header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-CRISPR-180606-1
CRISPR Name: CRISPR1-nr2f1a
Target: nr2f1a (1)
Source:
Target Sequence:
5' - GGCCAGTATGCGCTAACGAATGG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR1-nr2f1a No data available
GENOMIC FEATURES CREATED WITH CRISPR1-nr2f1a
Genomic Feature Affected Genomic Regions    
ci1009 nr2f1a    
GENE EXPRESSION
Gene expression in Wild Types + CRISPR1-nr2f1a No data available
PHENOTYPE
Phenotype resulting from CRISPR1-nr2f1a
No data available

Phenotype of all Fish created by or utilizing CRISPR1-nr2f1a
OTHER CRISPR1-nr2f1a CRISPR PAGES No links to external sites
CITATIONS (1)