Morpholino

MO1-gata6

ID
ZDB-MRPHLNO-050927-1
Name
MO1-gata6
Previous Names
  • zfMDL MO (1)
Target
Sequence
5' - AGCTGTTATCACCCAGGTCCATCCA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The sequence reported in Peterkin et al, 2003 is written 3' -> 5'. The sequence shown has been reversed.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-gata6
Expressed Gene Anatomy Figures
bmp4 Fig. 6 with image from Zeng et al., 2012
cp Fig. 5 with image from Shin et al., 2007
egr2b Fig. 5 with imageFig. 6 with image from Peterkin et al., 2007
foxa2 Fig. 3 with image from Tseng et al., 2011
foxa3 Fig. 3 with image from Tseng et al., 2011
foxb1a Fig. 2 with image from Tseng et al., 2011
gata4 Fig. 5 with imageFig. 6 with image from Peterkin et al., 2007
Fig. 8 from Peterkin et al., 2003
gata5 Fig. 3 with image from Tseng et al., 2011
Fig. 8 from Peterkin et al., 2003
hhex Fig. 5 with image from Shin et al., 2007
ihha Fig. 6 with image from Zeng et al., 2012
myh6 Fig. 3 with image from Holtzinger et al., 2007
myh7 Fig. 4 with image from Holtzinger et al., 2007
Fig. 4 with image from Peterkin et al., 2007
Fig. 8 from Peterkin et al., 2003
myl7 Fig. 4 with image from Peterkin et al., 2007
Fig. 8 from Peterkin et al., 2003
myod1 Fig. 5 with imageFig. 6 with image from Peterkin et al., 2007
nkx2.5 Fig. 5 with image from Holtzinger et al., 2007
Fig. 4 with imageFig. 5 with imageFig. 6 with image from Peterkin et al., 2007
Fig. 8 from Peterkin et al., 2003
prox1a Fig. 5 with image from Shin et al., 2007
sebox Fig. 3 with image from Tseng et al., 2011
shha Fig. 6 with image from Zeng et al., 2012
sox32 Fig. 2 with imageFig. 3 with image from Tseng et al., 2011
tbx16 Fig. 3 with image from Tseng et al., 2011
tfa Fig. 7 with image from Holtzinger et al., 2005
Phenotype
Phenotype resulting from MO1-gata6
No data available
Phenotype of all Fish created by or utilizing MO1-gata6
No data available
Citations