Morpholino

MO1-rpl11

ID
ZDB-MRPHLNO-070327-7
Name
MO1-rpl11
Previous Names
  • rpl11 MO (1)
Target
Sequence
5' - CTTCTTCTCGCTCTGGTCCGCCATG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-rpl11
Expressed Gene Anatomy Figures
atm Fig. 4 with image from Chakraborty et al., 2009
baxa Fig. 3 from Ear et al., 2015
Fig. 4 with imageFig. S2 with image from Chakraborty et al., 2009
bbc3 Fig. 3 from Ear et al., 2015
Fig. 4 with imageFig. S2 with image from Chakraborty et al., 2009
bcl2l1 Fig. 4 with image from Chakraborty et al., 2009
bik Fig. 4 with image from Chakraborty et al., 2009
bop1 Fig. 3 from Chakraborty et al., 2017
ccng1 Fig. S3 from Chakraborty et al., 2017
cdkn1a Fig. 1Fig. 3 from Ear et al., 2015
Fig. 4 with imageFig. S2 with image from Chakraborty et al., 2009
egr2b Fig. 3 with image from Chakraborty et al., 2009
gata1a Fig. 2 from Ear et al., 2015
gnl3 Fig. 3 from Chakraborty et al., 2017
lft1 Fig. 6 from Ear et al., 2015
mcl1a Fig. 4 with image from Chakraborty et al., 2009
mdm2 Fig. 1Fig. 3 from Ear et al., 2015
Fig. 4 with imageFig. S2 with image from Chakraborty et al., 2009
myb Fig. 4 with image from Zhang et al., 2013
myca Fig. 4 with image from Chakraborty et al., 2009
nras Fig. 4 with image from Chakraborty et al., 2009
otx2b Fig. 3 with image from Chakraborty et al., 2009
pax2a Fig. 3 with image from Chakraborty et al., 2009
pax6a Fig. 3 with image from Chakraborty et al., 2009
pcna Fig. 2Fig. 5 from Ear et al., 2015
pes Fig. 3 from Chakraborty et al., 2017
pmaip1 Fig. 4 with image from Chakraborty et al., 2009
rpl11 Fig. 1 with image from Chakraborty et al., 2009
rrs1 Fig. 3 from Chakraborty et al., 2017
shha Fig. 3 with image from Chakraborty et al., 2009
tp53 Fig. 1Fig. 3 from Ear et al., 2015
Fig. 4 with imageFig. S2 with image from Chakraborty et al., 2009
Phenotype
Phenotype resulting from MO1-rpl11
Phenotype Fish Figures
apoptotic process increased occurrence, abnormal WT + MO1-rpl11 Fig. 4 with image from Chakraborty et al., 2009
caudal fin shortened, abnormal WT + MO1-rpl11 Fig. 1 from Ear et al., 2015
cerebellum aplastic, abnormal AB + MO1-rpl11 Fig. 3 with image from Uechi et al., 2006
erythroid lineage cell absent, abnormal zf623Tg + MO1-rpl11 Fig. 1Fig. 3Fig. 5 from Ear et al., 2015
erythroid lineage cell decreased amount, abnormal zf623Tg + MO1-rpl11 Fig. 3 from Ear et al., 2015
erythroid lineage cell EGFP expression decreased amount, abnormal cz3325Tg + MO1-rpl11 Fig. 2 from Ear et al., 2015
erythroid lineage cell increased size, abnormal cz3325Tg + MO1-rpl11 Fig. 2 from Ear et al., 2015
extension decreased size, abnormal WT + MO1-rpl11 Fig. 1 with image from Chakraborty et al., 2009
extension decreased thickness, abnormal WT + MO1-rpl11 Fig. S4 with image from Chakraborty et al., 2009
Fig. 3 with image from Uechi et al., 2006
extension morphology, abnormal zf623Tg + MO1-rpl11 Fig. 1Fig. 3 from Ear et al., 2015
eye decreased size, abnormal WT + MO1-rpl11 Fig. 1 with imageFig. S4 with image from Chakraborty et al., 2009
eye pigmentation delayed, abnormal WT + MO1-rpl11 Fig. 1 with image from Chakraborty et al., 2009
fin deformed, abnormal AB + MO1-rpl11 Fig. 3 with image from Uechi et al., 2006
