Morpholino

MO1-prkci

ID
ZDB-MRPHLNO-060118-3
Name
MO1-prkci
Previous Names
  • hasMO (1)
Target
Sequence
5' - TGTCCCGCAGCGTGGGCATTATGGA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-prkci
Phenotype
Phenotype resulting from MO1-prkci
Phenotype Fish Figures
amacrine cell spatial pattern, abnormal knu3Tg + MO1-prkci Fig. 3 from Cui et al., 2007
camera-type eye photoreceptor cell differentiation decreased occurrence, abnormal AB/EKW + MO1-prkci Fig. 9 with image from Krock et al., 2014
dorsal motor nucleus of vagus nerve development disrupted, abnormal WT + MO1-prkci Fig. 3 with image from Ohata et al., 2011
dorsolateral motor nucleus of vagal nerve malformed, abnormal WT + MO1-prkci Fig. 3 with image from Ohata et al., 2011
eye photoreceptor cell apical region decreased length, abnormal AB/EKW + MO1-prkci Fig. 8 with image from Krock et al., 2014
heart morphology, abnormal WT + MO1-prkci Fig. 7 with image from Serluca, 2008
heart morphogenesis process quality, abnormal twu34Tg + MO1-prkci Fig. 3 from Rohr et al., 2008
maintenance of epithelial cell apical/basal polarity disrupted, abnormal WT + MO1-prkci Fig. 3 with image from Ohata et al., 2011
mitotic cell cycle process quality, abnormal WT + MO1-prkci Fig. 3 from Cui et al., 2007
neuroepithelial cell cell-cell junction broken, abnormal WT + MO1-prkci Fig. 3 with image from Ohata et al., 2011
peridermal cell actin-based cell projection decreased length, abnormal TU + MO1-prkci Fig. 1 with image from Raman et al., 2016
peridermal cell actin-based cell projection increased length, abnormal TU + MO1-prkci Fig. 1 with imageFig. 5 with image from Raman et al., 2016
photoreceptor cell morphogenesis decreased process quality, abnormal AB/EKW + MO1-prkci Fig. 8 with image from Krock et al., 2014
pigmented epithelial cell shape, abnormal WT + MO1-prkci Fig. 2 from Cui et al., 2007
pigmented epithelial cell pigment granule mislocalised, abnormal WT + MO1-prkci Fig. 2 from Cui et al., 2007
podocyte cell migration decreased process quality, abnormal TU + MO1-prkci Fig. 3 with image from Gerlach et al., 2014
pronephric podocyte mislocalised laterally, abnormal TU + MO1-prkci Fig. 3 with image from Gerlach et al., 2014
pronephric proximal convoluted tubule malformed, abnormal TU + MO1-prkci Fig. 3 with image from Gerlach et al., 2014
pronephric proximal tubule morphogenesis decreased process quality, abnormal TU + MO1-prkci Fig. 3 with image from Gerlach et al., 2014
retina has fewer parts of type retinal rod cell, abnormal AB/EKW + MO1-prkci Fig. 9 with image from Krock et al., 2014
retina neuroepithelial cell positional polarity, abnormal kca66Tg; kca6Tg + MO1-prkci (AB) Fig. 3 from Cui et al., 2007
retinal ganglion cell layer disorganized, abnormal knu3Tg + MO1-prkci Fig. 3 from Cui et al., 2007
retinal pigmented epithelium structure, abnormal WT + MO1-prkci Fig. 4 from Cui et al., 2007
Phenotype of all Fish created by or utilizing MO1-prkci
Phenotype Fish Conditions Figures
eye photoreceptor cell apical region decreased length, abnormal AB/EKW + MO1-prkci standard conditions Fig. 8 with image from Krock et al., 2014
retina has fewer parts of type retinal rod cell, abnormal AB/EKW + MO1-prkci standard conditions Fig. 9 with image from Krock et al., 2014
photoreceptor cell morphogenesis decreased process quality, abnormal AB/EKW + MO1-prkci standard conditions Fig. 8 with image from Krock et al., 2014
camera-type eye photoreceptor cell differentiation decreased occurrence, abnormal AB/EKW + MO1-prkci standard conditions Fig. 9 with image from Krock et al., 2014
peridermal cell actin-based cell projection decreased length, abnormal TU + MO1-prkci standard conditions Fig. 1 with image from Raman et al., 2016
