Morpholino

MO1-chrd

ID
ZDB-MRPHLNO-050221-6
Name
MO1-chrd
Previous Names
  • Chd(UTR) (1)
  • MO1-chd
  • zCdh (1)
  • chordin-MO (1)
Target
Sequence
5' - ATCCACAGCAGCCCCTCCATCATCC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Effects are abnormal u-shaped somites, reduced head, extremely expanded blood island, and abnormal tail fin.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-chrd
No data available
Phenotype
Phenotype resulting from MO1-chrd
Phenotype Fish Figures
blood island size, abnormal WT + MO1-chrd Fig. 5 with image from Griepenburg et al., 2015
brain anterior region decreased size, abnormal TL + MO1-chrd Fig. 2 from Kamachi et al., 2008
determination of heart left/right asymmetry disrupted, abnormal WT + MO1-chrd Fig. 5 with image from Aamar et al., 2010
determination of left/right asymmetry in lateral mesoderm disrupted, abnormal WT + MO1-chrd Fig. 4 with image from Aamar et al., 2010
determination of left/right symmetry disrupted, abnormal WT + MO1-chrd Fig. 6 with image from Aamar et al., 2010
dorsal/ventral pattern formation disrupted, abnormal WT + MO1-chrd Fig. 7 with image,  Fig. 8 with image from Branam et al., 2010
Fig. 8 with image from Dal-Pra et al., 2006
forerunner cell group decreased size, abnormal WT + MO1-chrd Fig. 7 with image from Aamar et al., 2010
head decreased size, abnormal AB + MO1-chrd Fig. 7 with image from Dixon Fox et al., 2009
Fig. 8 with image from Dal-Pra et al., 2006
heart looping disrupted, abnormal WT + MO1-chrd Fig. S4 with image from Aamar et al., 2010
intermediate cell mass of mesoderm increased size, abnormal TL + MO1-chrd Fig. 2 from Kamachi et al., 2008
Kupffer's vesicle bilateral, abnormal WT + MO1-chrd Fig. 6 with image from Aamar et al., 2010
Kupffer's vesicle decreased size, abnormal WT + MO1-chrd Fig. 6 with image from Aamar et al., 2010
Kupffer's vesicle inverted, abnormal WT + MO1-chrd Fig. 6 with image from Aamar et al., 2010
median fin fold increased amount, abnormal WT + MO1-chrd Fig. 5 with image from Xie et al., 2011
neural plate decreased length, abnormal WT + MO1-chrd Fig. 4 with image from Dal-Pra et al., 2006
neural plate decreased thickness, abnormal WT + MO1-chrd Fig. 4 with image from Dal-Pra et al., 2006
notochord decreased width, abnormal AB + MO1-chrd Fig. 7 with image from Dixon Fox et al., 2009
notochord truncated, abnormal AB + MO1-chrd Fig. 7 with image from Dixon Fox et al., 2009
otic vesicle decreased size, abnormal WT + MO1-chrd Fig. 4 with image from Dal-Pra et al., 2006
pancreatic B cell increased amount, abnormal AB + MO1-chrd Fig. 2 from Song et al., 2007
post-vent region apoptotic, abnormal WT + MO1-chrd Fig. 5 with image from Robu et al., 2007
post-vent region bent, abnormal WT + MO1-chrd + MO4-tp53 Fig. 8 with image from Branam et al., 2010
post-vent region increased size, abnormal WT + MO1-chrd Fig. 5 with image from Xie et al., 2011
Fig. 2 from Kamachi et al., 2008
post-vent region wholly ventralized, abnormal WT + MO1-chrd Fig. 2 with image from Esterberg et al., 2009
primitive heart tube bilateral, abnormal WT + MO1-chrd Fig. 5 with image from Aamar et al., 2010
primitive heart tube inverted, abnormal WT + MO1-chrd Fig. 5 with image from Aamar et al., 2010
somite U-shaped, abnormal WT + MO1-chrd Fig. 5 with image from Griepenburg et al., 2015
Fig. 5 with image from Xie et al., 2011
whole organism ventralized, abnormal AB + MO1-chrd Figure 4 with image from Cheng et al., 2019
Fig 6 with image from Ye et al., 2019
whole organism wholly ventralized, abnormal AB + MO1-chrd Fig. S6 with image from Moreno-Ayala et al., 2015
