ZFIN ID: ZDB-MRPHLNO-050308-11
Morpholino Name: MO1-tcf7l1b
Target: tcf7l1b
Previous Names: MO2-tcf7l1b, tcf3b-MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CGCCTCCGTTAAGCTGCGGCATGTT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: This is a translation blocking morpholino
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-tcf7l1b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-tcf7l1b
Expressed Gene Anatomy Figures
ascl1b Fig. 4 with image from Amoyel et al., 2005
cdx4 Fig. 4 from Ro et al., 2011
dla Fig. 4 with image from Amoyel et al., 2005
Fig. 3 with image from Riley et al., 2004
epha4a Fig. 3 with image from Riley et al., 2004
etv5b Fig. 3 with image from Riley et al., 2004
foxb1a Fig. 2 with image from Amoyel et al., 2005
neurog1 Fig. 4 with image from Amoyel et al., 2005
rfng Fig. 2 with image from Amoyel et al., 2005
wnt1 Fig. 3 with image from Riley et al., 2004
PHENOTYPE
Phenotype resulting from MO1-tcf7l1b
Phenotype Figures
atrium has extra parts of type cardiac muscle cell, abnormal Fig. 1 with image from Sorrell et al., 2013
axon guidance disrupted, abnormal Fig. 3 with image from Riley et al., 2004
brain decreased size, abnormal Fig. 3 from Dorsky et al., 2003
cardiac ventricle has extra parts of type cardiac muscle cell, abnormal Fig. 1 with image from Sorrell et al., 2013
cell proliferation in hindbrain disrupted, abnormal Fig. 4 with image from Amoyel et al., 2005
embryonic pattern specification disrupted, abnormal Fig. 3 with image from Riley et al., 2004
heart has extra parts of type cardiac muscle cell, abnormal Fig. 1 with image from Sorrell et al., 2013
heart increased size, abnormal Fig. 1 with image from Sorrell et al., 2013
heart linear, abnormal Fig. 1 with image from Sorrell et al., 2013
hindbrain constricted, abnormal Fig. 3 with image from Riley et al., 2004
hindbrain decreased width, abnormal Fig. 4 with image from Amoyel et al., 2005
hindbrain morphology, abnormal Fig. 3 with image from Riley et al., 2004
hindbrain commissure neuron absent, abnormal Fig. 3 with image from Riley et al., 2004
hindbrain morphogenesis delayed, abnormal Fig. 4 with image from Amoyel et al., 2005
Mauthner neuron axon decreased length, abnormal Fig. 3 with image from Riley et al., 2004
Mauthner neuron axon fasciculation, abnormal Fig. 3 with image from Riley et al., 2004
midbrain hindbrain boundary closure incomplete, abnormal Fig. 6 from Dorsky et al., 2003
neurogenesis disrupted, abnormal Fig. 4 with image from Amoyel et al., 2005
pericardium edematous, abnormal Fig. 3 from Dorsky et al., 2003
radial glial cell cell projection irregular spatial pattern, abnormal Fig. 3 with image from Riley et al., 2004
rhombomere morphology, abnormal Fig. 6 from Dorsky et al., 2003
rhombomere primary neuron crowded, abnormal Fig. 3 with image from Riley et al., 2004
rhombomere primary neuron disorganized, abnormal Fig. 3 with image from Riley et al., 2004
rhombomere morphogenesis disrupted, abnormal Fig. 6 from Dorsky et al., 2003

Phenotype of all Fish created by or utilizing MO1-tcf7l1b
Phenotype Fish Conditions Figures
hindbrain commissure neuron absent, abnormal AB + MO1-tcf7l1b standard conditions Fig. 3 with image from Riley et al., 2004
rhombomere primary neuron disorganized, abnormal AB + MO1-tcf7l1b standard conditions Fig. 3 with image from Riley et al., 2004
rhombomere primary neuron crowded, abnormal AB + MO1-tcf7l1b standard conditions Fig. 3 with image from Riley et al., 2004
Mauthner neuron axon decreased length, abnormal AB + MO1-tcf7l1b standard conditions Fig. 3 with image from Riley et al., 2004
radial glial cell cell projection irregular spatial pattern, abnormal AB + MO1-tcf7l1b standard conditions Fig. 3 with image from Riley et al., 2004
embryonic pattern specification disrupted, abnormal AB + MO1-tcf7l1b standard conditions Fig. 3 with image from Riley et al., 2004
hindbrain constricted, abnormal AB + MO1-tcf7l1b standard conditions Fig. 3 with image from Riley et al., 2004