podocyte cell migration decreased process quality, abnormal TU + MO1-prkci standard conditions Fig. 3 with image from Gerlach et al., 2014
pronephric podocyte mislocalised laterally, abnormal TU + MO1-prkci standard conditions Fig. 3 with image from Gerlach et al., 2014
peridermal cell actin-based cell projection increased length, abnormal TU + MO1-prkci standard conditions Fig. 1 with imageFig. 5 with image from Raman et al., 2016
pronephric proximal tubule morphogenesis decreased process quality, abnormal TU + MO1-prkci standard conditions Fig. 3 with image from Gerlach et al., 2014
pronephric proximal convoluted tubule malformed, abnormal TU + MO1-prkci standard conditions Fig. 3 with image from Gerlach et al., 2014
dorsolateral motor nucleus of vagal nerve malformed, abnormal WT + MO1-prkci standard conditions Fig. 3 with image from Ohata et al., 2011
retinal pigmented epithelium structure, abnormal WT + MO1-prkci standard conditions Fig. 4 from Cui et al., 2007
dorsal motor nucleus of vagus nerve development disrupted, abnormal WT + MO1-prkci standard conditions Fig. 3 with image from Ohata et al., 2011
mitotic cell cycle process quality, abnormal WT + MO1-prkci standard conditions Fig. 3 from Cui et al., 2007
pigmented epithelial cell shape, abnormal WT + MO1-prkci standard conditions Fig. 2 from Cui et al., 2007
heart morphology, abnormal WT + MO1-prkci standard conditions Fig. 7 with image from Serluca, 2008
maintenance of epithelial cell apical/basal polarity disrupted, abnormal WT + MO1-prkci standard conditions Fig. 3 with image from Ohata et al., 2011
pigmented epithelial cell pigment granule mislocalised, abnormal WT + MO1-prkci standard conditions Fig. 2 from Cui et al., 2007
neuroepithelial cell cell-cell junction broken, abnormal WT + MO1-prkci standard conditions Fig. 3 with image from Ohata et al., 2011
amacrine cell spatial pattern, abnormal knu3Tg + MO1-prkci standard conditions Fig. 3 from Cui et al., 2007
retinal ganglion cell layer disorganized, abnormal knu3Tg + MO1-prkci standard conditions Fig. 3 from Cui et al., 2007
heart morphogenesis process quality, abnormal twu34Tg + MO1-prkci standard conditions Fig. 3 from Rohr et al., 2008
retina neuroepithelial cell positional polarity, abnormal kca66Tg; kca6Tg + MO1-prkci (AB) standard conditions Fig. 3 from Cui et al., 2007
nuclear migration disrupted, abnormal knu3Tg/knu3Tg + MO1-prkci + MO1-prkcz standard conditions Fig. 6 from Baye et al., 2007
neuroblast nucleus position, abnormal knu3Tg/knu3Tg + MO1-prkci + MO1-prkcz standard conditions Fig. 6 from Baye et al., 2007
neuroblast development disrupted, abnormal knu3Tg/knu3Tg + MO1-prkci + MO1-prkcz standard conditions Fig. 6 from Baye et al., 2007
peridermal cell actin-based cell projection length, ameliorated llgl2to6/to6 + MO1-prkci standard conditions Fig. 5 with image from Raman et al., 2016
determination of left/right asymmetry in lateral mesoderm decreased process quality, abnormal AB/EKW + MO1-pard3ab + MO1-prkci standard conditions Fig. 12 with image from Krock et al., 2014
determination of left/right asymmetry in lateral mesoderm decreased process quality, abnormal AB/EKW + MO1-prkci + MO1-prkcz standard conditions Fig. 12 with image from Krock et al., 2014
camera-type eye photoreceptor cell differentiation arrested, abnormal AB/EKW + MO1-prkci + MO1-prkcz standard conditions Fig. 8 with image from Krock et al., 2014
retina lacks all parts of type retinal cone cell, abnormal AB/EKW + MO1-prkci + MO1-prkcz standard conditions Fig. 8 with image from Krock et al., 2014
