Morpholino

MO1-arl13b

ID
ZDB-MRPHLNO-100113-3
Name
MO1-arl13b
Previous Names
  • hi459 oligo 2 (1)
Target
Sequence
5' - TTTCCCCCCTAAATGCTTTCACTGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
translation-blocker
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-arl13b
No data available
Phenotype
Phenotype resulting from MO1-arl13b
Phenotype Fish Figures
axis decreased length, abnormal WT + MO1-arl13b Fig. 2 with image from Duldulao et al., 2009
cerebellar granule cell differentiation decreased occurrence, abnormal AB + MO1-arl13b Fig. 3 with image from Zhu et al., 2020
cerebellar Purkinje cell differentiation decreased occurrence, abnormal AB + MO1-arl13b Fig. 4 with image from Zhu et al., 2020
cerebellum morphogenesis decreased process quality, abnormal nl1Tg + MO1-arl13b Fig. 6 with image from Zhu et al., 2020
convergent extension involved in gastrulation process quality, abnormal WT + MO1-arl13b Fig. 2 with image from Duldulao et al., 2009
corpus cerebelli atoh1c expression decreased amount, abnormal AB + MO1-arl13b Fig. 2 with image from Zhu et al., 2020
corpus cerebelli dorso-medial region atoh1a expression absent, abnormal AB + MO1-arl13b Fig. 2 with image from Zhu et al., 2020
corpus cerebelli dorso-medial region zic1 expression decreased amount, abnormal AB + MO1-arl13b Fig. 3 with image from Zhu et al., 2020
corpus cerebelli dorso-medial region reln expression decreased amount, abnormal AB + MO1-arl13b Fig. 3 with image from Zhu et al., 2020
corpus cerebelli dorso-medial region EGFP expression decreased amount, abnormal nl1Tg + MO1-arl13b Fig. 3 with imageFig. 6 with image from Zhu et al., 2020
determination of left/right asymmetry in lateral mesoderm process quality, abnormal WT + MO1-arl13b Fig. 5 with image from Duldulao et al., 2009
determination of left/right symmetry process quality, abnormal WT + MO1-arl13b Fig. 5 with image from Duldulao et al., 2009
granular layer corpus cerebelli has fewer parts of type cerebellar granule cell, abnormal nl1Tg + MO1-arl13b Fig. 6 with image from Zhu et al., 2020
heart bilateral symmetry, abnormal WT + MO1-arl13b Fig. 5 with image from Duldulao et al., 2009
lateral plate mesoderm bilateral symmetry, abnormal WT + MO1-arl13b Fig. 5 with image from Duldulao et al., 2009
molecular layer corpus cerebelli parallel fiber disorganized, abnormal nl1Tg + MO1-arl13b Fig. 3 with image from Zhu et al., 2020
parallel fiber axon development decreased process quality, abnormal AB + MO1-arl13b Fig. 1 with image from Zhu et al., 2020
post-vent region increased curvature, abnormal WT + MO1-arl13b Table 2 from Sun et al., 2004
pronephric duct motile cilium decreased length, abnormal sq5713Tg + MO1-arl13b Fig. 4 with image from Lu et al., 2015
pronephros cystic, abnormal TU + MO1-arl13b Fig. 7 from Jin et al., 2019
Table 2 from Sun et al., 2004
Purkinje cell layer corpus cerebelli has fewer parts of type Purkinje cell, abnormal AB + MO1-arl13b Fig. 4 with image from Zhu et al., 2020
Purkinje cell layer corpus cerebelli dorso-medial region ab1-pvalb labeling decreased amount, abnormal AB + MO1-arl13b Fig. 4 with image from Zhu et al., 2020
Purkinje cell layer corpus cerebelli dorso-medial region ptf1a expression decreased amount, abnormal AB + MO1-arl13b Fig. 4 with image from Zhu et al., 2020
Purkinje cell layer corpus cerebelli dorso-medial region has fewer parts of type Purkinje cell, abnormal AB + MO1-arl13b Fig. 4 with image from Zhu et al., 2020
somite increased width, abnormal WT + MO1-arl13b Fig. 2 with image from Duldulao et al., 2009
swimming decreased process quality, abnormal AB + MO1-arl13b Fig. 1 with image from Zhu et al., 2020
trunk increased width, abnormal WT + MO1-arl13b Fig. 2 with image from Duldulao et al., 2009
Phenotype of all Fish created by or utilizing MO1-arl13b
Phenotype Fish Conditions Figures
swimming decreased process quality, abnormal AB + MO1-arl13b standard conditions Fig. 1 with image from Zhu et al., 2020
corpus cerebelli dorso-medial region zic1 expression decreased amount, abnormal AB + MO1-arl13b standard conditions Fig. 3 with image from Zhu et al., 2020
corpus cerebelli atoh1c expression decreased amount, abnormal AB + MO1-arl13b standard conditions Fig. 2 with image from Zhu et al., 2020
cerebellar granule cell differentiation decreased occurrence, abnormal AB + MO1-arl13b standard conditions Fig. 3 with image from Zhu et al., 2020
Purkinje cell layer corpus cerebelli dorso-medial region ab1-pvalb labeling decreased amount, abnormal AB + MO1-arl13b standard conditions Fig. 4 with image from Zhu et al., 2020
Purkinje cell layer corpus cerebelli dorso-medial region has fewer parts of type Purkinje cell, abnormal AB + MO1-arl13b standard conditions Fig. 4 with image from Zhu et al., 2020
corpus cerebelli dorso-medial region atoh1a expression absent, abnormal AB + MO1-arl13b standard conditions Fig. 2 with image from Zhu et al., 2020
