Morpholino

MO1-tbx5b

ID
ZDB-MRPHLNO-130123-3
Name
MO1-tbx5b
Previous Names
None
Target
Sequence
5' - GGATTCGCCATATTCCCGTCTGAGT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-tbx5b
No data available
Phenotype
Phenotype resulting from MO1-tbx5b
Phenotype Fish Figures
eye decreased size, abnormal AB + MO1-tbx5b Fig. 1 with image from Boyle Anderson et al., 2018
head decreased size, abnormal AB + MO1-tbx5b Fig. 1 with image from Boyle Anderson et al., 2018
head shape, abnormal AB + MO1-tbx5b Fig. 1 with image from Boyle Anderson et al., 2018
heart malformed, abnormal WT + MO1-tbx5b Fig. 1 with image from Pi-Roig et al., 2014
heart morphology, abnormal AB + MO1-tbx5b Fig. 1 with image from Boyle Anderson et al., 2018
heart structure, abnormal WT + MO1-tbx5b Fig. 4 with imageFig. 10 with image from Parrie et al., 2013
heart contraction decreased rate, abnormal s883Tg + MO1-tbx5b Fig. 4 with image from Parrie et al., 2013
heart development disrupted, abnormal s883Tg + MO1-tbx5b Fig. 4 with imageFig. 10 with image from Parrie et al., 2013
heart jogging disrupted, abnormal WT + MO1-tbx5b Fig. 2 with image from Pi-Roig et al., 2014
heart looping arrested, abnormal WT + MO1-tbx5b Fig. 1 with image from Pi-Roig et al., 2014
heart looping disrupted, abnormal s849Tg; uto1Tg + MO1-tbx5b Fig. 1 with image from Pi-Roig et al., 2014
Fig. 4 with image from Parrie et al., 2013
Fig. S8 with image from Chiavacci et al., 2012
heart looping process quality, abnormal AB + MO1-tbx5b Fig. 1 with image from Boyle Anderson et al., 2018
immature eye cryba1l1 expression decreased amount, abnormal AB + MO1-tbx5b Fig. S5 with image from Boyle Anderson et al., 2018
immature eye tyrp1b expression decreased distribution, abnormal AB + MO1-tbx5b Fig. S5 with image from Boyle Anderson et al., 2018
immature eye tyrp1b expression increased amount, abnormal AB + MO1-tbx5b Fig. S5 with image from Boyle Anderson et al., 2018
intersegmental vessel increased branchiness, abnormal y1Tg + MO1-tbx5b Fig. 3 with image from Boyle Anderson et al., 2018
pectoral fin decreased size, abnormal WT + MO1-tbx5b Fig. 8 with imageFig. 11 with image from Parrie et al., 2013
pectoral fin immature, abnormal WT + MO1-tbx5b Fig. 5 with image from Pi-Roig et al., 2014
pectoral fin shape, abnormal AB + MO1-tbx5b Fig. 1 with image from Boyle Anderson et al., 2018
pectoral fin shortened, abnormal AB + MO1-tbx5b Fig. 1 with image from Boyle Anderson et al., 2018
pectoral fin development delayed, abnormal WT + MO1-tbx5b Fig. 5 with image from Pi-Roig et al., 2014
pectoral fin development disrupted, abnormal WT + MO1-tbx5b Fig. 8 with imageFig. 11 with image from Parrie et al., 2013
pectoral fin morphogenesis disrupted, abnormal WT + MO1-tbx5b Fig. 8 with image from Parrie et al., 2013
pericardium edematous, abnormal AB + MO1-tbx5b Fig. 1 with image from Boyle Anderson et al., 2018
primordial vasculature hhex expression decreased amount, abnormal AB + MO1-tbx5b Fig. 3 with image from Boyle Anderson et al., 2018
primordial vasculature sox7 expression decreased amount, abnormal AB + MO1-tbx5b Fig. 3 with image from Boyle Anderson et al., 2018
primordial vasculature hhex expression spatial pattern, abnormal AB + MO1-tbx5b Fig. 3 with image from Boyle Anderson et al., 2018
primordial vasculature sox7 expression spatial pattern, abnormal AB + MO1-tbx5b Fig. 3 with image from Boyle Anderson et al., 2018
pronephros cox6b1 expression decreased amount, abnormal AB + MO1-tbx5b Fig. 3 with image from Boyle Anderson et al., 2018
somite aimp1a expression decreased amount, abnormal AB + MO1-tbx5b Fig. 4 with imageFig. S4 with image from Boyle Anderson et al., 2018
somite decreased size, abnormal AB + MO1-tbx5b Fig. 4 with image from Boyle Anderson et al., 2018