Fig. 4 with image from Kapp et al., 2013
Fig. 3 with image from Chen et al., 2012
Fig. 8 from Zhong et al., 2011
Fig. 7 with image,  Fig. 8 with image from Branam et al., 2010
Fig. 3 with image,  Fig. 4 with image from Zhang et al., 2010
Fig. 7 with image from Dixon Fox et al., 2009
Fig. 3 with image,  Fig. 7 with image,  Fig. 8 with image from Dal-Pra et al., 2006
whole organism ventral region szl expression increased distribution, abnormal AB + MO1-chrd Fig 6 with image from Ye et al., 2019
whole organism ventral region ved expression increased distribution, abnormal AB + MO1-chrd Fig 6 with image from Ye et al., 2019
Phenotype of all Fish created by or utilizing MO1-chrd
Phenotype Fish Conditions Figures
notochord truncated, abnormal AB + MO1-chrd standard conditions Fig. 7 with image from Dixon Fox et al., 2009
whole organism ventral region ved expression increased distribution, abnormal AB + MO1-chrd standard conditions Fig 6 with image from Ye et al., 2019
whole organism wholly ventralized, abnormal AB + MO1-chrd standard conditions Fig. 7 with image from Dixon Fox et al., 2009
pancreatic B cell increased amount, abnormal AB + MO1-chrd standard conditions Fig. 2 from Song et al., 2007
notochord decreased width, abnormal AB + MO1-chrd standard conditions Fig. 7 with image from Dixon Fox et al., 2009
whole organism ventral region szl expression increased distribution, abnormal AB + MO1-chrd standard conditions Fig 6 with image from Ye et al., 2019
whole organism ventralized, abnormal AB + MO1-chrd standard conditions Fig 6 with image from Ye et al., 2019
head decreased size, abnormal AB + MO1-chrd standard conditions Fig. 7 with image from Dixon Fox et al., 2009
intermediate cell mass of mesoderm increased size, abnormal TL + MO1-chrd standard conditions Fig. 2 from Kamachi et al., 2008
post-vent region increased size, abnormal TL + MO1-chrd standard conditions Fig. 2 from Kamachi et al., 2008
brain anterior region decreased size, abnormal TL + MO1-chrd standard conditions Fig. 2 from Kamachi et al., 2008
post-vent region increased size, abnormal TL + MO1-chrd + MO2-chrd standard conditions Fig. 2 from Kamachi et al., 2008
brain anterior region decreased size, abnormal TL + MO1-chrd + MO2-chrd standard conditions Fig. 2 from Kamachi et al., 2008
intermediate cell mass of mesoderm increased size, abnormal TL + MO1-chrd + MO2-chrd standard conditions Fig. 2 from Kamachi et al., 2008
dorsal/ventral pattern formation disrupted, abnormal WT + MO1-chrd standard conditions Fig. 7 with image from Branam et al., 2010
Fig. 8 with image from Dal-Pra et al., 2006
primitive heart tube inverted, abnormal WT + MO1-chrd standard conditions Fig. 5 with image from Aamar et al., 2010
Kupffer's vesicle inverted, abnormal WT + MO1-chrd standard conditions Fig. 6 with image from Aamar et al., 2010
determination of left/right symmetry disrupted, abnormal WT + MO1-chrd standard conditions Fig. 6 with image from Aamar et al., 2010
Kupffer's vesicle bilateral, abnormal WT + MO1-chrd standard conditions Fig. 6 with image from Aamar et al., 2010
post-vent region increased size, abnormal WT + MO1-chrd standard conditions Fig. 5 with image from Xie et al., 2011
somite U-shaped, abnormal WT + MO1-chrd standard conditions Fig. 5 with image from Griepenburg et al., 2015
Fig. 5 with image from Xie et al., 2011
neural plate decreased length, abnormal WT + MO1-chrd standard conditions Fig. 4 with image from Dal-Pra et al., 2006
median fin fold increased amount, abnormal WT + MO1-chrd standard conditions Fig. 5 with image from Xie et al., 2011
