ZFIN ID: ZDB-MRPHLNO-050316-1
Morpholino Name: MO1-cyp26a1
Target: cyp26a1 (1)
Sequence:
5' - CGCGCAACTGATCGCCAAAACGAAA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-cyp26a1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-cyp26a1
Expressed Gene Anatomy Figures
dlc Fig. 7 from Echeverri et al., 2007
her1 Fig. 7 from Echeverri et al., 2007
her7 Fig. 7 from Echeverri et al., 2007
slc4a4a Fig. 5 with image from Naylor et al., 2016
slc12a1 Fig. 5 with image from Naylor et al., 2016
slc12a3 Fig. 5 with image from Naylor et al., 2016
ttn.2 Fig. 7 from Echeverri et al., 2007
PHENOTYPE
Phenotype resulting from MO1-cyp26a1
Phenotype Figures
anterior/posterior pattern specification involved in pronephros development disrupted, abnormal Fig. 5 with image from Naylor et al., 2016
blood circulation disrupted, abnormal Fig. 7 from Echeverri et al., 2007
eye decreased size, abnormal Fig. 7 from Echeverri et al., 2007
pectoral fin bud decreased size, abnormal Fig. 7 from Echeverri et al., 2007
post-vent region structure, abnormal Fig. 7 from Echeverri et al., 2007
pronephric distal early tubule slc12a1 expression mislocalised, abnormal Fig. 5 with image from Naylor et al., 2016
pronephric distal late tubule slc12a3 expression decreased distribution, abnormal Fig. 5 with image from Naylor et al., 2016
pronephric proximal convoluted tubule slc4a4a expression increased distribution, abnormal Fig. 5 with image from Naylor et al., 2016
pronephric proximal straight tubule slc4a4a expression increased distribution, abnormal Fig. 5 with image from Naylor et al., 2016
pronephros wholly anterioralized, abnormal Fig. 5 with image from Naylor et al., 2016
somite spatial pattern, abnormal Fig. 7 from Echeverri et al., 2007
whole organism increased curvature, abnormal Fig. 7 from Echeverri et al., 2007
yolk increased accumulation blood, abnormal Fig. 7 from Echeverri et al., 2007

Phenotype of all Fish created by or utilizing MO1-cyp26a1
Phenotype Fish Conditions Figures
pronephric proximal convoluted tubule slc4a4a expression increased distribution, abnormal TU + MO1-cyp26a1 standard conditions Fig. 5 with image from Naylor et al., 2016
pronephros wholly anterioralized, abnormal TU + MO1-cyp26a1 standard conditions Fig. 5 with image from Naylor et al., 2016
pronephric distal late tubule slc12a3 expression decreased distribution, abnormal TU + MO1-cyp26a1 standard conditions Fig. 5 with image from Naylor et al., 2016
pronephric proximal straight tubule slc4a4a expression increased distribution, abnormal TU + MO1-cyp26a1 standard conditions Fig. 5 with image from Naylor et al., 2016
pronephric distal early tubule slc12a1 expression mislocalised, abnormal TU + MO1-cyp26a1 standard conditions Fig. 5 with image from Naylor et al., 2016
anterior/posterior pattern specification involved in pronephros development disrupted, abnormal TU + MO1-cyp26a1 standard conditions Fig. 5 with image from Naylor et al., 2016
post-vent region structure, abnormal WT + MO1-cyp26a1 standard conditions Fig. 7 from Echeverri et al., 2007
blood circulation disrupted, abnormal WT + MO1-cyp26a1 standard conditions Fig. 7 from Echeverri et al., 2007
yolk increased accumulation blood, abnormal WT + MO1-cyp26a1 standard conditions Fig. 7 from Echeverri et al., 2007
pectoral fin bud decreased size, abnormal WT + MO1-cyp26a1 standard conditions Fig. 7 from Echeverri et al., 2007
whole organism increased curvature, abnormal WT + MO1-cyp26a1 standard conditions Fig. 7 from Echeverri et al., 2007
somite spatial pattern, abnormal WT + MO1-cyp26a1 standard conditions Fig. 7 from Echeverri et al., 2007
eye decreased size, abnormal WT + MO1-cyp26a1 standard conditions Fig. 7 from Echeverri et al., 2007
OTHER MO1-cyp26a1 MORPHOLINO PAGESNo links to external sites
CITATIONS (8)