header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-161116-1
Morpholino Name: MO1-znf644a
Target: znf644a (1)
Sequence:
5' - ATTAAAATTGTCACCTGTTTTGACT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-znf644a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-znf644a
Expressed Gene Anatomy Figures
atoh7 Fig. 3 with image from Olsen et al., 2016
ccnd1 Fig. 3 with imageFig. 7 with image from Olsen et al., 2016
lef1 Fig. S3 with image from Olsen et al., 2016
otx2b Fig. 3 with imageFig. S3 with image from Olsen et al., 2016
rx3 Fig. 3 with image from Olsen et al., 2016
vsx2 Fig. 3 with imageFig. 5 with imageFig. S3 with image from Olsen et al., 2016
PHENOTYPE
Phenotype resulting from MO1-znf644a
Phenotype Figures
amacrine cell ab1-gaba labeling absent, abnormal Fig. 4 with image from Olsen et al., 2016
amacrine cell ab1-pax6 labeling absent, abnormal Fig. 5 with image from Olsen et al., 2016
cell proliferation in midbrain increased occurrence, abnormal Fig. 7 with image from Olsen et al., 2016
ciliary marginal zone cell vsx2 expression increased distribution, abnormal Fig. 5 with image from Olsen et al., 2016
ciliary marginal zone cell vsx2 expression spatial pattern, abnormal Fig. 5 with image from Olsen et al., 2016
eye decreased size, abnormal Fig. 2 with imageFig. S2 with image from Olsen et al., 2016
hindbrain neuron vsx2 expression mislocalised, abnormal Fig. S3 with image from Olsen et al., 2016
hindbrain neuron vsx2 expression spatial pattern, abnormal Fig. S3 with image from Olsen et al., 2016
midbrain lef1 expression decreased amount, abnormal Fig. S3 with image from Olsen et al., 2016
midbrain ccnd1 expression mislocalised, abnormal Fig. 7 with image from Olsen et al., 2016
midbrain morphology, abnormal Fig. 2 with imageFig. S2 with image from Olsen et al., 2016
midbrain ccnd1 expression spatial pattern, abnormal Fig. 7 with image from Olsen et al., 2016
regulation of gene silencing disrupted, abnormal Fig. 3 with image from Olsen et al., 2016
retina cell population proliferation increased occurrence, abnormal Fig. 4 with image from Olsen et al., 2016
retina central region vsx2 expression mislocalised, abnormal Fig. 3 with imageFig. S3 with image from Olsen et al., 2016
retina central region ccnd1 expression mislocalised, abnormal Fig. 3 with image from Olsen et al., 2016
retina central region ccnd1 expression spatial pattern, abnormal Fig. 3 with image from Olsen et al., 2016
retina central region vsx2 expression spatial pattern, abnormal Fig. 3 with image from Olsen et al., 2016
retina multi fate stem cell otx2b expression increased amount, abnormal Fig. 3 with imageFig. S3 with image from Olsen et al., 2016
retina multi fate stem cell rx3 expression increased amount, abnormal Fig. 3 with image from Olsen et al., 2016
retina multi fate stem cell rx3 expression spatial pattern, abnormal Fig. 3 with image from Olsen et al., 2016
retina multi fate stem cell otx2b expression spatial pattern, abnormal Fig. 3 with imageFig. S3 with image from Olsen et al., 2016
retina neuroblast atoh7 expression increased amount, abnormal Fig. 3 with image from Olsen et al., 2016
retina neuroblast atoh7 expression spatial pattern, abnormal Fig. 3 with image from Olsen et al., 2016
retinal bipolar neuron ab2-prkcb labeling absent, abnormal Fig. 4 with image from Olsen et al., 2016
retinal bipolar neuron ab1-pax6 labeling absent, abnormal Fig. 5 with image from Olsen et al., 2016
