hp689 is a novel zebrafish gene encoding usp39.

A, B, E, F: Whole-mount in situ hybridization with pomc probe at 48 hpf, ventral view with anterior to left. (A) Wild-type (wt) embryo, pomc is expressed in the rostral pars distalis (black arrow), the pars intermedia (the red arrow), and in the β-endorphin-synthesizing neurons of the hypothalamus (asterisk). The medial domain which lacks pomc expression corresponds to the proximal pars distalis. (B) The hp689 mutant exhibits increased pomc expression in the adenohypophysis, and lower expression in the hypothalamus compared to wt. (C) Genomic map of linkage group 5 (LG5) and position of the hp689 mutation (in red) and mapping markers based on meiotic segregation linkage analysis. hp689 mapped close to markers z34450 and ndrg3 that were located 2.4 cM and 0.3 cM, respectively (see Materials and Methods). (D) Schematic representation of the Usp39 protein, which include a zinc finger and ubiquitin carboxyl-terminal hydrolases family 2 domains with the hp689 mutation from a tyrosine to a stop codon indicated in red. (E) Non-injected wt control embryos. (F) wt embryos injected with usp39 MO. Note increased pomc expression and disorganization of the adenohypophysis similar to the increased expression of pomc in usp39 mutant embryos in (B).

Whole-mount in situ hybridization analysis of the zebrafish usp39 expression pattern.

Embryonic ages are shown in the lower right corner, lateral view. A–C: Expression of usp39 in wt is found in the brain and eye region. (A) Inset shows additional usp39 expression in the intermediate cell mass, site of embryonic zebrafish hematopoiesis. (B) usp39 expression is highest at 36 hpf. (C) usp39 expression declines by 42 hpf. (D) The expression pattern of usp39 in usp39 mutants is lower in all stages; expression at 42 hpf is depicted.

usp39 mutation lead to expansion of all pituitary cell lineages at 48 hpf as indicated by pituitary hormone markers.

A–L: Whole-mount double in situ hybridization with probes indicated on the side. usp39 mutant embryos exhibit higher expression of all pituitary hormone markers compared to wild-type (wt) embryos. Spatial distribution of prl, tsh, pomc and cga are normal in the usp39 mutant. (A, B, E, F, I, J, M, and N) ventral view and (C, D, G, H, K, L, O, and P) lateral view, with anterior to the left. Columns 1 (A, E, I, and M) and 3 (C, G, K and O) show wt siblings; columns 2 (B, F, J, and N) and 4 (D, H, L, and P) show usp39 mutant embryos. A–D: gh (purple) and prl (red) transcripts. (C) The spatial distribution of gh is normally found in the proximal pars distalis (white arrow) and prl is found in the rostral pars distalis (black arrow). (D) Note the spatial distribution of gh in the usp39 mutant; gh is abnormally expressed in the rostral pars distalis (black arrow). E–H: tsh (purple) and pomc (red) transcripts. I–L: prl (purple) and pomc (red) transcripts. M–P: Whole-mount in situ hybridization with cga transcript.

The hypothalamic releasing hormone and dopamine signals are unaffected in usp39 mutants.

A–C and E–G: Whole-mount in situ hybridization with hypothalamic probes at 48 hpf, ventral view. (A–C) wild-type (wt) embryos. (E–G) usp39 mutant embryos. Expression of hypothalamic markers crh, gnrh2, and gnrh3 did not change. D and H: Immunocytochemistry with tyrosine hydroxylase (TH) antibody at 48 hpf, ventral view. (H) Expression of TH in usp39 mutant embryos did not change.

Loss of usp39 leads to pituitary expansion as indicated by increased expression of pituitary transcription factors.

A–F and G–J: Single and double in situ hybridization with probes indicated on the side, at 48 hpf, ventral view, anterior to the left. (A, C, E, G, and I) wild-type (wt) embryos. (B, D, F, H, and J) usp39 mutant embryos have increased pituitary expression of pit1, lim3, pitx3, eya1, and ascl1a.

Loss of usp39 leads to aberrant Rb1 mRNA splicing and increased pituitary e2f4 expression.

