header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-161116-2
Morpholino Name: MO1-znf644b
Target: znf644b (1)
Sequence:
5' - GTGAGCAATAATCACCTTTTCTGAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATIONS
View all 3 target locations
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-znf644b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-znf644b
Expressed Gene Anatomy Figures
atoh7 Fig. 3 with image from Olsen et al., 2016
ccnd1 Fig. 3 with imageFig. 7 with image from Olsen et al., 2016
lef1 Fig. S3 with image from Olsen et al., 2016
otx2b Fig. 3 with imageFig. S3 with image from Olsen et al., 2016
rx3 Fig. 3 with image from Olsen et al., 2016
vsx2 Fig. 3 with imageFig. S3 with image from Olsen et al., 2016
PHENOTYPE
Phenotype resulting from MO1-znf644b
Phenotype Figures
eye decreased size, abnormal Fig. 2 with imageFig. S2 with image from Olsen et al., 2016
hindbrain neuron vsx2 expression mislocalised, abnormal Fig. S3 with image from Olsen et al., 2016
hindbrain neuron vsx2 expression spatial pattern, abnormal Fig. S3 with image from Olsen et al., 2016
midbrain lef1 expression decreased amount, abnormal Fig. S3 with image from Olsen et al., 2016
midbrain ccnd1 expression mislocalised, abnormal Fig. 7 with image from Olsen et al., 2016
midbrain morphology, abnormal Fig. 2 with imageFig. S2 with image from Olsen et al., 2016
midbrain ccnd1 expression spatial pattern, abnormal Fig. 7 with image from Olsen et al., 2016
midbrain apoptotic process increased occurrence, abnormal Fig. 7 with image from Olsen et al., 2016
regulation of gene silencing disrupted, abnormal Fig. 3 with image from Olsen et al., 2016
retina ab5-casp3 labeling increased amount, abnormal Fig. 5 with image from Olsen et al., 2016
retina apoptotic process increased occurrence, abnormal Fig. 5 with image from Olsen et al., 2016
retina apoptotic process process quality, ameliorated Fig. 5 with image from Olsen et al., 2016
retina cell population proliferation increased occurrence, abnormal Fig. 4 with image from Olsen et al., 2016
retina central region vsx2 expression mislocalised, abnormal Fig. 3 with imageFig. S3 with image from Olsen et al., 2016
retina central region ccnd1 expression mislocalised, abnormal Fig. 3 with image from Olsen et al., 2016
retina central region vsx2 expression spatial pattern, abnormal Fig. 3 with image from Olsen et al., 2016
retina central region ccnd1 expression spatial pattern, abnormal Fig. 3 with image from Olsen et al., 2016
retina multi fate stem cell otx2b expression increased amount, abnormal Fig. 3 with imageFig. S3 with image from Olsen et al., 2016
retina multi fate stem cell otx2b expression spatial pattern, abnormal Fig. 3 with imageFig. S3 with image from Olsen et al., 2016

Phenotype of all Fish created by or utilizing MO1-znf644b
Phenotype Fish Conditions Figures
retina central region vsx2 expression mislocalised, abnormal AB + MO1-znf644b standard conditions Fig. 3 with imageFig. S3 with image from Olsen et al., 2016
retina central region ccnd1 expression mislocalised, abnormal AB + MO1-znf644b standard conditions Fig. 3 with image from Olsen et al., 2016
midbrain lef1 expression decreased amount, abnormal AB + MO1-znf644b standard conditions Fig. S3 with image from Olsen et al., 2016
retina central region vsx2 expression spatial pattern, abnormal AB + MO1-znf644b standard conditions Fig. 3 with image from Olsen et al., 2016
midbrain ccnd1 expression mislocalised, abnormal AB + MO1-znf644b standard conditions Fig. 7 with image from Olsen et al., 2016
retina ab5-casp3 labeling increased amount, abnormal AB + MO1-znf644b standard conditions Fig. 5 with image from Olsen et al., 2016
midbrain apoptotic process increased occurrence, abnormal AB + MO1-znf644b standard conditions Fig. 7 with image from Olsen et al., 2016