forebrain increased size, abnormal WT + MO1-rpl11 Fig. 1 with image from Chakraborty et al., 2009
forebrain protruding, abnormal AB + MO1-rpl11 Fig. 3 with image from Uechi et al., 2006
fourth ventricle increased size, abnormal AB + MO1-rpl11 Fig. 3 with image from Uechi et al., 2006
fourth ventricle opaque, abnormal AB + MO1-rpl11 Fig. 3 with image from Uechi et al., 2006
gut aplastic, abnormal WT + MO1-rpl11 Fig. 1 with image from Chakraborty et al., 2009
head aplastic, abnormal WT + MO1-rpl11 Fig. 1Fig. 3 from Ear et al., 2015
head decreased size, abnormal WT + MO1-rpl11 Fig. 1 from Ear et al., 2015
Fig. 1 with imageFig. S4 with image from Chakraborty et al., 2009
head bop1 expression increased amount, abnormal WT + MO1-rpl11 Fig. 3 from Chakraborty et al., 2017
head pes expression increased amount, abnormal WT + MO1-rpl11 Fig. 3 from Chakraborty et al., 2017
head ccng1 expression increased amount, abnormal WT + MO1-rpl11 Fig. S3 from Chakraborty et al., 2017
head gnl3 expression increased amount, abnormal WT + MO1-rpl11 Fig. 3 from Chakraborty et al., 2017
head opaque, abnormal WT + MO1-rpl11 Fig. 1 with image from Chakraborty et al., 2009
head apoptotic process increased occurrence, abnormal WT + MO1-rpl11 Fig. 2 with image from Berres et al., 2017
hemopoiesis process quality, abnormal WT + MO1-rpl11 Fig. 1 with imageFig. 4 with image from Zhang et al., 2013
hindbrain malformed, abnormal WT + MO1-rpl11 Fig. 1 with image from Chakraborty et al., 2009
inner ear morphology, abnormal WT + MO1-rpl11 Fig. 1 with image from Chakraborty et al., 2009
intermediate cell mass of mesoderm pcna expression decreased amount, abnormal WT + MO1-rpl11 Fig. 2Fig. 5 from Ear et al., 2015
intermediate cell mass of mesoderm cell population proliferation decreased occurrence, abnormal WT + MO1-rpl11 Fig. 2Fig. 5 from Ear et al., 2015
midbrain hindbrain boundary aplastic, abnormal AB + MO1-rpl11 Fig. 3 with image from Uechi et al., 2006
midbrain-hindbrain boundary structural organization disrupted, abnormal WT + MO1-rpl11 Fig. 1 with image from Chakraborty et al., 2009
nucleate erythrocyte decreased amount, abnormal WT + MO1-rpl11 + MO4-tp53 Fig. 2 from Chakraborty et al., 2017
nucleate erythrocyte increased size, abnormal WT + MO1-rpl11 Fig. 2 from Ear et al., 2015
nucleate erythrocyte irregularly shaped, abnormal WT + MO1-rpl11 Fig. 2 from Ear et al., 2015
optic tectum increased size, abnormal AB + MO1-rpl11 Fig. 3 with image from Uechi et al., 2006
optic tectum opaque, abnormal AB + MO1-rpl11 Fig. 3 with image from Uechi et al., 2006
otic placode decreased size, abnormal AB + MO1-rpl11 Fig. 3 with image from Uechi et al., 2006
otic placode shape, abnormal AB + MO1-rpl11 Fig. 3 with image from Uechi et al., 2006
otolith deformed, abnormal WT + MO1-rpl11 Fig. 1 with image from Chakraborty et al., 2009
pericardium edematous, abnormal WT + MO1-rpl11 Fig. 1 from Liu et al., 2014
Fig. 1 with image from Chakraborty et al., 2009
post-vent region bent, abnormal AB + MO1-rpl11 Fig. 3 with image from Uechi et al., 2006
swim bladder absent, abnormal TU + MO1-rpl11 Fig. 1 from Liu et al., 2014
trunk bent, abnormal AB + MO1-rpl11 Fig. 3 with image from Uechi et al., 2006
