Image
Figure Caption
Fig. S6 otx2 splicing defect in usp39 mutants. (A, B) Whole-mount in situ hybridization of otx2 at 48 hpf, ventral view, anterior to left. (A) wt. (B) Expression of otx2 is downregulated in usp39 mutants. (C) PCR product with primers designed for a region between exon 3 and exon 4 of otx2 in wt and usp39 mutant embryos. In addition to the 79 bp band in wt, the usp39 mutant embryos contain an additional 289 bp band, which corresponds to a mispliced mRNA fragment including the intron between exon 3 and 4. The primers used were: GGCCTTGAAAATCAACTTGC and CTGCTGTTGGCGACACTTT.
Acknowledgments
This image is the copyrighted work of the attributed author or publisher, and
ZFIN has permission only to display this image to its users.
Additional permissions should be obtained from the applicable author or publisher of the image.
Full text @ PLoS Genet.