Morpholino

MO1-gata6

ID
ZDB-MRPHLNO-050927-1
Name
MO1-gata6
Previous Names
  • zfMDL MO (1)
Target
Sequence
5' - AGCTGTTATCACCCAGGTCCATCCA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The sequence reported in Peterkin et al, 2003 is written 3' -> 5'. The sequence shown has been reversed.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-gata6
Expressed Gene Anatomy Figures
bmp4 Fig. 6 with image from Zeng et al., 2012
cp Fig. 5 with image from Shin et al., 2007
egr2b Fig. 5 with imageFig. 6 with image from Peterkin et al., 2007
foxa2 Fig. 3 with image from Tseng et al., 2011
foxa3 Fig. 3 with image from Tseng et al., 2011
foxb1a Fig. 2 with image from Tseng et al., 2011
gata4 Fig. 5 with imageFig. 6 with image from Peterkin et al., 2007
Fig. 8 from Peterkin et al., 2003
gata5 Fig. 3 with image from Tseng et al., 2011
Fig. 8 from Peterkin et al., 2003
hhex Fig. 5 with image from Shin et al., 2007
ihha Fig. 6 with image from Zeng et al., 2012
myh6 Fig. 3 with image from Holtzinger et al., 2007
myh7 Fig. 4 with image from Holtzinger et al., 2007
Fig. 4 with image from Peterkin et al., 2007
Fig. 8 from Peterkin et al., 2003
myl7 Fig. 4 with image from Peterkin et al., 2007
Fig. 8 from Peterkin et al., 2003
myod1 Fig. 5 with imageFig. 6 with image from Peterkin et al., 2007
nkx2.5 Fig. 5 with image from Holtzinger et al., 2007
Fig. 4 with imageFig. 5 with imageFig. 6 with image from Peterkin et al., 2007
Fig. 8 from Peterkin et al., 2003
prox1a Fig. 5 with image from Shin et al., 2007
sebox Fig. 3 with image from Tseng et al., 2011
shha Fig. 6 with image from Zeng et al., 2012
sox32 Fig. 2 with imageFig. 3 with image from Tseng et al., 2011
tbx16 Fig. 3 with image from Tseng et al., 2011
tfa Fig. 7 with image from Holtzinger et al., 2005
Phenotype
Phenotype resulting from MO1-gata6
Phenotype of all Fish created by or utilizing MO1-gata6
Phenotype Fish Conditions Figures
cell population proliferation increased rate, abnormal TL + MO1-gata6 standard conditions Fig. 6 with image from Zeng et al., 2012
gut immature, abnormal TL + MO1-gata6 standard conditions Fig. 6 with image from Zeng et al., 2012
heart tube malformed, abnormal WT + MO1-gata6 standard conditions Fig. 4 with imageFig. 5 with image from Peterkin et al., 2007
embryonic heart tube development disrupted, abnormal WT + MO1-gata6 standard conditions Fig. 4 with imageFig. 5 with image from Peterkin et al., 2007
heart morphogenesis disrupted, abnormal WT + MO1-gata6 standard conditions Fig. 4 with imageFig. 5 with image from Peterkin et al., 2007
heart morphogenesis process quality, abnormal knu9Tg + MO1-gata6(AB) standard conditions Fig. 2 with image from Park et al., 2009
heart hypoplastic, abnormal twu34Tg + MO1-gata6 standard conditions Fig. S4 with image from Gupta et al., 2013
heart morphogenesis decreased process quality, abnormal twu34Tg + MO1-gata6 standard conditions Fig. S4 with image from Gupta et al., 2013
heart morphogenesis disrupted, abnormal WT + MO1-gata5 + MO1-gata6 standard conditions Fig. 4 with imageFig. 5 with image from Peterkin et al., 2007
heart formation disrupted, abnormal WT + MO1-gata5 + MO1-gata6 standard conditions Fig. 3 with image from Peterkin et al., 2009
otic placode foxj1b expression decreased amount, abnormal WT + MO1-gata5 + MO1-gata6 standard conditions Fig. S3 from Jia et al., 2018
embryonic heart tube development disrupted, abnormal WT + MO1-gata5 + MO1-gata6 standard conditions Fig. 4 with imageFig. 5 with image from Peterkin et al., 2007
fin bud aplastic, abnormal WT + MO1-gata5 + MO1-gata6 standard conditions Fig. 6 with image from Peterkin et al., 2009