midbrain ccnd1 expression spatial pattern, abnormal AB + MO1-znf644b standard conditions Fig. 7 with image from Olsen et al., 2016
midbrain morphology, abnormal AB + MO1-znf644b standard conditions Fig. 2 with imageFig. S2 with image from Olsen et al., 2016
retina multi fate stem cell otx2b expression increased amount, abnormal AB + MO1-znf644b standard conditions Fig. 3 with imageFig. S3 with image from Olsen et al., 2016
regulation of gene silencing disrupted, abnormal AB + MO1-znf644b standard conditions Fig. 3 with image from Olsen et al., 2016
retina multi fate stem cell otx2b expression spatial pattern, abnormal AB + MO1-znf644b standard conditions Fig. 3 with imageFig. S3 with image from Olsen et al., 2016
retina cell population proliferation increased occurrence, abnormal AB + MO1-znf644b standard conditions Fig. 4 with image from Olsen et al., 2016
retina apoptotic process increased occurrence, abnormal AB + MO1-znf644b standard conditions Fig. 5 with image from Olsen et al., 2016
hindbrain neuron vsx2 expression spatial pattern, abnormal AB + MO1-znf644b standard conditions Fig. S3 with image from Olsen et al., 2016
eye decreased size, abnormal AB + MO1-znf644b standard conditions Fig. 2 with imageFig. S2 with image from Olsen et al., 2016
retina central region ccnd1 expression spatial pattern, abnormal AB + MO1-znf644b standard conditions Fig. 3 with image from Olsen et al., 2016
hindbrain neuron vsx2 expression mislocalised, abnormal AB + MO1-znf644b standard conditions Fig. S3 with image from Olsen et al., 2016
retina apoptotic process process quality, ameliorated AB + MO1-znf644b + MO4-tp53 standard conditions Fig. 5 with image from Olsen et al., 2016
retina apoptotic process increased occurrence, abnormal AB + MO1-ehmt2 + MO1-znf644b standard conditions Fig. 6 with image from Olsen et al., 2016
retina central region vsx2 expression mislocalised, abnormal AB + MO1-ehmt2 + MO1-znf644b standard conditions Fig. 6 with image from Olsen et al., 2016
midbrain ccnd1 expression mislocalised, abnormal AB + MO1-ehmt2 + MO1-znf644b standard conditions Fig. S6 with image from Olsen et al., 2016
midbrain ccnd1 expression spatial pattern, abnormal AB + MO1-ehmt2 + MO1-znf644b standard conditions Fig. S6 with image from Olsen et al., 2016
retina central region ccnd1 expression spatial pattern, abnormal AB + MO1-ehmt2 + MO1-znf644b standard conditions Fig. S6 with image from Olsen et al., 2016
retina central region ccnd1 expression mislocalised, abnormal AB + MO1-ehmt2 + MO1-znf644b standard conditions Fig. S6 with image from Olsen et al., 2016
retina cell population proliferation increased occurrence, abnormal AB + MO1-ehmt2 + MO1-znf644b standard conditions Fig. 6 with imageFig. S6 with image from Olsen et al., 2016
retina ab5-casp3 labeling increased amount, abnormal AB + MO1-ehmt2 + MO1-znf644b standard conditions Fig. 6 with image from Olsen et al., 2016
retina central region vsx2 expression mislocalised, abnormal AB + MO1-znf644a + MO1-znf644b standard conditions Fig. 6 with image from Olsen et al., 2016
retina central region ccnd1 expression spatial pattern, abnormal AB + MO1-znf644a + MO1-znf644b standard conditions Fig. S6 with image from Olsen et al., 2016
midbrain ccnd1 expression spatial pattern, abnormal AB + MO1-znf644a + MO1-znf644b standard conditions Fig. S6 with image from Olsen et al., 2016
midbrain ccnd1 expression mislocalised, abnormal AB + MO1-znf644a + MO1-znf644b standard conditions Fig. S6 with image from Olsen et al., 2016
retina central region ccnd1 expression mislocalised, abnormal AB + MO1-znf644a + MO1-znf644b standard conditions Fig. S6 with image from Olsen et al., 2016
retina cell population proliferation increased occurrence, abnormal AB + MO1-znf644a + MO1-znf644b standard conditions Fig. 6 with imageFig. S6 with image from Olsen et al., 2016
OTHER MO1-znf644b MORPHOLINO PAGESNo links to external sites
CITATIONS (1)