somite pvalb2 expression increased amount, abnormal AB + MO1-tbx5b Fig. S4 with image from Boyle Anderson et al., 2018
somite hspa8b expression increased amount, abnormal AB + MO1-tbx5b Fig. S4 with image from Boyle Anderson et al., 2018
somite hsp90aa1.2 expression increased amount, abnormal AB + MO1-tbx5b Fig. 4 with imageFig. S4 with image from Boyle Anderson et al., 2018
somite mybphb expression increased distribution, abnormal AB + MO1-tbx5b Fig. S4 with image from Boyle Anderson et al., 2018
somite hspa8b expression increased distribution, abnormal AB + MO1-tbx5b Fig. S4 with image from Boyle Anderson et al., 2018
somite hsp90aa1.2 expression mislocalised, abnormal AB + MO1-tbx5b Fig. 4 with imageFig. S4 with image from Boyle Anderson et al., 2018
somite medial side ctsc expression increased distribution, abnormal AB + MO1-tbx5b Fig. S4 with image from Boyle Anderson et al., 2018
somite ventral side mybphb expression mislocalised, abnormal AB + MO1-tbx5b Fig. S4 with image from Boyle Anderson et al., 2018
subintestinal vein decreased size, abnormal y1Tg + MO1-tbx5b Fig. 3 with image from Boyle Anderson et al., 2018
swim bladder uninflated, abnormal AB + MO1-tbx5b text only from Boyle Anderson et al., 2018
tail bud napbb expression increased distribution, abnormal AB + MO1-tbx5b Fig. S5 with image from Boyle Anderson et al., 2018
trunk somite obsl1a expression decreased amount, abnormal AB + MO1-tbx5b Fig. 4 with imageFig. S4 with image from Boyle Anderson et al., 2018
whole organism dead, abnormal AB + MO1-tbx5b text only from Boyle Anderson et al., 2018
whole organism napbb expression mislocalised, abnormal AB + MO1-tbx5b Fig. S5 with image from Boyle Anderson et al., 2018
whole organism anterior side phlda2 expression decreased amount, abnormal AB + MO1-tbx5b Fig. S4 with image from Boyle Anderson et al., 2018
whole organism posterior region obsl1a expression increased amount, abnormal AB + MO1-tbx5b Fig. S4 with image from Boyle Anderson et al., 2018
yolk napbb expression mislocalised, abnormal AB + MO1-tbx5b Fig. S5 with image from Boyle Anderson et al., 2018
Phenotype of all Fish created by or utilizing MO1-tbx5b
Phenotype Fish Conditions Figures
head decreased size, abnormal AB + MO1-tbx5b standard conditions Fig. 1 with image from Boyle Anderson et al., 2018
pronephros cox6b1 expression decreased amount, abnormal AB + MO1-tbx5b standard conditions Fig. 3 with image from Boyle Anderson et al., 2018
primordial vasculature sox7 expression decreased amount, abnormal AB + MO1-tbx5b standard conditions Fig. 3 with image from Boyle Anderson et al., 2018
primordial vasculature hhex expression decreased amount, abnormal AB + MO1-tbx5b standard conditions Fig. 3 with image from Boyle Anderson et al., 2018
head shape, abnormal AB + MO1-tbx5b standard conditions Fig. 1 with image from Boyle Anderson et al., 2018
somite ventral side mybphb expression mislocalised, abnormal AB + MO1-tbx5b standard conditions Fig. S4 with image from Boyle Anderson et al., 2018
somite pvalb2 expression increased amount, abnormal AB + MO1-tbx5b standard conditions Fig. S4 with image from Boyle Anderson et al., 2018
immature eye tyrp1b expression increased amount, abnormal AB + MO1-tbx5b standard conditions Fig. S5 with image from Boyle Anderson et al., 2018
somite hsp90aa1.2 expression increased amount, abnormal AB + MO1-tbx5b standard conditions Fig. 4 with imageFig. S4 with image from Boyle Anderson et al., 2018
swim bladder uninflated, abnormal AB + MO1-tbx5b standard conditions text only from Boyle Anderson et al., 2018
immature eye cryba1l1 expression decreased amount, abnormal AB + MO1-tbx5b standard conditions Fig. S5 with image from Boyle Anderson et al., 2018
whole organism posterior region obsl1a expression increased amount, abnormal AB + MO1-tbx5b standard conditions Fig. S4 with image from Boyle Anderson et al., 2018
