et al., 2017
macrophage decreased amount, abnormal w200Tg + MO1-irf8 control Fig. 5 with image from Pagán et al., 2015
macrophage absent, abnormal uwm12Tg; uwm24Tg + MO1-irf8 physical alteration: caudal fin Fig. 2 from Tauzin et al., 2014
neutrophil response to wounding process quality, abnormal uwm12Tg; uwm24Tg + MO1-irf8 physical alteration: caudal fin Fig. 2 from Tauzin et al., 2014
neutrophil chemotaxis process quality, abnormal uwm12Tg; uwm24Tg + MO1-irf8 physical alteration: caudal fin Fig. 2 from Tauzin et al., 2014
liver hematopoietic multipotent progenitor cell Ab14-gfap labeling amount, ameliorated gz32Tg/gz32Tg + MO1-irf8 chemical treatment by environment: doxycycline Fig. 2 with image from Yang et al., 2018
liver hematopoietic multipotent progenitor cell Ab5-acta2 labeling amount, ameliorated gz32Tg/gz32Tg + MO1-irf8 chemical treatment by environment: doxycycline Fig. 2 with image from Yang et al., 2018
hematopoietic multipotent progenitor cell apoptotic process increased occurrence, exacerbated gz32Tg/gz32Tg + MO1-irf8 chemical treatment by environment: doxycycline Fig. 2 with image from Yang et al., 2018
liver hematopoietic multipotent progenitor cell ab1-casp3 labeling amount, ameliorated gz32Tg/gz32Tg + MO1-irf8 chemical treatment by environment: doxycycline Fig. 2 with image from Yang et al., 2018
liver hematopoietic multipotent progenitor cell ab1-tgfb1a labeling increased amount, abnormal gz32Tg/gz32Tg + MO1-irf8 chemical treatment by environment: doxycycline Fig. 2 with image from Yang et al., 2018
defense response to fungus increased process quality, abnormal myd88hu3568/hu3568 + MO1-irf8 fungal treatment by injection: Aspergillus fumigatus Fig. 7 with image from Rosowski et al., 2018
whole organism lacks all parts of type macrophage, abnormal nlrc3lst73/+ + MO1-irf8 standard conditions Fig. 6 with image from Shiau et al., 2013
whole organism lacks all parts of type macrophage, abnormal nlrc3lst73/st73 + MO1-irf8 standard conditions Fig. 6 with image from Shiau et al., 2013
regenerating fin apoptotic process occurrence, ameliorated WT + MO1-il1b + MO1-irf8 amputation: caudal fin Fig. 5 with image from Hasegawa et al., 2017
neutrophil decreased amount, ameliorated nz50Tg + MO1-irf8 + MO3-septin15 bacterial treatment by injection: Shigella flexneri Fig. 3 with image from Mazon-Moya et al., 2017
whole organism decreased life span, abnormal nz50Tg + MO1-irf8 + MO3-septin15 bacterial treatment by injection: Shigella flexneri Fig. 3 with image from Mazon-Moya et al., 2017
whole organism decreased life span, exacerbated uwm36Tg + MO1-irf8 bacterial treatment by injection: Streptococcus iniae Fig. 5 with image from Vincent et al., 2017
muscle cell cell wall repair process quality, abnormal gl22Tg + MO1-irf8 + MO1-spi1b + MO3-csf3r light damage: sarcolemma: muscle cell Fig. 1 with image from Middel et al., 2016
macrophage absent, abnormal gl22Tg + MO1-irf8 + MO1-spi1b + MO3-csf3r light damage: sarcolemma: muscle cell Fig. 1 with image from Middel et al., 2016
trunk vasculature morphology, ameliorated cxcr4bt26035/t26035; s843Tg + MO1-irf8 bacterial treatment by injection: Mycobacterium marinum M Fig. 3 with image from Torraca et al., 2017
trunk vasculature response to bacterium process quality, abnormal cxcr4bt26035/t26035; s843Tg + MO1-irf8 bacterial treatment by injection: Mycobacterium marinum M Fig. 3 with image from Torraca et al., 2017
liver increased size, abnormal gz32Tg; nz50Tg + MO1-irf8 chemical treatment: doxycycline monohydrate Fig. 3 with image from Yan et al., 2015
liver neutrophil increased amount, abnormal gz32Tg; nz50Tg + MO1-irf8 chemical treatment: doxycycline monohydrate Fig. 3 with image from Yan et al., 2015
macrophage decreased amount, abnormal hzm1Et; io006Tg + MO1-irf8 chemical treatment: prostaglandin E2 Fig. 3 with image from Feng et al., 2012
macrophage decreased amount, abnormal hzm1Et; io006Tg + MO1-irf8 standard conditions Fig. 3 with image from Feng et al., 2012
mucus secreting cell decreased amount, abnormal hzm1Et; io006Tg + MO1-irf8 standard conditions Fig. 3 with image from Feng et al., 2012
neutrophil increased amount, abnormal hzm1Et; io006Tg + MO1-irf8 standard conditions Fig. 3 with image from Feng et al., 2012
mucus secreting cell proliferative, abnormal hzm1Et; io006Tg + MO1-irf8 standard conditions Fig. 3 with image from Feng et al., 2012
mucus secreting cell proliferative, abnormal hzm1Et; io006Tg + MO1-irf8 chemical treatment: prostaglandin E2 Fig. 3 with image from Feng et al., 2012
neutrophil increased amount, abnormal hzm1Et; io006Tg + MO1-irf8 chemical treatment: prostaglandin E2 Fig. 3 with image from Feng et al., 2012
macrophage absent, abnormal hzm1Et; io006Tg; nz50Tg + MO1-irf8 control Fig. 3 with image from Antonio et al., 2015
macrophage absent, abnormal hzm1Et; io006Tg; nz50Tg + MO1-irf8 resection: caudal fin Fig. 3 with image from Antonio et al., 2015
Citations