Kupffer's vesicle decreased size, abnormal WT + MO1-chrd standard conditions Fig. 6 with image from Aamar et al., 2010
post-vent region apoptotic, abnormal WT + MO1-chrd standard conditions Fig. 5 with image from Robu et al., 2007
primitive heart tube bilateral, abnormal WT + MO1-chrd standard conditions Fig. 5 with image from Aamar et al., 2010
whole organism ventralized, abnormal WT + MO1-chrd control Figure 4 with image from Cheng et al., 2019
determination of heart left/right asymmetry disrupted, abnormal WT + MO1-chrd standard conditions Fig. 5 with image from Aamar et al., 2010
forerunner cell group decreased size, abnormal WT + MO1-chrd standard conditions Fig. 7 with image from Aamar et al., 2010
heart looping disrupted, abnormal WT + MO1-chrd standard conditions Fig. S4 with image from Aamar et al., 2010
blood island size, abnormal WT + MO1-chrd standard conditions Fig. 5 with image from Griepenburg et al., 2015
whole organism wholly ventralized, abnormal WT + MO1-chrd standard conditions Fig. 4 with image from Kapp et al., 2013
Fig. 8 from Zhong et al., 2011
Fig. 7 with image from Branam et al., 2010
Fig. 3 with image,  Fig. 4 with image from Zhang et al., 2010
Fig. 3 with image,  Fig. 7 with image,  Fig. 8 with image from Dal-Pra et al., 2006
post-vent region wholly ventralized, abnormal WT + MO1-chrd standard conditions Fig. 2 with image from Esterberg et al., 2009
neural plate decreased thickness, abnormal WT + MO1-chrd standard conditions Fig. 4 with image from Dal-Pra et al., 2006
head decreased size, abnormal WT + MO1-chrd standard conditions Fig. 8 with image from Dal-Pra et al., 2006
determination of left/right asymmetry in lateral mesoderm disrupted, abnormal WT + MO1-chrd standard conditions Fig. 4 with image from Aamar et al., 2010
otic vesicle decreased size, abnormal WT + MO1-chrd standard conditions Fig. 4 with image from Dal-Pra et al., 2006
dorsal/ventral pattern formation disrupted, abnormal WT + MO1-chrd + MO4-tp53 standard conditions Fig. 8 with image from Branam et al., 2010
post-vent region bent, abnormal WT + MO1-chrd + MO4-tp53 standard conditions Fig. 8 with image from Branam et al., 2010
post-vent region apoptotic, abnormal WT + MO1-chrd + MO4-tp53 standard conditions Fig. 5 with image from Robu et al., 2007
whole organism wholly ventralized, abnormal WT + MO1-chrd + MO4-tp53 standard conditions Fig. S6 with image from Moreno-Ayala et al., 2015
Fig. 8 with image from Branam et al., 2010
whole organism wholly ventralized, abnormal t32231Tg + MO1-chrd standard conditions Fig. 3 with image from Chen et al., 2012
pancreatic B cell decreased amount, abnormal hnf1bahi2169Tg/hi2169Tg + MO1-chrd standard conditions Fig. 2 from Song et al., 2007
whole organism ventralized, exacerbated marcksbihb199/ihb199 + MO1-chrd standard conditions Fig 6 with image from Ye et al., 2019
whole organism ventral region ved expression increased distribution, abnormal marcksbihb199/ihb199 + MO1-chrd standard conditions Fig 6 with image from Ye et al., 2019
whole organism ventral region szl expression increased distribution, abnormal marcksbihb199/ihb199 + MO1-chrd standard conditions Fig 6 with image from Ye et al., 2019
notochord decreased width, abnormal AB + MO1-chrd + MO1-gsc standard conditions Fig. 7 with image from Dixon Fox et al., 2009
head decreased size, abnormal AB + MO1-chrd + MO1-gsc standard conditions Fig. 7 with image from Dixon Fox et al., 2009
notochord truncated, abnormal AB + MO1-chrd + MO1-gsc standard conditions Fig. 7 with image from Dixon Fox et al., 2009
