header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-070109-1
Morpholino Name: MO1-smc3
Target: smc3 (1)
Sequence:
5' - GTACATGGCGGTTTATGCACAAAAC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-smc3 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-smc3
Expressed Gene Anatomy Figures
baxa Fig. 4 with image from Ghiselli, 2006
ccnd1 Fig. 4 with image from Ghiselli, 2006
foxa2 Fig. 8 with image from Muto et al., 2011
mdm2 Fig. 4 with image from Ghiselli, 2006
smc3 Fig. 3 with imageFig. 4 with image from Ghiselli, 2006
sox17 Fig. 8 with image from Muto et al., 2011
sox32 Fig. 8 with image from Muto et al., 2011
tp53 Fig. 1 from Xu et al., 2015
Fig. 4 with image from Ghiselli, 2006
PHENOTYPE
Phenotype resulting from MO1-smc3
Phenotype Figures
brain necrotic, abnormal Fig. 3 with image from Ghiselli, 2006
caudal fin aplastic, abnormal Fig. 3 with image from Ghiselli, 2006
cell death increased occurrence, abnormal Fig. 4 with image from Ghiselli, 2006
cerebellum necrotic, abnormal Fig. 3 with image from Ghiselli, 2006
cranial cartilage cartilage development disrupted, abnormal Fig. 5 from Xu et al., 2015
eye decreased size, abnormal Fig. 1 from Xu et al., 2015
eye necrotic, abnormal Fig. 3 with image from Ghiselli, 2006
head decreased size, abnormal Fig. 1 from Xu et al., 2015
head apoptotic process increased occurrence, abnormal Fig. 6 from Xu et al., 2015
heart edematous, abnormal Fig. 1 from Xu et al., 2015
notochord morphology, abnormal Fig. 3 with image from Ghiselli, 2006
post-vent region curved, abnormal Fig. 1 from Xu et al., 2015
post-vent region morphology, abnormal Fig. 3 with image from Ghiselli, 2006
post-vent region apoptotic process increased occurrence, abnormal Fig. 6 from Xu et al., 2015
rRNA transcription decreased process quality, abnormal Fig. 4 from Xu et al., 2015
somite structure, abnormal Fig. 3 with image from Ghiselli, 2006
translation decreased process quality, abnormal Fig. 3Fig. 4 from Xu et al., 2015
whole organism decreased length, abnormal Fig. 1 from Xu et al., 2015
Fig. 3 with image from Ghiselli, 2006
whole organism deformed, abnormal Fig. 8 with image from Muto et al., 2011
whole organism tp53 expression increased amount, abnormal Fig. 1 from Xu et al., 2015
whole organism lethal (sensu genetics), abnormal Fig. S4 from Xu et al., 2015
whole organism morphology, abnormal Fig. 3 with image from Ghiselli, 2006
whole organism ploidy, abnormal Fig. 7 with image from Ghiselli, 2006

Phenotype of all Fish created by or utilizing MO1-smc3
Phenotype Fish Conditions Figures
whole organism morphology, abnormal AB + MO1-smc3 standard conditions Fig. 3 with image from Ghiselli, 2006
caudal fin aplastic, abnormal AB + MO1-smc3 standard conditions Fig. 3 with image from Ghiselli, 2006
whole organism decreased length, abnormal AB + MO1-smc3 standard conditions Fig. 3 with image from Ghiselli, 2006
post-vent region morphology, abnormal AB + MO1-smc3 standard conditions Fig. 3 with image from Ghiselli, 2006
whole organism deformed, abnormal AB + MO1-smc3 standard conditions Fig. 8 with image from Muto et al., 2011
notochord morphology, abnormal AB + MO1-smc3 standard conditions Fig. 3 with image from Ghiselli, 2006
cell death increased occurrence, abnormal AB + MO1-smc3 standard conditions Fig. 4 with image from Ghiselli, 2006
whole organism ploidy, abnormal AB + MO1-smc3 standard conditions Fig. 7 with image from Ghiselli, 2006
brain necrotic, abnormal AB + MO1-smc3 standard conditions Fig. 3 with image from Ghiselli, 2006
somite structure, abnormal AB + MO1-smc3 standard conditions Fig. 3 with image from Ghiselli, 2006
cerebellum necrotic, abnormal AB + MO1-smc3 standard conditions Fig. 3 with image from Ghiselli, 2006
eye necrotic, abnormal AB + MO1-smc3 standard conditions Fig. 3 with image from Ghiselli, 2006
eye decreased size, abnormal WT + MO1-smc3 standard conditions Fig. 1 from Xu et al., 2015
cranial cartilage cartilage development disrupted, abnormal WT + MO1-smc3 standard conditions Fig. 5 from Xu et al., 2015
post-vent region curved, ameliorated WT + MO1-smc3 chemical treatment: L-leucine zwitterion Fig. 2 from Xu et al., 2015
rRNA transcription decreased process quality, ameliorated WT + MO1-smc3 chemical treatment: L-leucine zwitterion Fig. 4 from Xu et al., 2015
translation decreased process quality, ameliorated WT + MO1-smc3 chemical treatment: L-leucine zwitterion Fig. 3Fig. 4 from Xu et al., 2015
cranial cartilage cartilage development decreased process quality, ameliorated WT + MO1-smc3 chemical treatment: L-leucine zwitterion Fig. 5 from Xu et al., 2015
post-vent region curved, abnormal WT + MO1-smc3 standard conditions Fig. 1 from Xu et al., 2015
heart edematous, abnormal WT + MO1-smc3 standard conditions Fig. 1 from Xu et al., 2015
whole organism lethal (sensu genetics), ameliorated WT + MO1-smc3 chemical treatment: L-leucine zwitterion Fig. S4 from Xu et al., 2015
post-vent region apoptotic process increased occurrence, ameliorated WT + MO1-smc3 chemical treatment: L-leucine zwitterion Fig. 6 from Xu et al., 2015
head decreased size, abnormal WT + MO1-smc3 standard conditions Fig. 1 from Xu et al., 2015
whole organism tp53 expression increased amount, abnormal WT + MO1-smc3 standard conditions Fig. 1 from Xu et al., 2015
whole organism decreased length, abnormal WT + MO1-smc3 standard conditions Fig. 1 from Xu et al., 2015
head apoptotic process increased occurrence, ameliorated WT + MO1-smc3 chemical treatment: L-leucine zwitterion Fig. 6 from Xu et al., 2015
head apoptotic process increased occurrence, abnormal WT + MO1-smc3 standard conditions Fig. 6 from Xu et al., 2015
whole organism lethal (sensu genetics), abnormal WT + MO1-smc3 standard conditions Fig. S4 from Xu et al., 2015
rRNA transcription decreased process quality, abnormal WT + MO1-smc3 standard conditions Fig. 4 from Xu et al., 2015
trunk decreased length, ameliorated WT + MO1-smc3 chemical treatment: L-leucine zwitterion Fig. 2 from Xu et al., 2015
translation decreased process quality, abnormal WT + MO1-smc3 standard conditions Fig. 3Fig. 4 from Xu et al., 2015
eye decreased size, ameliorated WT + MO1-smc3 chemical treatment: L-leucine zwitterion Fig. 2 from Xu et al., 2015
post-vent region apoptotic process increased occurrence, abnormal WT + MO1-smc3 standard conditions Fig. 6 from Xu et al., 2015
head decreased size, ameliorated WT + MO1-smc3 chemical treatment: L-leucine zwitterion Fig. 2 from Xu et al., 2015
Genome Resources:
CITATIONS (3)