Fig. EV5
- ID
- ZDB-IMAGE-241002-52
- Genes
- Publication
- Mo et al., 2023 - The mitochondrial ribosomal protein mRpL4 regulates Notch signaling
- All Figures
- Figures for Mo et al., 2023
Fig. EV5 Function of mRpL4 in zebrafish A. Schematic diagrams of wild‐type (WT) and the zmRpL4 mutant allele (mu) generated by the CRISPR‐Cas9 genome editing system. The mutant allele contains a 24‐bp deletion (GTCCCAGCTCACTTGACACCAGCG, in blue) and a 2‐bp insertion (TA, in red) in the third exon. As a result, the mutant allele encodes a small polypeptide of 100 amino acid residues containing part of the wild‐type residues and a disordered Carbon‐terminal tail due to frame shifting (amino acid, in red). B. The mRNA levels of zmRpL4 in wild‐type control and mrpl4‐null larvae at 5 dpf as measured by quantitative PCR (three biological replicates for each genotype and three technical replicates for each sample). Statistical significance was tested using two‐tailed unpaired t‐test. Error bars represent ± SD, ****P < 0.00001. C. Bar graph showing relative levels of Notch signaling target genes her4.1 and her6 in mrpl4‐null larvae comparing to wild‐type control at 5 dpf as measured by quantitative PCR (n = 3 biological replicates per group). Statistical significance was tested using two‐tailed unpaired t‐test. Error bars represent ± SD; n.s., not significant.