whole organism wholly ventralized, abnormal AB + MO1-chrd + MO1-gsc standard conditions Fig. 7 with image from Dixon Fox et al., 2009
dorsal convergence disrupted, abnormal WT + MO1-cdh2 + MO1-chrd standard conditions Fig. 6 with image from von der Hardt et al., 2007
lateral mesoderm mislocalised, abnormal WT + MO1-cdh2 + MO1-chrd standard conditions Fig. 6 with image from von der Hardt et al., 2007
dorsal/ventral pattern formation disrupted, abnormal WT + MO1-chrd + MO1-fstl1b standard conditions Fig. 8 with image from Dal-Pra et al., 2006
whole organism wholly ventralized, abnormal WT + MO1-chrd + MO1-fstl1b standard conditions Fig. 8 with image from Dal-Pra et al., 2006
head decreased size, abnormal WT + MO1-chrd + MO1-fstl1b standard conditions Fig. 8 with image from Dal-Pra et al., 2006
dorsal/ventral pattern formation disrupted, abnormal WT + MO1-chrd + MO1-nog1 standard conditions Fig. 8 with image from Dal-Pra et al., 2006
head anterior region agenesis, abnormal WT + MO1-chrd + MO1-nog1 standard conditions Fig. 3 with image from Dal-Pra et al., 2006
head decreased size, abnormal WT + MO1-chrd + MO1-nog1 standard conditions Fig. 8 with image from Dal-Pra et al., 2006
neural plate decreased length, abnormal WT + MO1-chrd + MO1-nog1 standard conditions Fig. 4 with image from Dal-Pra et al., 2006
head anterior region truncated, abnormal WT + MO1-chrd + MO1-nog1 standard conditions Fig. 3 with image from Dal-Pra et al., 2006
whole organism wholly ventralized, abnormal WT + MO1-chrd + MO1-nog1 standard conditions Fig. 3 with image from Zhang et al., 2010
Fig. 3 with image,  Fig. 7 with image,  Fig. 8 with image from Dal-Pra et al., 2006
neural plate decreased thickness, abnormal WT + MO1-chrd + MO1-nog1 standard conditions Fig. 4 with image from Dal-Pra et al., 2006
otic vesicle mislocalised medially, abnormal WT + MO1-chrd + MO1-nog1 standard conditions Fig. 4 with image from Dal-Pra et al., 2006
otic vesicle decreased size, abnormal WT + MO1-chrd + MO1-nog1 standard conditions Fig. 4 with image from Dal-Pra et al., 2006
whole organism wholly ventralized, abnormal WT + MO1-chrd + MO1-zmiz2 + MO4-tp53 standard conditions Fig. S6 with image from Moreno-Ayala et al., 2015
post-vent region increased thickness, abnormal WT + MO1-chrd + MO2-chrdl2 standard conditions Fig. 7 with image from Branam et al., 2010
blood circulation disrupted, abnormal WT + MO1-chrd + MO2-chrdl2 standard conditions Fig. 7 with image from Branam et al., 2010
whole organism wholly ventralized, abnormal WT + MO1-chrd + MO2-chrdl2 standard conditions Fig. 7 with image,  Fig. 8 with image from Branam et al., 2010
dorsal/ventral pattern formation disrupted, abnormal WT + MO1-chrd + MO2-chrdl2 standard conditions Fig. 7 with image from Branam et al., 2010
head morphology, abnormal WT + MO1-chrd + MO2-chrdl2 standard conditions Fig. 7 with image from Branam et al., 2010
head decreased size, abnormal WT + MO1-chrd + MO2-chrdl2 standard conditions Fig. 7 with image from Branam et al., 2010
dorsal/ventral pattern formation disrupted, abnormal WT + MO1-chrd + MO2-chrdl2 + MO4-tp53 standard conditions Fig. 8 with image from Branam et al., 2010
whole organism wholly ventralized, abnormal WT + MO1-chrd + MO2-chrdl2 + MO4-tp53 standard conditions Fig. 8 with image from Branam et al., 2010
head decreased size, abnormal WT + MO1-chrd + MO2-igfbp3 standard conditions Fig. 8 from Zhong et al., 2011
hematopoietic system increased size, abnormal WT + MO1-chrd + MO2-igfbp3 standard conditions Fig. 8 from Zhong et al., 2011
