Morpholino

MO1-tfg

ID
ZDB-MRPHLNO-240103-1
Name
MO1-tfg
Previous Names
  • tfg-ATG-MO (1)
Target
Sequence
5' - CATTCATACTGCTGGTGTTTTGGAC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-tfg
Phenotype
Phenotype resulting from MO1-tfg
Phenotype Fish Figures
brain apoptotic process increased process quality, abnormal ml2Tg + MO1-tfg FIGURE 4 with image from Chen et al., 2022
motor neuron axon GFP expression decreased distribution, abnormal ml2Tg + MO1-tfg FIGURE 4 with image from Chen et al., 2022
motor neuron axon decreased length, abnormal ml2Tg + MO1-tfg FIGURE 4 with image from Chen et al., 2022
post-vent region curved, abnormal ml2Tg + MO1-tfg FIGURE 4 with image from Chen et al., 2022
spinal cord GFP expression decreased distribution, abnormal ml2Tg + MO1-tfg FIGURE 4 with image from Chen et al., 2022
spinal cord apoptotic process increased process quality, abnormal ml2Tg + MO1-tfg FIGURE 4 with image from Chen et al., 2022
swimming behavior decreased process quality, abnormal ml2Tg + MO1-tfg FIGURE 5 with image from Chen et al., 2022
whole organism axin1 expression increased amount, abnormal WT + MO1-tfg FIGURE 6 with image from Chen et al., 2022
whole organism fzd7a expression increased amount, abnormal WT + MO1-tfg FIGURE 6 with image from Chen et al., 2022
whole organism fzd7b expression increased amount, abnormal WT + MO1-tfg FIGURE 6 with image from Chen et al., 2022
whole organism wnt9a expression increased amount, abnormal WT + MO1-tfg FIGURE 6 with image from Chen et al., 2022
whole organism axin2 expression increased amount, abnormal WT + MO1-tfg FIGURE 6 with image from Chen et al., 2022
whole organism lef1 expression increased amount, abnormal WT + MO1-tfg FIGURE 6 with image from Chen et al., 2022
whole organism wnt8a expression increased amount, abnormal WT + MO1-tfg FIGURE 6 with image from Chen et al., 2022
whole organism lrp6 expression increased amount, abnormal WT + MO1-tfg FIGURE 6 with image from Chen et al., 2022
whole organism lrp5 expression increased amount, abnormal WT + MO1-tfg FIGURE 6 with image from Chen et al., 2022
whole organism mycn expression increased amount, abnormal WT + MO1-tfg FIGURE 6 with image from Chen et al., 2022
whole organism myca expression increased amount, abnormal WT + MO1-tfg FIGURE 6 with image from Chen et al., 2022
whole organism ctnnb1 expression increased amount, abnormal WT + MO1-tfg FIGURE 6 with image from Chen et al., 2022
whole organism viability, abnormal ml2Tg + MO1-tfg FIGURE 5 with image from Chen et al., 2022
Phenotype of all Fish created by or utilizing MO1-tfg
Phenotype Fish Conditions Figures
whole organism wnt8a expression increased amount, abnormal WT + MO1-tfg control FIGURE 6 with image from Chen et al., 2022
whole organism lrp5 expression increased amount, abnormal WT + MO1-tfg control FIGURE 6 with image from Chen et al., 2022
whole organism myca expression increased amount, abnormal WT + MO1-tfg control FIGURE 6 with image from Chen et al., 2022
whole organism mycn expression increased amount, abnormal WT + MO1-tfg control FIGURE 6 with image from Chen et al., 2022
whole organism axin1 expression increased amount, abnormal WT + MO1-tfg control FIGURE 6 with image from Chen et al., 2022
whole organism lef1 expression increased amount, abnormal WT + MO1-tfg control FIGURE 6 with image from Chen et al., 2022
whole organism fzd7a expression increased amount, abnormal WT + MO1-tfg control FIGURE 6 with image from Chen et al., 2022
whole organism ctnnb1 expression increased amount, abnormal WT + MO1-tfg control FIGURE 6 with image from Chen et al., 2022
whole organism wnt9a expression increased amount, abnormal WT + MO1-tfg control FIGURE 6 with image from Chen et al., 2022
whole organism lrp6 expression increased amount, abnormal WT + MO1-tfg control FIGURE 6 with image from Chen et al., 2022
whole organism axin2 expression increased amount, abnormal WT + MO1-tfg control FIGURE 6 with image from Chen et al., 2022
whole organism fzd7b expression increased amount, abnormal WT + MO1-tfg control FIGURE 6 with image from Chen et al., 2022
brain apoptotic process increased process quality, abnormal ml2Tg + MO1-tfg control FIGURE 4 with image from Chen et al., 2022
whole organism viability, abnormal ml2Tg + MO1-tfg control FIGURE 5 with image from Chen et al., 2022
swimming behavior decreased process quality, abnormal ml2Tg + MO1-tfg control FIGURE 5 with image from Chen et al., 2022
spinal cord apoptotic process increased process quality, abnormal ml2Tg + MO1-tfg control FIGURE 4 with image from Chen et al., 2022
motor neuron axon GFP expression decreased distribution, abnormal ml2Tg + MO1-tfg control FIGURE 4 with image from Chen et al., 2022
spinal cord GFP expression decreased distribution, abnormal ml2Tg + MO1-tfg control FIGURE 4 with image from Chen et al., 2022
motor neuron axon decreased length, abnormal ml2Tg + MO1-tfg control FIGURE 4 with image from Chen et al., 2022
post-vent region curved, abnormal ml2Tg + MO1-tfg control FIGURE 4 with image from Chen et al., 2022
Citations