Mapping Details

Genome Browser Chr Position Assembly ZFIN JBrowse 7 40,884,012 - 40,893,295 GRCz11 Ensembl 7 40,884,012 - 40,893,295 GRCz11 Vega 7 40,603,939 - 40,613,222 GRCv10 NCBI Map Viewer 7 40,884,012 - 40,891,326 GRCz11 UCSC 7 - GRCv10

Mapped Clones containing shha
CH211-105D1	Chr: 7 Details
CH211-150E22	Chr: 7 Details

GENETIC MAPPING PANELS

Chr	Location	Mapped As	Panel	Mapped By	Scoring
7	111.6 cM	shh	Mother of Pearl (MOP)	Postlethwait, John H.	Data
7	165.63 cR	shh	Loeb/NIH/5000/4000 (LN54)	Dawid, Igor B.	Data
7	4073.0 cR	shh	Goodfellow T51 (T51)	Geisler, Robert	Data
7	86.7 cM	shh	Heat Shock (HS)	Woods, Ian G.	Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location. Note: Physical map location should be used whenever possible.

MAPPING FROM PUBLICATIONS

Marker	Type	Chr	Distance	Publication / Person	Comments
en2a	GENE	7		Bertrand et al., 2001	Bertrand, C. et al. (2001, J. Biol. Chem. 276(1):464-474) mapped ache to LG7 on the MOP panel.
ccne1	GENE	7		Bertrand et al., 2001	Bertrand, C. et al. (2001, J. Biol. Chem. 276(1):464-474) mapped ache to LG7 on the MOP panel.
isl2b	GENE	7		Bertrand et al., 2001	Bertrand, C. et al. (2001, J. Biol. Chem. 276(1):464-474) mapped ache to LG7 on the MOP panel.
foxb1b	GENE	7		Bertrand et al., 2001	Bertrand, C. et al. (2001, J. Biol. Chem. 276(1):464-474) mapped ache to LG7 on the MOP panel.
z1059	SSLP	7		Bertrand et al., 2001	Bertrand, C. et al. (2001, J. Biol. Chem. 276(1):464-474) mapped ache to LG7 on the MOP panel.
z1182	SSLP	7		Bertrand et al., 2001	Bertrand, C. et al. (2001, J. Biol. Chem. 276(1):464-474) mapped ache to LG7 on the MOP panel.
z3445	SSLP	7		Bertrand et al., 2001	Bertrand, C. et al. (2001, J. Biol. Chem. 276(1):464-474) mapped ache to LG7 on the MOP panel.
z4706	SSLP	7		Bertrand et al., 2001	Bertrand, C. et al. (2001, J. Biol. Chem. 276(1):464-474) mapped ache to LG7 on the MOP panel.
ache	GENE	7		Bertrand et al., 2001	Bertrand, C. et al. (2001, J. Biol. Chem. 276(1):464-474) mapped ache to LG7 on the MOP panel.

OTHER MAPPING INFORMATION

Chr 7 Bertrand et al., 2001 Bertrand, C. et al. (2001, J. Biol. Chem. 276(1):464-474) mapped ache to LG7 on the MOP  ... Bertrand, C. et al. (2001, J. Biol. Chem. 276(1):464-474) mapped ache to LG7 on the MOP panel.

Markers Encoded by shha
fc83d08 Chr: 7 Details

Primer Sets:

Strain	Bandsize	Restriction Enzyme	Annealing Temperature [C]
SJD	369	MnlI	36.0
Forward Primer	ACACACACACGGAGTCGAAT
Reverse Primer	AAAGAAACAGCTCAAGACTGCA