header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-111028-1
Morpholino Name: MO1-mnx1
Target: mnx1 (1)
Sequence:
5' - AACAGATTAACGCCTCGTTCGTAAC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO targeted to 5-prime UTR of mnx1.
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-mnx1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-mnx1
Expressed Gene Anatomy Figures
arxa Fig. S6 with image from Dalgin et al., 2011
gcga Fig. 4 with imageFig. 7 with image from Dalgin et al., 2011
ins Fig. 2 with imageFig. 4 with imageFig. 5 with imageFig. 7 with image from Dalgin et al., 2011
isl1 Fig. 2 with image from Dalgin et al., 2011
myod1 Fig. 3 with image from Dalgin et al., 2011
neurod1 Fig. 3 with image from Dalgin et al., 2011
sst1.1 Fig. 4 with image from Dalgin et al., 2011
PHENOTYPE
Phenotype resulting from MO1-mnx1
Phenotype of all Fish created by or utilizing MO1-mnx1
Phenotype Fish Conditions Figures
posterior pancreatic bud has fewer parts of type pancreatic B cell, abnormal AB + MO1-mnx1 standard conditions Fig. 2 with imageFig. 4 with imageFig. 7 with image from Dalgin et al., 2011
pancreatic A cell differentiation increased occurrence, abnormal AB + MO1-mnx1 chemical treatment: all-trans-retinoic acid Fig. 7 with image from Dalgin et al., 2011
type B pancreatic cell differentiation decreased occurrence, abnormal AB + MO1-mnx1 standard conditions Fig. 4 with imageFig. 7 with image from Dalgin et al., 2011
endocrine pancreas development increased process quality, abnormal AB + MO1-mnx1 chemical treatment: all-trans-retinoic acid Fig. 7 with image from Dalgin et al., 2011
posterior pancreatic bud has fewer parts of type pancreatic B cell, abnormal AB + MO1-mnx1 chemical treatment: all-trans-retinoic acid Fig. 7 with image from Dalgin et al., 2011
posterior pancreatic bud has extra parts of type pancreatic A cell, abnormal AB + MO1-mnx1 chemical treatment: all-trans-retinoic acid Fig. 7 with image from Dalgin et al., 2011
retinoic acid receptor signaling pathway increased occurrence, abnormal AB + MO1-mnx1 chemical treatment: all-trans-retinoic acid Fig. 7 with image from Dalgin et al., 2011
posterior pancreatic bud has extra parts of type pancreatic A cell, abnormal AB + MO1-mnx1 standard conditions Fig. 4 with imageFig. 7 with imageFig. S6 with image from Dalgin et al., 2011
type B pancreatic cell differentiation decreased occurrence, abnormal AB + MO1-mnx1 chemical treatment: all-trans-retinoic acid Fig. 7 with image from Dalgin et al., 2011
endocrine pancreas development decreased process quality, abnormal AB + MO1-mnx1 standard conditions Fig. 2 with image from Dalgin et al., 2011
pancreatic A cell differentiation increased occurrence, abnormal AB + MO1-mnx1 standard conditions Fig. 4 with imageFig. 7 with imageFig. S6 with image from Dalgin et al., 2011
endocrine pancreas has fewer parts of type pancreatic B cell, abnormal nl1Tg + MO1-mnx1 standard conditions Fig. 5 with image from Dalgin et al., 2011
endocrine pancreas has extra parts of type pancreatic A cell, abnormal nl1Tg + MO1-mnx1 standard conditions Fig. 5 with image from Dalgin et al., 2011
Genome Resources:
CITATIONS (2)