camera-type eye photoreceptor cell differentiation decreased occurrence, abnormal AB/EKW + MO1-prkci + MO1-prkcz standard conditions Fig. 9 with image from Krock et al., 2014
retina has fewer parts of type retinal rod cell, abnormal AB/EKW + MO1-prkci + MO1-prkcz standard conditions Fig. 9 with image from Krock et al., 2014
heart edematous, abnormal TU + MO1-prkci + MO1-prkcz standard conditions Fig. 6 with image from Gerlach et al., 2014
pronephric proximal convoluted tubule malformed, abnormal TU + MO1-prkci + MO1-prkcz standard conditions Fig. 5 with image from Gerlach et al., 2014
pronephros pronephric nephron tubule epithelial cell differentiation process quality, abnormal TU + MO1-prkci + MO1-prkcz standard conditions Fig. 7 with image from Gerlach et al., 2014
pronephric proximal convoluted tubule cell differentiation involved in pronephros development process quality, abnormal TU + MO1-prkci + MO1-prkcz standard conditions Fig. 8 with imageFig. 9 with image from Gerlach et al., 2014
pronephric proximal convoluted tubule apoptotic, abnormal TU + MO1-prkci + MO1-prkcz standard conditions Fig. 5 with image from Gerlach et al., 2014
pronephric proximal convoluted tubule endocytosis decreased occurrence, abnormal TU + MO1-prkci + MO1-prkcz standard conditions Fig. 6 with image from Gerlach et al., 2014
renal filtration decreased occurrence, abnormal TU + MO1-prkci + MO1-prkcz standard conditions Fig. 6 with image from Gerlach et al., 2014
pronephric proximal convoluted tubule apoptotic process increased occurrence, abnormal TU + MO1-prkci + MO1-prkcz standard conditions Fig. 5 with image from Gerlach et al., 2014
pronephric glomerulus development process quality, abnormal TU + MO1-prkci + MO1-prkcz standard conditions Fig. 7 with image from Gerlach et al., 2014
pronephric proximal tubule morphogenesis decreased process quality, abnormal TU + MO1-prkci + MO1-prkcz standard conditions Fig. 5 with image from Gerlach et al., 2014
pronephric proximal straight tubule cell differentiation involved in pronephros development process quality, abnormal TU + MO1-prkci + MO1-prkcz standard conditions Fig. 8 with image from Gerlach et al., 2014
pronephric tubule establishment of epithelial cell apical/basal polarity decreased occurrence, abnormal TU + MO1-prkci + MO1-prkcz standard conditions Fig. 3 with image from Gerlach et al., 2014
pigmented epithelial cell shape, abnormal WT + MO1-prkci + MO1-prkcz standard conditions Fig. 2 from Cui et al., 2007
mitotic cell cycle process quality, abnormal WT + MO1-prkci + MO1-prkcz standard conditions Fig. 3 from Cui et al., 2007
pigmented epithelial cell pigment granule mislocalised, abnormal WT + MO1-prkci + MO1-prkcz standard conditions Fig. 2 from Cui et al., 2007
retinal ganglion cell layer disorganized, abnormal knu3Tg + MO1-prkci + MO1-prkcz standard conditions Fig. 3 from Cui et al., 2007
cell migration process quality, abnormal knu3Tg + MO1-prkci + MO1-prkcz standard conditions Fig. 9 from Cui et al., 2007
retina cellular quality, abnormal knu3Tg + MO1-prkci + MO1-prkcz standard conditions Fig. 9 from Cui et al., 2007
amacrine cell spatial pattern, abnormal knu3Tg + MO1-prkci + MO1-prkcz standard conditions Fig. 3 from Cui et al., 2007
pronephros establishment of epithelial cell apical/basal polarity decreased occurrence, abnormal nz1Tg + MO1-prkci + MO1-prkcz standard conditions Fig. 4 with image from Gerlach et al., 2014
pronephric nephron tubule morphogenesis decreased process quality, abnormal nz1Tg + MO1-prkci + MO1-prkcz standard conditions Fig. 4 with image from Gerlach et al., 2014
retina neuroepithelial cell positional polarity, abnormal kca66Tg; kca6Tg + MO1-prkci + MO1-prkcz (AB) standard conditions Fig. 3 from Cui et al., 2007
Citations