whole organism decreased length, abnormal WT + MO1-rpl11 Fig. 1 with image from Chakraborty et al., 2009
whole organism lft1 expression increased amount, abnormal WT + MO1-rpl11 Fig. 6 from Ear et al., 2015
whole organism tp53 expression increased amount, abnormal WT + MO1-rpl11 Fig. 1 from Ear et al., 2015
whole organism mdm2 expression increased amount, abnormal WT + MO1-rpl11 Fig. 1 from Ear et al., 2015
whole organism cdkn1a expression increased amount, abnormal WT + MO1-rpl11 Fig. 1 from Ear et al., 2015
yolk circular, abnormal WT + MO1-rpl11 Fig. S4 with image from Chakraborty et al., 2009
yolk edematous, abnormal WT + MO1-rpl11 Fig. 1Fig. 3 from Ear et al., 2015
yolk grey, abnormal WT + MO1-rpl11 Fig. S4 with image from Chakraborty et al., 2009
Phenotype of all Fish created by or utilizing MO1-rpl11
Phenotype Fish Conditions Figures
otic placode shape, abnormal AB + MO1-rpl11 standard conditions Fig. 3 with image from Uechi et al., 2006
fourth ventricle opaque, abnormal AB + MO1-rpl11 standard conditions Fig. 3 with image from Uechi et al., 2006
extension decreased thickness, abnormal AB + MO1-rpl11 standard conditions Fig. 3 with image from Uechi et al., 2006
midbrain hindbrain boundary aplastic, abnormal AB + MO1-rpl11 standard conditions Fig. 3 with image from Uechi et al., 2006
otic placode decreased size, abnormal AB + MO1-rpl11 standard conditions Fig. 3 with image from Uechi et al., 2006
optic tectum opaque, abnormal AB + MO1-rpl11 standard conditions Fig. 3 with image from Uechi et al., 2006
fourth ventricle increased size, abnormal AB + MO1-rpl11 standard conditions Fig. 3 with image from Uechi et al., 2006
fin deformed, abnormal AB + MO1-rpl11 standard conditions Fig. 3 with image from Uechi et al., 2006
trunk bent, abnormal AB + MO1-rpl11 standard conditions Fig. 3 with image from Uechi et al., 2006
post-vent region bent, abnormal AB + MO1-rpl11 standard conditions Fig. 3 with image from Uechi et al., 2006
cerebellum aplastic, abnormal AB + MO1-rpl11 standard conditions Fig. 3 with image from Uechi et al., 2006
optic tectum increased size, abnormal AB + MO1-rpl11 standard conditions Fig. 3 with image from Uechi et al., 2006
forebrain protruding, abnormal AB + MO1-rpl11 standard conditions Fig. 3 with image from Uechi et al., 2006
swim bladder absent, abnormal TU + MO1-rpl11 standard conditions Fig. 1 from Liu et al., 2014
pericardium edematous, abnormal TU + MO1-rpl11 standard conditions Fig. 1 from Liu et al., 2014
whole organism cdkn1a expression increased amount, abnormal WT + MO1-rpl11 standard conditions Fig. 1 from Ear et al., 2015
extension decreased thickness, abnormal WT + MO1-rpl11 standard conditions Fig. S4 with image from Chakraborty et al., 2009
forebrain increased size, abnormal WT + MO1-rpl11 standard conditions Fig. 1 with image from Chakraborty et al., 2009
intermediate cell mass of mesoderm pcna expression decreased amount, abnormal WT + MO1-rpl11 standard conditions Fig. 2Fig. 5 from Ear et al., 2015
nucleate erythrocyte irregularly shaped, abnormal WT + MO1-rpl11 standard conditions Fig. 2 from Ear et al., 2015
whole organism decreased length, abnormal WT + MO1-rpl11 standard conditions Fig. 1 with image from Chakraborty et al., 2009
