Morpholino

MO1-ippk

ID
ZDB-MRPHLNO-050830-1
Name
MO1-ippk
Previous Names
  • ipk1 MO1 (1)
  • MO1-ipk1l (1)
Target
Sequence
5' - GTCCATTTTATCCAGTTCCATAACC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ippk
Phenotype
Phenotype resulting from MO1-ippk
Phenotype of all Fish created by or utilizing MO1-ippk
Phenotype Fish Conditions Figures
Kupffer's vesicle cilium movement decreased rate, abnormal AB + MO1-ippk control Fig. 4 with image from Jao et al., 2017
determination of heart left/right asymmetry disrupted, abnormal WT + MO1-ippk standard conditions Fig. 1 with image from Sarmah et al., 2010
heart tube position, abnormal WT + MO1-ippk standard conditions Fig. S7 with image from Sarmah et al., 2007
Kupffer's vesicle cilium decreased length, abnormal WT + MO1-ippk standard conditions Fig. 1 with image from Sarmah et al., 2007
pronephric duct cilium decreased length, abnormal WT + MO1-ippk standard conditions Fig. 1 with imageFig. S5 with image from Sarmah et al., 2007
Kupffer's vesicle cilium decreased functionality, abnormal WT + MO1-ippk standard conditions Fig. 1 with image from Sarmah et al., 2007
pronephric duct cilium decreased functionality, abnormal WT + MO1-ippk standard conditions Fig. 1 with image from Sarmah et al., 2007
central canal cilium decreased length, abnormal WT + MO1-ippk standard conditions Fig. 1 with imageFig. S5 with image from Sarmah et al., 2007
central canal cilium decreased functionality, abnormal WT + MO1-ippk standard conditions Fig. 1 with image from Sarmah et al., 2007
heart looping disrupted, abnormal vu504Tg + MO1-ippk control Fig. 4 with image from Jao et al., 2017
heart tube position, abnormal vu504Tg + MO1-ippk control Fig. 4 with image from Jao et al., 2017
determination of heart left/right asymmetry disrupted, abnormal vu504Tg + MO1-ippk control Fig. 4 with image from Jao et al., 2017
heart tube position, abnormal ift88tz288/+ + MO1-ippk standard conditions Fig. 3 with imageFig. S7 with image from Sarmah et al., 2007
heart tube position, abnormal WT + MO1-ift57 + MO1-ippk standard conditions Fig. 3 with imageFig. S7 with image from Sarmah et al., 2007
heart tube position, abnormal WT + MO1-ift88 + MO1-ippk standard conditions Fig. 3 with imageFig. S7 with image from Sarmah et al., 2007
heart looping disrupted, abnormal vu504Tg + MO1-gle1 + MO1-ippk + MO2-gle1 standard conditions Fig. 4 with image from Jao et al., 2017
heart tube position, abnormal vu504Tg + MO1-gle1 + MO1-ippk + MO2-gle1 standard conditions Fig. 4 with image from Jao et al., 2017
determination of heart left/right asymmetry disrupted, abnormal vu504Tg + MO1-gle1 + MO1-ippk + MO2-gle1 standard conditions Fig. 4 with image from Jao et al., 2017
Citations