Purkinje cell layer corpus cerebelli dorso-medial region ptf1a expression decreased amount, abnormal AB + MO1-arl13b standard conditions Fig. 4 with image from Zhu et al., 2020
parallel fiber axon development decreased process quality, abnormal AB + MO1-arl13b standard conditions Fig. 1 with image from Zhu et al., 2020
cerebellar Purkinje cell differentiation decreased occurrence, abnormal AB + MO1-arl13b standard conditions Fig. 4 with image from Zhu et al., 2020
corpus cerebelli dorso-medial region reln expression decreased amount, abnormal AB + MO1-arl13b standard conditions Fig. 3 with image from Zhu et al., 2020
Purkinje cell layer corpus cerebelli has fewer parts of type Purkinje cell, abnormal AB + MO1-arl13b standard conditions Fig. 4 with image from Zhu et al., 2020
pronephros cystic, abnormal TU + MO1-arl13b standard conditions Fig. 7 from Jin et al., 2019
pronephros cystic, abnormal WT + MO1-arl13b standard conditions Table 2 from Sun et al., 2004
trunk increased width, abnormal WT + MO1-arl13b standard conditions Fig. 2 with image from Duldulao et al., 2009
post-vent region increased curvature, abnormal WT + MO1-arl13b standard conditions Table 2 from Sun et al., 2004
somite increased width, abnormal WT + MO1-arl13b standard conditions Fig. 2 with image from Duldulao et al., 2009
determination of left/right asymmetry in lateral mesoderm process quality, abnormal WT + MO1-arl13b standard conditions Fig. 5 with image from Duldulao et al., 2009
determination of left/right symmetry process quality, abnormal WT + MO1-arl13b standard conditions Fig. 5 with image from Duldulao et al., 2009
convergent extension involved in gastrulation process quality, abnormal WT + MO1-arl13b standard conditions Fig. 2 with image from Duldulao et al., 2009
heart bilateral symmetry, abnormal WT + MO1-arl13b standard conditions Fig. 5 with image from Duldulao et al., 2009
axis decreased length, abnormal WT + MO1-arl13b standard conditions Fig. 2 with image from Duldulao et al., 2009
lateral plate mesoderm bilateral symmetry, abnormal WT + MO1-arl13b standard conditions Fig. 5 with image from Duldulao et al., 2009
corpus cerebelli dorso-medial region EGFP expression decreased amount, abnormal nl1Tg + MO1-arl13b standard conditions Fig. 3 with imageFig. 6 with image from Zhu et al., 2020
corpus cerebelli dorso-medial region EGFP expression amount, ameliorated nl1Tg + MO1-arl13b chemical treatment by environment: lithium chloride Fig. 6 with image from Zhu et al., 2020
granular layer corpus cerebelli has number of cerebellar granule cell, ameliorated nl1Tg + MO1-arl13b chemical treatment by environment: lithium chloride Fig. 6 with image from Zhu et al., 2020
cerebellar granule cell differentiation decreased occurrence, abnormal nl1Tg + MO1-arl13b standard conditions Fig. 3 with image from Zhu et al., 2020
cerebellum morphogenesis process quality, ameliorated nl1Tg + MO1-arl13b chemical treatment by environment: lithium chloride Fig. 6 with image from Zhu et al., 2020
granular layer corpus cerebelli has fewer parts of type cerebellar granule cell, abnormal nl1Tg + MO1-arl13b standard conditions Fig. 6 with image from Zhu et al., 2020
cerebellum morphogenesis decreased process quality, abnormal nl1Tg + MO1-arl13b standard conditions Fig. 6 with image from Zhu et al., 2020
molecular layer corpus cerebelli parallel fiber disorganized, abnormal nl1Tg + MO1-arl13b standard conditions Fig. 3 with image from Zhu et al., 2020
pronephric duct motile cilium decreased length, abnormal sq5713Tg + MO1-arl13b heat shock Fig. 4 with image from Lu et al., 2015
pronephric duct motile cilium decreased length, abnormal sq5713Tg + MO1-arl13b standard conditions Fig. 4 with image from Lu et al., 2015
pronephros cystic, exacerbated TU + MO1-arl13b + MO1-cldn3c standard conditions Fig. 7 from Jin et al., 2019
pronephros cystic, exacerbated TU + MO1-arl13b + MO1-cldn7b standard conditions Fig. 7 from Jin et al., 2019
eye decreased size, abnormal WT + MO1-arl13b + MO1-exoc5 standard conditions Fig. 5 with image from Seixas et al., 2016
pericardium edematous, abnormal WT + MO1-arl13b + MO1-exoc5 standard conditions Fig. 5 with image from Seixas et al., 2016
post-vent region curved, abnormal WT + MO1-arl13b + MO1-exoc5 standard conditions Fig. 5 with image from Seixas et al., 2016
pronephros cystic, abnormal WT + MO1-arl13b + MO2-yap1 control Fig. 7 from He et al., 2015
pericardium edematous, abnormal WT + MO1-arl13b + MO2-yap1 control Fig. 7 from He et al., 2015
eye decreased size, abnormal WT + MO1-arl13b + MO2-yap1 control Fig. 7 from He et al., 2015
caudal fin curved, abnormal WT + MO1-arl13b + MO2-yap1 control Fig. 7 from He et al., 2015
somite cilium decreased length, abnormal sq5714Tg + MO1-arl13b standard conditions Fig. 4 with image from Lu et al., 2015
somite cilium decreased length, abnormal sq5714Tg + MO1-arl13b heat shock Fig. 4 with image from Lu et al., 2015
Citations