whole organism mir210 expression increased amount, abnormal WT + MO1-gata5 + MO1-gata6 standard conditions Fig. 2 from Jia et al., 2018
yolk syncytial layer slc3a2a expression decreased amount, abnormal WT + MO1-gata5 + MO1-gata6 standard conditions Fig. S3 from Jia et al., 2018
granulocyte mpx expression decreased amount, abnormal WT + MO1-gata5 + MO1-gata6 standard conditions Fig. 3 from Jia et al., 2018
cardioblast migration to the midline involved in heart field formation disrupted, abnormal WT + MO1-gata5 + MO1-gata6 standard conditions Fig. 3 with image from Peterkin et al., 2009
myeloid cell differentiation disrupted, abnormal WT + MO1-gata5 + MO1-gata6 standard conditions Fig. 1 with image from Peterkin et al., 2009
myeloid cell differentiation decreased occurrence, abnormal WT + MO1-gata5 + MO1-gata6 standard conditions Fig. 3 from Jia et al., 2018
heart tube malformed, abnormal WT + MO1-gata5 + MO1-gata6 standard conditions Fig. 4 with imageFig. 5 with image from Peterkin et al., 2007
anterior lateral plate mesoderm physical object quality, abnormal WT + MO1-gata6 + MO2-gata5 standard conditions Fig. 2 with image from Novikov et al., 2013
heart tube malformed, abnormal WT + MO1-gata6 + MO3-gata4 standard conditions Fig. 4 with imageFig. 5 with image from Peterkin et al., 2007
embryonic heart tube development disrupted, abnormal WT + MO1-gata6 + MO3-gata4 standard conditions Fig. 4 with imageFig. 5 with image from Peterkin et al., 2007
heart morphogenesis disrupted, abnormal WT + MO1-gata6 + MO3-gata4 standard conditions Fig. 4 with imageFig. 5 with image from Peterkin et al., 2007
otic placode foxj1b expression amount, ameliorated mir210nju49/nju49 + MO1-gata5 + MO1-gata6 standard conditions Fig. S3 from Jia et al., 2018
granulocyte mpx expression amount, ameliorated mir210nju49/nju49 + MO1-gata5 + MO1-gata6 standard conditions Fig. 3 from Jia et al., 2018
myeloid cell differentiation occurrence, ameliorated mir210nju49/nju49 + MO1-gata5 + MO1-gata6 standard conditions Fig. 3 from Jia et al., 2018
yolk syncytial layer slc3a2a expression amount, ameliorated mir210nju49/nju49 + MO1-gata5 + MO1-gata6 standard conditions Fig. S3 from Jia et al., 2018
margin EGFP expression absent, abnormal hsc70Tg + MO1-gata5 + MO1-gata6 standard conditions Fig. 2 with image from Yuan et al., 2018
lateral mesoderm EGFP expression decreased amount, abnormal hsc70Tg + MO1-gata5 + MO1-gata6 standard conditions Fig. 2 with image from Yuan et al., 2018
cardiac ventricle EGFP expression decreased distribution, abnormal knu9Tg + MO1-gata6 + MO5-gata4(AB) standard conditions Fig. 6 with image from Park et al., 2009
heart physical object quality, abnormal twu34Tg + MO1-gata5 + MO1-gata6 standard conditions Fig. 2 with image from Holtzinger et al., 2007
cardiac muscle cell decreased amount, abnormal twu34Tg + MO1-gata5 + MO1-gata6 standard conditions Fig. 2 with image from Holtzinger et al., 2007
heart primordium left side unfused from heart primordium right side, abnormal twu34Tg + MO1-gata6 + MO2-gata4 standard conditions Fig. 2 with image from Holtzinger et al., 2007
heart bifurcated, abnormal twu34Tg + MO1-gata6 + MO2-gata4 standard conditions Fig. 2 with image from Holtzinger et al., 2007
heart physical object quality, abnormal twu34Tg + MO1-gata6 + MO2-gata4 standard conditions Fig. 2 with image from Holtzinger et al., 2007
heart absent, abnormal knu9Tg + MO1-gata5 + MO1-gata6 + MO5-gata4(AB) standard conditions Fig. 6 with image from Park et al., 2009
whole organism EGFP expression absent, abnormal knu9Tg + MO1-gata5 + MO1-gata6 + MO5-gata4(AB) standard conditions Fig. 6 with image from Park et al., 2009
Citations