retinal bipolar neuron vsx2 expression increased distribution, abnormal Fig. 5 with image from Olsen et al., 2016
retinal bipolar neuron vsx2 expression spatial pattern, abnormal Fig. 5 with image from Olsen et al., 2016
retinal bipolar neuron nucleus Ab34-h3 labeling absent, abnormal Fig. 5 with image from Olsen et al., 2016
retinal cone cell zpr-1 labeling absent, abnormal Fig. 4 with image from Olsen et al., 2016
retinal ganglion cell ab1-pax6 labeling absent, abnormal Fig. 5 with image from Olsen et al., 2016

Phenotype of all Fish created by or utilizing MO1-znf644a
Phenotype Fish Conditions Figures
retina central region vsx2 expression spatial pattern, abnormal AB + MO1-znf644a standard conditions Fig. 3 with image from Olsen et al., 2016
midbrain lef1 expression decreased amount, abnormal AB + MO1-znf644a standard conditions Fig. S3 with image from Olsen et al., 2016
retina central region ccnd1 expression mislocalised, abnormal AB + MO1-znf644a standard conditions Fig. 3 with image from Olsen et al., 2016
ciliary marginal zone cell vsx2 expression increased distribution, abnormal AB + MO1-znf644a standard conditions Fig. 5 with image from Olsen et al., 2016
retina multi fate stem cell rx3 expression increased amount, abnormal AB + MO1-znf644a standard conditions Fig. 3 with image from Olsen et al., 2016
retinal bipolar neuron nucleus Ab34-h3 labeling absent, abnormal AB + MO1-znf644a standard conditions Fig. 5 with image from Olsen et al., 2016
retina multi fate stem cell rx3 expression spatial pattern, abnormal AB + MO1-znf644a standard conditions Fig. 3 with image from Olsen et al., 2016
retina central region vsx2 expression mislocalised, abnormal AB + MO1-znf644a standard conditions Fig. 3 with imageFig. S3 with image from Olsen et al., 2016
retina neuroblast atoh7 expression spatial pattern, abnormal AB + MO1-znf644a standard conditions Fig. 3 with image from Olsen et al., 2016
cell proliferation in midbrain increased occurrence, abnormal AB + MO1-znf644a standard conditions Fig. 7 with image from Olsen et al., 2016
midbrain morphology, abnormal AB + MO1-znf644a standard conditions Fig. 2 with imageFig. S2 with image from Olsen et al., 2016
retina multi fate stem cell otx2b expression increased amount, abnormal AB + MO1-znf644a standard conditions Fig. 3 with imageFig. S3 with image from Olsen et al., 2016
regulation of gene silencing disrupted, abnormal AB + MO1-znf644a standard conditions Fig. 3 with image from Olsen et al., 2016
midbrain ccnd1 expression spatial pattern, abnormal AB + MO1-znf644a standard conditions Fig. 7 with image from Olsen et al., 2016
midbrain ccnd1 expression mislocalised, abnormal AB + MO1-znf644a standard conditions Fig. 7 with image from Olsen et al., 2016
retina multi fate stem cell otx2b expression spatial pattern, abnormal AB + MO1-znf644a standard conditions Fig. 3 with imageFig. S3 with image from Olsen et al., 2016
retina cell population proliferation increased occurrence, abnormal AB + MO1-znf644a standard conditions Fig. 4 with image from Olsen et al., 2016
retinal bipolar neuron ab1-pax6 labeling absent, abnormal AB + MO1-znf644a standard conditions Fig. 5 with image from Olsen et al., 2016
ciliary marginal zone cell vsx2 expression spatial pattern, abnormal AB + MO1-znf644a standard conditions Fig. 5 with image from Olsen et al., 2016
retinal cone cell zpr-1 labeling absent, abnormal AB + MO1-znf644a standard conditions Fig. 4 with image from Olsen et al., 2016