head pes expression increased amount, abnormal WT + MO1-rpl11 standard conditions Fig. 3 from Chakraborty et al., 2017
erythroid lineage cell absent, abnormal WT + MO1-rpl11 standard conditions Fig. 1Fig. 3Fig. 5 from Ear et al., 2015
yolk circular, abnormal WT + MO1-rpl11 standard conditions Fig. S4 with image from Chakraborty et al., 2009
mandibular arch skeleton malformed, exacerbated WT + MO1-rpl11 chemical treatment by environment: ethanol Fig. 1 with image from Berres et al., 2017
intermediate cell mass of mesoderm cell population proliferation decreased occurrence, abnormal WT + MO1-rpl11 standard conditions Fig. 2Fig. 5 from Ear et al., 2015
inner ear morphology, abnormal WT + MO1-rpl11 standard conditions Fig. 1 with image from Chakraborty et al., 2009
Meckel's cartilage malformed, exacerbated WT + MO1-rpl11 chemical treatment by environment: ethanol Fig. 1 with image from Berres et al., 2017
caudal fin shortened, abnormal WT + MO1-rpl11 standard conditions Fig. 1 from Ear et al., 2015
head apoptotic process increased occurrence, exacerbated WT + MO1-rpl11 chemical treatment by environment: ethanol Fig. 2 with image from Berres et al., 2017
pericardium edematous, abnormal WT + MO1-rpl11 standard conditions Fig. 1 with image from Chakraborty et al., 2009
head apoptotic process increased occurrence, abnormal WT + MO1-rpl11 control Fig. 2 with image from Berres et al., 2017
otolith deformed, abnormal WT + MO1-rpl11 standard conditions Fig. 1 with image from Chakraborty et al., 2009
Meckel's cartilage decreased length, exacerbated WT + MO1-rpl11 chemical treatment by environment: ethanol Fig. 1 with image from Berres et al., 2017
extension morphology, abnormal WT + MO1-rpl11 standard conditions Fig. 1 from Ear et al., 2015
heart edematous, exacerbated WT + MO1-rpl11 chemical treatment by environment: ethanol Fig. 1 with image from Berres et al., 2017
head bop1 expression increased amount, abnormal WT + MO1-rpl11 standard conditions Fig. 3 from Chakraborty et al., 2017
whole organism mdm2 expression increased amount, abnormal WT + MO1-rpl11 standard conditions Fig. 1 from Ear et al., 2015
eye decreased size, abnormal WT + MO1-rpl11 standard conditions Fig. 1 with imageFig. S4 with image from Chakraborty et al., 2009
embryonic neurocranium morphogenesis decreased process quality, exacerbated WT + MO1-rpl11 chemical treatment by environment: ethanol Fig. 1 with image from Berres et al., 2017
yolk edematous, abnormal WT + MO1-rpl11 standard conditions Fig. 1 from Ear et al., 2015
apoptotic process increased occurrence, abnormal WT + MO1-rpl11 standard conditions Fig. 4 with image from Chakraborty et al., 2009
whole organism tp53 expression increased amount, abnormal WT + MO1-rpl11 standard conditions Fig. 1 from Ear et al., 2015
eye pigmentation delayed, abnormal WT + MO1-rpl11 standard conditions Fig. 1 with image from Chakraborty et al., 2009
nucleate erythrocyte increased size, abnormal WT + MO1-rpl11 standard conditions Fig. 2 from Ear et al., 2015
midbrain-hindbrain boundary structural organization disrupted, abnormal WT + MO1-rpl11 standard conditions Fig. 1 with image from Chakraborty et al., 2009