post-vent region increased size, abnormal WT + MO1-chrd + MO2-igfbp3 standard conditions Fig. 8 from Zhong et al., 2011
whole organism wholly ventralized, abnormal WT + MO1-chrd + MO2-igfbp3 standard conditions Fig. 8 from Zhong et al., 2011
whole organism wholly ventralized, abnormal WT + MO1-chrd + MO2-nog1 standard conditions text only from Dal-Pra et al., 2006
Kupffer's vesicle bilateral, abnormal WT + MO1-chrd + MO2-sox17 standard conditions Fig. 6 with image from Aamar et al., 2010
Kupffer's vesicle decreased size, abnormal WT + MO1-chrd + MO2-sox17 standard conditions Fig. 6 with image from Aamar et al., 2010
determination of left/right symmetry disrupted, abnormal WT + MO1-chrd + MO2-sox17 standard conditions Fig. 6 with image from Aamar et al., 2010
Kupffer's vesicle inverted, abnormal WT + MO1-chrd + MO2-sox17 standard conditions Fig. 6 with image from Aamar et al., 2010
whole organism wholly ventralized, abnormal WT + MO1-chrd + MO3-bmper standard conditions Fig. 3 with image from Zhang et al., 2010
head decreased size, abnormal WT + MO1-chrd + MO3-chrdl2 standard conditions Fig. 7 with image from Branam et al., 2010
post-vent region increased thickness, abnormal WT + MO1-chrd + MO3-chrdl2 standard conditions Fig. 7 with image from Branam et al., 2010
head morphology, abnormal WT + MO1-chrd + MO3-chrdl2 standard conditions Fig. 7 with image from Branam et al., 2010
blood circulation disrupted, abnormal WT + MO1-chrd + MO3-chrdl2 standard conditions Fig. 7 with image from Branam et al., 2010
whole organism wholly ventralized, abnormal WT + MO1-chrd + MO3-chrdl2 standard conditions Fig. 7 with image from Branam et al., 2010
whole organism wholly ventralized, abnormal WT + MO1-chrd + MO3-wnt8a + MO5-wnt8a standard conditions Fig. 4 with image from Kapp et al., 2013
otic vesicle formation process quality, abnormal WT + MO1-chrd + MO6-fsta standard conditions Fig. 2 with image from Kwon et al., 2009
otic placode formation process quality, abnormal WT + MO1-chrd + MO6-fsta standard conditions Fig. 2 with image from Kwon et al., 2009
otic vesicle decreased size, abnormal WT + MO1-chrd + MO6-fsta standard conditions Fig. 2 with image from Kwon et al., 2009
otic vesicle formation process quality, abnormal fgf8ati282a/ti282a + MO1-chrd + MO6-fsta standard conditions Fig. 2 with image from Kwon et al., 2009
otic placode formation process quality, abnormal fgf8ati282a/ti282a + MO1-chrd + MO6-fsta standard conditions Fig. 2 with image from Kwon et al., 2009
whole organism cytolysis increased occurrence, abnormal TL + MO1-chrd + MO1-fstl1b + MO1-nog1 standard conditions Fig. 4 with image from Langdon et al., 2016
whole organism wholly ventralized, abnormal TL + MO1-chrd + MO1-fstl1b + MO1-nog1 standard conditions Fig. 4 with image from Langdon et al., 2016
whole organism wholly dorsalized, abnormal WT + MO1-bmp1a + MO1-chrd + MO1-tll1 standard conditions Fig. 4 with image from Zhang et al., 2010
whole organism wholly ventralized, abnormal WT + MO1-chrd + MO1-fstl1b + MO1-nog1 standard conditions Fig. 2 with image from Kapp et al., 2013
Fig. 8 with image from Dal-Pra et al., 2006
dorsal/ventral pattern formation disrupted, abnormal WT + MO1-chrd + MO1-fstl1b + MO1-nog1 standard conditions Fig. 8 with image from Dal-Pra et al., 2006
head decreased size, abnormal WT + MO1-chrd + MO1-fstl1b + MO1-nog1 standard conditions Fig. 8 with image from Dal-Pra et al., 2006
trigeminal placode decreased size, abnormal WT + MO1-chrd + MO2-bmper + MO6-fsta standard conditions Fig. 3 with image from Kwon et al., 2009