somite hspa8b expression increased distribution, abnormal AB + MO1-tbx5b standard conditions Fig. S4 with image from Boyle Anderson et al., 2018
primordial vasculature hhex expression spatial pattern, abnormal AB + MO1-tbx5b standard conditions Fig. 3 with image from Boyle Anderson et al., 2018
tail bud napbb expression increased distribution, abnormal AB + MO1-tbx5b standard conditions Fig. S5 with image from Boyle Anderson et al., 2018
pectoral fin shape, abnormal AB + MO1-tbx5b standard conditions Fig. 1 with image from Boyle Anderson et al., 2018
pericardium edematous, abnormal AB + MO1-tbx5b standard conditions Fig. 1 with image from Boyle Anderson et al., 2018
somite mybphb expression increased distribution, abnormal AB + MO1-tbx5b standard conditions Fig. S4 with image from Boyle Anderson et al., 2018
trunk somite obsl1a expression decreased amount, abnormal AB + MO1-tbx5b standard conditions Fig. 4 with imageFig. S4 with image from Boyle Anderson et al., 2018
somite hsp90aa1.2 expression mislocalised, abnormal AB + MO1-tbx5b standard conditions Fig. 4 with imageFig. S4 with image from Boyle Anderson et al., 2018
pectoral fin shortened, abnormal AB + MO1-tbx5b standard conditions Fig. 1 with image from Boyle Anderson et al., 2018
somite aimp1a expression decreased amount, abnormal AB + MO1-tbx5b standard conditions Fig. 4 with imageFig. S4 with image from Boyle Anderson et al., 2018
somite decreased size, abnormal AB + MO1-tbx5b standard conditions Fig. 4 with image from Boyle Anderson et al., 2018
whole organism anterior side phlda2 expression decreased amount, abnormal AB + MO1-tbx5b standard conditions Fig. S4 with image from Boyle Anderson et al., 2018
whole organism napbb expression mislocalised, abnormal AB + MO1-tbx5b standard conditions Fig. S5 with image from Boyle Anderson et al., 2018
heart looping process quality, abnormal AB + MO1-tbx5b standard conditions Fig. 1 with image from Boyle Anderson et al., 2018
eye decreased size, abnormal AB + MO1-tbx5b standard conditions Fig. 1 with image from Boyle Anderson et al., 2018
somite medial side ctsc expression increased distribution, abnormal AB + MO1-tbx5b standard conditions Fig. S4 with image from Boyle Anderson et al., 2018
yolk napbb expression mislocalised, abnormal AB + MO1-tbx5b standard conditions Fig. S5 with image from Boyle Anderson et al., 2018
primordial vasculature sox7 expression spatial pattern, abnormal AB + MO1-tbx5b standard conditions Fig. 3 with image from Boyle Anderson et al., 2018
immature eye tyrp1b expression decreased distribution, abnormal AB + MO1-tbx5b standard conditions Fig. S5 with image from Boyle Anderson et al., 2018
whole organism dead, abnormal AB + MO1-tbx5b standard conditions text only from Boyle Anderson et al., 2018
heart morphology, abnormal AB + MO1-tbx5b standard conditions Fig. 1 with image from Boyle Anderson et al., 2018
somite hspa8b expression increased amount, abnormal AB + MO1-tbx5b standard conditions Fig. S4 with image from Boyle Anderson et al., 2018
pectoral fin morphogenesis disrupted, abnormal WT + MO1-tbx5b standard conditions Fig. 8 with image from Parrie et al., 2013
heart development disrupted, abnormal WT + MO1-tbx5b standard conditions Fig. 10 with image from Parrie et al., 2013
pectoral fin decreased size, abnormal WT + MO1-tbx5b standard conditions Fig. 8 with imageFig. 11 with image from Parrie et al., 2013
heart malformed, abnormal WT + MO1-tbx5b standard conditions Fig. 1 with image from Pi-Roig et al., 2014
pectoral fin development delayed, abnormal WT + MO1-tbx5b standard conditions Fig. 5 with image from Pi-Roig et al., 2014
pectoral fin immature, abnormal WT + MO1-tbx5b standard conditions Fig. 5 with image from Pi-Roig et al., 2014