retina neuroblast atoh7 expression increased amount, abnormal AB + MO1-znf644a standard conditions Fig. 3 with image from Olsen et al., 2016
hindbrain neuron vsx2 expression mislocalised, abnormal AB + MO1-znf644a standard conditions Fig. S3 with image from Olsen et al., 2016
retinal ganglion cell ab1-pax6 labeling absent, abnormal AB + MO1-znf644a standard conditions Fig. 5 with image from Olsen et al., 2016
eye decreased size, abnormal AB + MO1-znf644a standard conditions Fig. 2 with imageFig. S2 with image from Olsen et al., 2016
amacrine cell ab1-pax6 labeling absent, abnormal AB + MO1-znf644a standard conditions Fig. 5 with image from Olsen et al., 2016
retina central region ccnd1 expression spatial pattern, abnormal AB + MO1-znf644a standard conditions Fig. 3 with image from Olsen et al., 2016
retinal bipolar neuron ab2-prkcb labeling absent, abnormal AB + MO1-znf644a standard conditions Fig. 4 with image from Olsen et al., 2016
retinal bipolar neuron vsx2 expression increased distribution, abnormal AB + MO1-znf644a standard conditions Fig. 5 with image from Olsen et al., 2016
retinal bipolar neuron vsx2 expression spatial pattern, abnormal AB + MO1-znf644a standard conditions Fig. 5 with image from Olsen et al., 2016
hindbrain neuron vsx2 expression spatial pattern, abnormal AB + MO1-znf644a standard conditions Fig. S3 with image from Olsen et al., 2016
amacrine cell ab1-gaba labeling absent, abnormal AB + MO1-znf644a standard conditions Fig. 4 with image from Olsen et al., 2016
retina central region vsx2 expression mislocalised, abnormal AB + MO1-ehmt2 + MO1-znf644a standard conditions Fig. 6 with image from Olsen et al., 2016
retina central region ccnd1 expression spatial pattern, abnormal AB + MO1-ehmt2 + MO1-znf644a standard conditions Fig. S6 with image from Olsen et al., 2016
midbrain ccnd1 expression mislocalised, abnormal AB + MO1-ehmt2 + MO1-znf644a standard conditions Fig. S6 with image from Olsen et al., 2016
midbrain ccnd1 expression spatial pattern, abnormal AB + MO1-ehmt2 + MO1-znf644a standard conditions Fig. S6 with image from Olsen et al., 2016
retina central region ccnd1 expression mislocalised, abnormal AB + MO1-ehmt2 + MO1-znf644a standard conditions Fig. S6 with image from Olsen et al., 2016
retina cell population proliferation increased occurrence, abnormal AB + MO1-ehmt2 + MO1-znf644a standard conditions Fig. 6 with imageFig. S6 with image from Olsen et al., 2016
retina central region vsx2 expression mislocalised, abnormal AB + MO1-znf644a + MO1-znf644b standard conditions Fig. 6 with image from Olsen et al., 2016
retina central region ccnd1 expression spatial pattern, abnormal AB + MO1-znf644a + MO1-znf644b standard conditions Fig. S6 with image from Olsen et al., 2016
midbrain ccnd1 expression spatial pattern, abnormal AB + MO1-znf644a + MO1-znf644b standard conditions Fig. S6 with image from Olsen et al., 2016
midbrain ccnd1 expression mislocalised, abnormal AB + MO1-znf644a + MO1-znf644b standard conditions Fig. S6 with image from Olsen et al., 2016
retina central region ccnd1 expression mislocalised, abnormal AB + MO1-znf644a + MO1-znf644b standard conditions Fig. S6 with image from Olsen et al., 2016
retina cell population proliferation increased occurrence, abnormal AB + MO1-znf644a + MO1-znf644b standard conditions Fig. 6 with imageFig. S6 with image from Olsen et al., 2016
OTHER MO1-znf644a MORPHOLINO PAGESNo links to external sites
CITATIONS (1)