ZFIN ID: ZDB-MRPHLNO-150316-3
Morpholino Name: MO2-ncor2
Target: ncor2 (1)
Previous Name: ncor2 MO1 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GATGAGGCTGGACCAGAGATCCATG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-ncor2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-ncor2
Expressed Gene Anatomy Figures
etv2 Fig. 5 with image from Li et al., 2014
fli1a Fig. 2 with image from Li et al., 2014
gata1a Fig. 2 with image from Li et al., 2014
lmo2 Fig. 5 with image from Li et al., 2014
mfap4 Fig. 1 with imageFig. 3 with imageFig. 6 with imageFig. 7 with image from Li et al., 2014
mpx Fig. 1 with imageFig. 3 with imageFig. 6 with imageFig. 7 with image from Li et al., 2014
spi1b Fig. 4 with imageFig. 7 with image from Li et al., 2014
tal1 Fig. 5 with image from Li et al., 2014
PHENOTYPE
Phenotype resulting from MO2-ncor2
Phenotype Figures
apoptotic process increased process quality, abnormal Fig. 3 with image from Li et al., 2014
macrophage decreased amount, abnormal Fig. 1 with imageFig. 3 with imageFig. 6 with imageFig. 7 with image from Li et al., 2014
neutrophil decreased amount, abnormal Fig. 1 with imageFig. 3 with imageFig. 6 with imageFig. 7 with image from Li et al., 2014

Phenotype of all Fish created by or utilizing MO2-ncor2
Phenotype Fish Conditions Figures
macrophage decreased amount, abnormal WT + MO2-ncor2 standard conditions Fig. 1 with imageFig. 3 with imageFig. 6 with imageFig. 7 with image from Li et al., 2014
apoptotic process increased process quality, abnormal WT + MO2-ncor2 standard conditions Fig. 3 with image from Li et al., 2014
neutrophil decreased amount, abnormal WT + MO2-ncor2 standard conditions Fig. 1 with imageFig. 3 with imageFig. 6 with imageFig. 7 with image from Li et al., 2014
macrophage decreased amount, abnormal WT + MO2-ncor2 + MO4-tp53 standard conditions Fig. 3 with image from Li et al., 2014
neutrophil decreased amount, abnormal WT + MO2-ncor2 + MO4-tp53 standard conditions Fig. 3 with image from Li et al., 2014
OTHER MO2-ncor2 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)