extension decreased size, abnormal WT + MO1-rpl11 standard conditions Fig. 1 with image from Chakraborty et al., 2009
head ccng1 expression increased amount, abnormal WT + MO1-rpl11 standard conditions Fig. S3 from Chakraborty et al., 2017
hemopoiesis process quality, abnormal WT + MO1-rpl11 standard conditions Fig. 1 with imageFig. 4 with image from Zhang et al., 2013
head opaque, abnormal WT + MO1-rpl11 standard conditions Fig. 1 with image from Chakraborty et al., 2009
neurocranium malformed, exacerbated WT + MO1-rpl11 chemical treatment by environment: ethanol Fig. 1 with image from Berres et al., 2017
head aplastic, abnormal WT + MO1-rpl11 standard conditions Fig. 1 from Ear et al., 2015
yolk grey, abnormal WT + MO1-rpl11 standard conditions Fig. S4 with image from Chakraborty et al., 2009
whole organism lft1 expression increased amount, abnormal WT + MO1-rpl11 standard conditions Fig. 6 from Ear et al., 2015
head gnl3 expression increased amount, abnormal WT + MO1-rpl11 standard conditions Fig. 3 from Chakraborty et al., 2017
gut aplastic, abnormal WT + MO1-rpl11 standard conditions Fig. 1 with image from Chakraborty et al., 2009
embryonic cranial skeleton morphogenesis decreased process quality, exacerbated WT + MO1-rpl11 chemical treatment by environment: ethanol Fig. 1 with image from Berres et al., 2017
head decreased size, abnormal WT + MO1-rpl11 standard conditions Fig. 1 from Ear et al., 2015
Fig. 1 with imageFig. S4 with image from Chakraborty et al., 2009
hindbrain malformed, abnormal WT + MO1-rpl11 standard conditions Fig. 1 with image from Chakraborty et al., 2009
nucleate erythrocyte decreased amount, abnormal WT + MO1-rpl11 + MO4-tp53 standard conditions Fig. 2 from Chakraborty et al., 2017
hemopoiesis process quality, abnormal WT + MO1-rpl11 + MO4-tp53 standard conditions Fig. 4 with image from Zhang et al., 2013
erythroid lineage cell EGFP expression decreased amount, abnormal cz3325Tg + MO1-rpl11 standard conditions Fig. 2 from Ear et al., 2015
erythroid lineage cell increased size, abnormal cz3325Tg + MO1-rpl11 standard conditions Fig. 2 from Ear et al., 2015
yolk edematous, abnormal zf623Tg + MO1-rpl11 standard conditions Fig. 3 from Ear et al., 2015
extension morphology, abnormal zf623Tg + MO1-rpl11 standard conditions Fig. 3 from Ear et al., 2015
head aplastic, abnormal zf623Tg + MO1-rpl11 standard conditions Fig. 3 from Ear et al., 2015
erythroid lineage cell decreased amount, abnormal zf623Tg + MO1-rpl11 standard conditions Fig. 3 from Ear et al., 2015
erythroid lineage cell absent, abnormal zf623Tg + MO1-rpl11 standard conditions Fig. 3 from Ear et al., 2015
nucleate erythrocyte decreased amount, abnormal tp53zdf1/zdf1 + MO1-rpl11 standard conditions Fig. 2 from Chakraborty et al., 2017
apoptotic process increased occurrence, abnormal WT + MO1-rpl11 + MO1-rpl23 + MO1-rpl5a standard conditions Fig. S5 with image from Chakraborty et al., 2009
brain deformed, abnormal WT + MO1-rpl11 + MO1-rpl23 + MO1-rpl5a standard conditions Fig. S5 with image from Chakraborty et al., 2009
brain morphogenesis disrupted, abnormal WT + MO1-rpl11 + MO1-rpl23 + MO1-rpl5a standard conditions Fig. S5 with image from Chakraborty et al., 2009
Citations