heart jogging disrupted, abnormal WT + MO1-tbx5b standard conditions Fig. 2 with image from Pi-Roig et al., 2014
heart structure, abnormal WT + MO1-tbx5b standard conditions Fig. 10 with image from Parrie et al., 2013
heart looping disrupted, abnormal WT + MO1-tbx5b standard conditions Fig. 1 with image from Pi-Roig et al., 2014
pectoral fin development disrupted, abnormal WT + MO1-tbx5b standard conditions Fig. 8 with imageFig. 11 with image from Parrie et al., 2013
heart looping arrested, abnormal WT + MO1-tbx5b standard conditions Fig. 1 with image from Pi-Roig et al., 2014
heart development disrupted, abnormal s883Tg + MO1-tbx5b standard conditions Fig. 4 with image from Parrie et al., 2013
heart structure, abnormal s883Tg + MO1-tbx5b standard conditions Fig. 4 with image from Parrie et al., 2013
heart looping disrupted, abnormal s883Tg + MO1-tbx5b standard conditions Fig. 4 with image from Parrie et al., 2013
heart contraction decreased rate, abnormal s883Tg + MO1-tbx5b standard conditions Fig. 4 with image from Parrie et al., 2013
intersegmental vessel increased branchiness, abnormal y1Tg + MO1-tbx5b standard conditions Fig. 3 with image from Boyle Anderson et al., 2018
subintestinal vein decreased size, abnormal y1Tg + MO1-tbx5b standard conditions Fig. 3 with image from Boyle Anderson et al., 2018
heart looping disrupted, abnormal s849Tg; uto1Tg + MO1-tbx5b standard conditions Fig. S8 with image from Chiavacci et al., 2012
yolk syncytial layer coxfa4b expression increased amount, abnormal AB + MO1-tbx5b + MO2-tbx5a standard conditions Fig. S5 with image from Boyle Anderson et al., 2018
primordial vasculature sox7 expression decreased amount, abnormal AB + MO1-tbx5b + MO2-tbx5a standard conditions Fig. 3 with image from Boyle Anderson et al., 2018
primordial vasculature sox7 expression spatial pattern, abnormal AB + MO1-tbx5b + MO2-tbx5a standard conditions Fig. 3 with image from Boyle Anderson et al., 2018
somite medial side ctsc expression increased distribution, abnormal AB + MO1-tbx5b + MO2-tbx5a standard conditions Fig. S4 with image from Boyle Anderson et al., 2018
somite pvalb2 expression increased amount, abnormal AB + MO1-tbx5b + MO2-tbx5a standard conditions Fig. S4 with image from Boyle Anderson et al., 2018
periderm krt91 expression decreased amount, abnormal AB + MO1-tbx5b + MO2-tbx5a standard conditions Fig. S5 with image from Boyle Anderson et al., 2018
somite phlda2 expression decreased amount, abnormal AB + MO1-tbx5b + MO2-tbx5a standard conditions Fig. 4 with imageFig. S4 with image from Boyle Anderson et al., 2018
somite hsp90aa1.2 expression increased amount, abnormal AB + MO1-tbx5b + MO2-tbx5a standard conditions Fig. 4 with imageFig. S4 with image from Boyle Anderson et al., 2018
immature eye tyrp1b expression increased amount, abnormal AB + MO1-tbx5b + MO2-tbx5a standard conditions Fig. S5 with image from Boyle Anderson et al., 2018
somite hspa8b expression increased distribution, abnormal AB + MO1-tbx5b + MO2-tbx5a standard conditions Fig. S4 with image from Boyle Anderson et al., 2018
tail bud napbb expression increased distribution, abnormal AB + MO1-tbx5b + MO2-tbx5a standard conditions Fig. S5 with image from Boyle Anderson et al., 2018
pronephros cox6b1 expression increased amount, abnormal AB + MO1-tbx5b + MO2-tbx5a standard conditions Fig. 3 with image from Boyle Anderson et al., 2018
trunk anterior region mybphb expression increased amount, abnormal AB + MO1-tbx5b + MO2-tbx5a standard conditions Fig. S4 with image from Boyle Anderson et al., 2018
periderm si:dkey-204l11.1 expression decreased amount, abnormal AB + MO1-tbx5b + MO2-tbx5a standard conditions Fig. S5 with image from Boyle Anderson et al., 2018