otic placode formation process quality, abnormal WT + MO1-chrd + MO2-bmper + MO6-fsta standard conditions Fig. 2 with image from Kwon et al., 2009
otic vesicle decreased size, abnormal WT + MO1-chrd + MO2-bmper + MO6-fsta standard conditions Fig. 2 with image from Kwon et al., 2009
otic vesicle malformed, abnormal WT + MO1-chrd + MO2-bmper + MO6-fsta standard conditions Fig. 2 with image from Kwon et al., 2009
otic vesicle formation process quality, abnormal WT + MO1-chrd + MO2-bmper + MO6-fsta standard conditions Fig. 2 with image from Kwon et al., 2009
inner ear lacks all parts of type otolith, abnormal WT + MO1-chrd + MO2-bmper + MO6-fsta standard conditions Fig. 2 with image from Kwon et al., 2009
post-vent region wholly ventralized, abnormal WT + MO1-chrd + MO5-dlx3b + MO5-dlx4b standard conditions Fig. 2 with image from Esterberg et al., 2009
intermediate cell mass of mesoderm increased size, abnormal WT + MO1-chrd + MO5-dlx3b + MO5-dlx4b standard conditions Fig. 2 with image from Esterberg et al., 2009
whole organism cytolysis increased occurrence, abnormal ctsbap24bdth/+ + MO1-chrd + MO1-fstl1b + MO1-nog1 (TL) standard conditions Fig. 4 with image from Langdon et al., 2016
whole organism wholly dorsalized, ameliorated ctsbap24bdth/+ + MO1-chrd + MO1-fstl1b + MO1-nog1 (TL) standard conditions Fig. 4 with image from Langdon et al., 2016
whole organism wholly ventralized, abnormal ctsbap24bdth/+ + MO1-chrd + MO1-fstl1b + MO1-nog1 (TL) standard conditions Fig. 4 with image from Langdon et al., 2016
otic vesicle formation process quality, abnormal fgf8ati282a/ti282a + MO1-chrd + MO2-bmper + MO6-fsta standard conditions Fig. 2 with image from Kwon et al., 2009
otic placode formation process quality, abnormal fgf8ati282a/ti282a + MO1-chrd + MO2-bmper + MO6-fsta standard conditions Fig. 2 with image from Kwon et al., 2009
otic vesicle aplastic, abnormal fgf8ati282a/ti282a + MO1-chrd + MO2-bmper + MO6-fsta standard conditions Fig. 2 with image from Kwon et al., 2009
whole organism wholly ventralized, abnormal Df(Chr25:szl)m60/m60 + MO1-chrd (HK) standard conditions Fig. 1 with image from Dal-Pra et al., 2006
whole organism wholly ventralized, abnormal ints6p18ahub + MO1-chrd (AB/TU) standard conditions Fig. 4 with image from Kapp et al., 2013
whole organism wholly dorsalized, abnormal ints6p18ahub + MO1-chrd + MO3-wnt8a + MO5-wnt8a (AB/TU) standard conditions Fig. 4 with image from Kapp et al., 2013
whole organism wholly ventralized, abnormal ints6p18ahub + MO1-chrd + MO1-fstl1b + MO1-nog1 (AB/TU) standard conditions Fig. 2 with image from Kapp et al., 2013
whole organism wholly ventralized, abnormal brsb2; ctnnb2p1/p1 + MO1-chrd standard conditions Fig. 3 with image from Varga et al., 2007
post-vent region morphology, abnormal brsb2; ctnnb2p1/p1 + MO1-chrd standard conditions Fig. 3 with image from Varga et al., 2007
dorsal/ventral axis specification decreased process quality, ameliorated pou5f3m793/+; sox19bm1434/+ + MO1-chrd standard conditions Fig. 2 with image from Gao et al., 2022
whole organism wholly ventralized, abnormal brsb2; ctnnb2p1/p1 + MO1-chrd + MO1-ctnnb2 + MO2-ctnnb1 standard conditions Fig. 3 with image from Varga et al., 2007
post-vent region morphology, abnormal brsb2; ctnnb2p1/p1 + MO1-chrd + MO1-ctnnb2 + MO2-ctnnb1 standard conditions Fig. 3 with image from Varga et al., 2007
dorsal/ventral axis specification decreased process quality, ameliorated pou5f3m793/+; sox19bm1434/+ + MO1-chrd + MO1-nog1 standard conditions Fig. 2 with image from Gao et al., 2022
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.