header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-100429-3
Morpholino Name: MO1-gbx1
Target: gbx1 (1)
Previous Name: gbx1-MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - AAATCCCGTGCTGTACTGGCCTTCA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Targets the 5'UTR.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-gbx1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-gbx1
Expressed Gene Anatomy Figures
cdx4 Fig. 6 with image from Rhinn et al., 2009
egr2b Fig. 5 with imageFig. 6 with imageFig. S2 with image from Rhinn et al., 2009
fgf8a Fig. 6 with image from Rhinn et al., 2009
hoxb1a Fig. 6 with image from Rhinn et al., 2009
hoxb1b Fig. 6 with image from Rhinn et al., 2009
mafba Fig. 6 with image from Rhinn et al., 2009
myod1 Fig. 5 with imageFig. S2 with image from Rhinn et al., 2009
otx2b Fig. 5 with imageFig. 6 with imageFig. S2 with image from Rhinn et al., 2009
pax2a Fig. 6 with image from Rhinn et al., 2009
PHENOTYPE
Phenotype resulting from MO1-gbx1
Phenotype of all Fish created by or utilizing MO1-gbx1
Phenotype Fish Conditions Figures
gastrulation delayed, abnormal WT + MO1-gbx1 standard conditions Fig. S1 with image from Rhinn et al., 2009
neural keel wholly anterioralized, abnormal WT + MO1-gbx1 standard conditions Fig. 5 with image from Rhinn et al., 2009
spinal cord decreased length, abnormal WT + MO1-gbx1 standard conditions Fig. S1 with image from Rhinn et al., 2009
brain morphology, abnormal WT + MO1-gbx1 standard conditions Fig. S1 with image from Rhinn et al., 2009
hindbrain anterior region decreased size, abnormal WT + MO1-gbx1 standard conditions Fig. 5 with image from Rhinn et al., 2009
spinal cord neural keel decreased length, abnormal WT + MO1-gbx1 standard conditions Fig. 5 with image from Rhinn et al., 2009
midbrain-hindbrain boundary morphogenesis disrupted, abnormal WT + MO1-gbx1 standard conditions Fig. 6 with image from Rhinn et al., 2009
midbrain hindbrain boundary neural keel morphology, abnormal WT + MO1-gbx1 standard conditions Fig. S1 with image from Rhinn et al., 2009
midbrain hindbrain boundary neural plate mislocalised posteriorly, abnormal WT + MO1-gbx1 standard conditions Fig. 6 with image from Rhinn et al., 2009
whole organism shape, abnormal WT + MO1-gbx1 standard conditions Fig. S1 with image from Rhinn et al., 2009
neural plate wholly anterioralized, abnormal WT + MO1-gbx1 standard conditions Fig. 6 with image from Rhinn et al., 2009
whole organism necrotic, abnormal WT + MO1-gbx1 standard conditions Fig. S1 with image from Rhinn et al., 2009
hindbrain anterior-posterior axis decreased length, abnormal WT + MO1-gbx1 standard conditions Fig. S1 with image from Rhinn et al., 2009
Genome Resources:
CITATIONS (1)