somite ryr1b expression increased amount, abnormal AB + MO1-tbx5b + MO2-tbx5a standard conditions Fig. 4 with imageFig. S4 with image from Boyle Anderson et al., 2018
whole organism posterior region mybphb expression decreased amount, abnormal AB + MO1-tbx5b + MO2-tbx5a standard conditions Fig. S4 with image from Boyle Anderson et al., 2018
somite obsl1a expression increased amount, abnormal AB + MO1-tbx5b + MO2-tbx5a standard conditions Fig. 4 with imageFig. S4 with image from Boyle Anderson et al., 2018
somite hsp90aa1.2 expression mislocalised, abnormal AB + MO1-tbx5b + MO2-tbx5a standard conditions Fig. 4 with imageFig. S4 with image from Boyle Anderson et al., 2018
immature eye cryba1l1 expression decreased amount, abnormal AB + MO1-tbx5b + MO2-tbx5a standard conditions Fig. S5 with image from Boyle Anderson et al., 2018
somite aimp1a expression decreased amount, abnormal AB + MO1-tbx5b + MO2-tbx5a standard conditions Fig. 4 with imageFig. S4 with image from Boyle Anderson et al., 2018
whole organism phlda2 expression decreased amount, abnormal AB + MO1-tbx5b + MO2-tbx5a standard conditions Fig. S4 with image from Boyle Anderson et al., 2018
somite decreased size, abnormal AB + MO1-tbx5b + MO2-tbx5a standard conditions Fig. 4 with image from Boyle Anderson et al., 2018
whole organism napbb expression mislocalised, abnormal AB + MO1-tbx5b + MO2-tbx5a standard conditions Fig. S5 with image from Boyle Anderson et al., 2018
pronephros anatomical region cox6b1 expression mislocalised, abnormal AB + MO1-tbx5b + MO2-tbx5a standard conditions Fig. 3 with image from Boyle Anderson et al., 2018
yolk napbb expression mislocalised, abnormal AB + MO1-tbx5b + MO2-tbx5a standard conditions Fig. S5 with image from Boyle Anderson et al., 2018
primordial vasculature hhex expression decreased distribution, abnormal AB + MO1-tbx5b + MO2-tbx5a standard conditions Fig. 3 with image from Boyle Anderson et al., 2018
immature eye tyrp1b expression decreased distribution, abnormal AB + MO1-tbx5b + MO2-tbx5a standard conditions Fig. S5 with image from Boyle Anderson et al., 2018
somite mybphb expression spatial pattern, abnormal AB + MO1-tbx5b + MO2-tbx5a standard conditions Fig. S4 with image from Boyle Anderson et al., 2018
somite hspa8b expression increased amount, abnormal AB + MO1-tbx5b + MO2-tbx5a standard conditions Fig. S4 with image from Boyle Anderson et al., 2018
heart jogging disrupted, abnormal WT + MO1-tbx5a + MO1-tbx5b standard conditions Fig. 2 with image from Pi-Roig et al., 2014
heart malformed, abnormal WT + MO1-tbx5a + MO1-tbx5b standard conditions Fig. 1 with image from Pi-Roig et al., 2014
heart looping disrupted, abnormal WT + MO1-tbx5a + MO1-tbx5b standard conditions Fig. 1 with image from Pi-Roig et al., 2014
cranial nerve II decreased thickness, abnormal WT + MO1-tbx5a + MO1-tbx5b standard conditions Fig. 4 with image from Pi-Roig et al., 2014
heart looping arrested, abnormal WT + MO1-tbx5a + MO1-tbx5b standard conditions Fig. 1 with image from Pi-Roig et al., 2014
intersegmental vessel increased branchiness, abnormal y1Tg + MO1-tbx5b + MO2-tbx5a standard conditions Fig. 3 with image from Boyle Anderson et al., 2018
subintestinal vein decreased size, abnormal y1Tg + MO1-tbx5b + MO2-tbx5a standard conditions Fig. 3 with image from Boyle Anderson et al., 2018
heart looping disrupted, abnormal tbx5am21/m21; s883Tg + MO1-tbx5b standard conditions Fig. 4 with image from Parrie et al., 2013
heart contraction decreased rate, abnormal tbx5am21/m21; s883Tg + MO1-tbx5b standard conditions Fig. 4 with image from Parrie et al., 2013
heart structure, abnormal tbx5am21/m21; s883Tg + MO1-tbx5b standard conditions Fig. 4 with image from Parrie et al., 2013
heart development disrupted, abnormal tbx5am21/m21; s883Tg + MO1-tbx5b standard conditions Fig. 4 with image from Parrie et al., 2013
Citations