A,B: Whole-mount double in situ hybridization of pomc in red and e2f4 in purple at 48 hpf, lateral view. (A) Wild-type (wt) embryo. (B) Expression of e2f4 is higher and colocalizes with pomc expression in usp39 mutant embryos. C–E and G–I: Whole-mount in situ hybridization of pomc at 48 hpf, ventral view, anterior to left. (C) wt. (D) usp39 mutant. (E) e2f4-MO-injected usp39 mutant embryos showed partial pomc rescue similar to observed in wt embryonic pomc expression (C). F: PCR product with primers designed for region between exon 3 and exon 4 of rb1 in wt and usp39 mutant embryos. wt embryos only contain a 250 base pair (bp) PCR band, indicating that the intron was correctly spliced out. However, in the usp39 mutants there is an additional 343 bp band that contains the intron sequence. G–I: (G) wt. (H) usp39 mutant. (I) rb1 mRNA-injected usp39 mutants exhibit partial rescue of pomc expression similar to wt embryos (G).

lim3 expression is not altered at 36 hpf. (A, B) Whole-mount in situ hybridization with lim3 probe, ventral view with anterior to left. (A) wild-type (wt). (B) Expression of lim3 in usp39 mutant embryos is not changed compared to wt embryos at 36 hpf.

Increase in pituitary cell number in usp39 mutants compared to wt embryos. Immunocytochemistry using anti-GFP antibody was performed on 5 µm frontal sections of wt and usp39 mutants with a POMC-GFP transgenic background at 48 hpf, ventral view, anterior on top. The anti-GFP, rabbit IgG fraction, Alexa Fluor 488 conjugated antibody are at 1:200 dilution (Invitrogen). A drop of ProLong Gold antifade reagent with DAPI (Invitrogen) was added to sections and coverslipped. (A, B) All pituitary POMC-GFP-positive cells are included in two sequential sections of the wild-type embryos. (C–E) Three sections are required to include all pituitary POMC-GFP positive cells in usp39 mutant embryos. (F) Four wt and four usp39 mutants were analyzed for POMC-GFP-positive cells. usp39 mutants had an average of 25.5 POMC-GFP-positive cells compare to 12.5 in wt embryos (mean ± SEM; p<0.02, n = 4). (G) To determine the total number of pituitary cells, DAPI positive cells were counted in the same sections of the four wt and four usp39 mutants. usp39 mutants had an average of 123.5 DAPI-positive cells in the pituitary compare to 48.25 in wt embryos (mean ± SEM; p<0.03, n = 4). (H–I) Embryos were placed in 10 mM solution of BrdU (Sigma) in fish water at 10-somite stage and kept in dark until 48 hpf. The embryos were also injected with 10 nl of 10 mM Brdu at 24 hfp. BrdU labeling results in 48 hpf embryos by immunocytochemistry using anti-GFP antibody and anti-BrdU was performed in whole-mount embryos as described in [Liu et al]. The anti-GFP, rabbit IgG fraction and Alexa Fluor 488 secondary antibody are at 1:200 dilution (Invitrogen). The anti-BrdU, mouse IgG fraction (Santa Cruz) and Alexa Fluor 594 secondary antibody (Invitrogen) are at 1:100 and 1:200 dilution, respectively. Imaging was performed on vibratome 100 μm sections of wt and usp39 mutant embryos. (H) Proliferating cells in the pituitary were not evident in wt embryos. (I) usp39 mutant embryos contain a higher number of proliferating cells in the pituitary region marked by white arrowheads. [Liu NA, Ren M, Song J, Rios Y, Wawrowsky K, et al. (2008) In vivo time-lapse imaging delineates the zebrafish pituitary proopiomelanocortin lineage boundary regulated by FGF3 signal. Dev Biol.]

e2f4 morpholino injections rescued prl expression in usp39 mutants. (A–C) Whole-mount in situ hybridization with prl probe, ventral view with anterior to left. (A) wt. (B) usp39 mutant embryo. (C) Expression of prl in e2f4-MO-injected usp39 embryos was partially rescued.

otx2 splicing defect in usp39 mutants. (A, B) Whole-mount in situ hybridization of otx2 at 48 hpf, ventral view, anterior to left. (A) wt. (B) Expression of otx2 is downregulated in usp39 mutants. (C) PCR product with primers designed for a region between exon 3 and exon 4 of otx2 in wt and usp39 mutant embryos. In addition to the 79 bp band in wt, the usp39 mutant embryos contain an additional 289 bp band, which corresponds to a mispliced mRNA fragment including the intron between exon 3 and 4. The primers used were: GGCCTTGAAAATCAACTTGC and CTGCTGTTGGCGACACTTT.