Function of mRpL4 in zebrafish A. Schematic diagrams of wild‐type (WT) and the zmRpL4 mutant allele (mu) generated by the CRISPR‐Cas9 genome editing system. The mutant allele contains a 24‐bp deletion (GTCCCAGCTCACTTGACACCAGCG, in blue) and a 2‐bp insertion (TA, in red) in the third exon. As a result, the mutant allele encodes a small polypeptide of 100 amino acid residues containing part of the wild‐type residues and a disordered Carbon‐terminal tail due to frame shifting (amino acid, in red). B. The mRNA levels of zmRpL4 in wild‐type control and mrpl4‐null larvae at 5 dpf as measured by quantitative PCR (three biological replicates for each genotype and three technical replicates for each sample). Statistical significance was tested using two‐tailed unpaired t‐test. Error bars represent ± SD, ****P < 0.00001. C. Bar graph showing relative levels of Notch signaling target genes her4.1 and her6 in mrpl4‐null larvae comparing to wild‐type control at 5 dpf as measured by quantitative PCR (n = 3 biological replicates per group). Statistical significance was tested using two‐tailed unpaired t‐test. Error bars represent ± SD; n.s., not significant.
|