axon guidance disrupted, abnormal AB + MO1-tcf7l1b standard conditions Fig. 3 with image from Riley et al., 2004
hindbrain morphology, abnormal AB + MO1-tcf7l1b standard conditions Fig. 3 with image from Riley et al., 2004
Mauthner neuron axon fasciculation, abnormal AB + MO1-tcf7l1b standard conditions Fig. 3 with image from Riley et al., 2004
pericardium edematous, abnormal WT + MO1-tcf7l1b standard conditions Fig. 3 from Dorsky et al., 2003
cell proliferation in hindbrain disrupted, abnormal WT + MO1-tcf7l1b standard conditions Fig. 4 with image from Amoyel et al., 2005
midbrain hindbrain boundary closure incomplete, abnormal WT + MO1-tcf7l1b standard conditions Fig. 6 from Dorsky et al., 2003
hindbrain decreased width, abnormal WT + MO1-tcf7l1b standard conditions Fig. 4 with image from Amoyel et al., 2005
rhombomere morphology, abnormal WT + MO1-tcf7l1b standard conditions Fig. 6 from Dorsky et al., 2003
rhombomere morphogenesis disrupted, abnormal WT + MO1-tcf7l1b standard conditions Fig. 6 from Dorsky et al., 2003
neurogenesis disrupted, abnormal WT + MO1-tcf7l1b standard conditions Fig. 4 with image from Amoyel et al., 2005
hindbrain morphogenesis delayed, abnormal WT + MO1-tcf7l1b standard conditions Fig. 4 with image from Amoyel et al., 2005
brain decreased size, abnormal WT + MO1-tcf7l1b standard conditions Fig. 3 from Dorsky et al., 2003
heart increased size, abnormal f2Tg + MO1-tcf7l1b + MO4-tp53 standard conditions Fig. 1 with image from Sorrell et al., 2013
cardiac ventricle has extra parts of type cardiac muscle cell, abnormal f2Tg + MO1-tcf7l1b + MO4-tp53 standard conditions Fig. 1 with image from Sorrell et al., 2013
heart linear, abnormal f2Tg + MO1-tcf7l1b + MO4-tp53 standard conditions Fig. 1 with image from Sorrell et al., 2013
heart has extra parts of type cardiac muscle cell, abnormal f2Tg + MO1-tcf7l1b + MO4-tp53 standard conditions Fig. 1 with image from Sorrell et al., 2013
atrium has extra parts of type cardiac muscle cell, abnormal f2Tg + MO1-tcf7l1b + MO4-tp53 standard conditions Fig. 1 with image from Sorrell et al., 2013
head morphology, abnormal tcf7l1am881/m881 + MO1-tcf7l1b standard conditions Fig. 5 from Ro et al., 2011
forebrain morphology, abnormal tcf7l1am881/m881 + MO1-tcf7l1b standard conditions Fig. 4 from Dorsky et al., 2003
brain wholly posterioralized, abnormal tcf7l1am881/m881 + MO1-tcf7l1b standard conditions Fig. 4 from Dorsky et al., 2003
rostrocaudal neural tube patterning disrupted, abnormal tcf7l1am881/m881 + MO1-tcf7l1b standard conditions Fig. 4 from Dorsky et al., 2003
head development abnormal, abnormal tcf7l1am881/m881 + MO1-tcf7l1b standard conditions Fig. 5 from Ro et al., 2011
head decreased size, abnormal WT + MO1-tcf7l1a + MO1-tcf7l1b standard conditions Fig. 3 from Dorsky et al., 2003
brain decreased size, abnormal WT + MO1-tcf7l1a + MO1-tcf7l1b standard conditions Fig. 3 from Dorsky et al., 2003
telencephalon aplastic, abnormal WT + MO1-tcf7l1a + MO1-tcf7l1b standard conditions Fig. 3 from Dorsky et al., 2003
eye aplastic, abnormal WT + MO1-tcf7l1a + MO1-tcf7l1b standard conditions Fig. 3 from Dorsky et al., 2003
midbrain increased size, abnormal WT + MO1-tcf7l1b + MO2-tcf7l1a standard conditions Fig. S4 with image from Nyholm et al., 2007
forebrain wholly posterioralized, abnormal WT + MO1-tcf7l1b + MO2-tcf7l1a standard conditions Fig. 6 with image from Nyholm et al., 2007
midbrain decreased size, abnormal WT + MO1-tcf7l1b + MO2-tcf7l1a standard conditions Fig. 6 with image from Nyholm et al., 2007
head morphology, abnormal tcf7l1am881/m881 + MO1-e4f1 + MO1-tcf7l1b standard conditions Fig. 5 from Ro et al., 2011
head development abnormal, abnormal tcf7l1am881/m881 + MO1-e4f1 + MO1-tcf7l1b standard conditions Fig. 5 from Ro et al., 2011
cardiac ventricle has extra parts of type cardiac muscle cell, abnormal f2Tg + MO1-tcf7l1a + MO1-tcf7l1b + MO4-tp53 standard conditions Fig. 1 with image from Sorrell et al., 2013
atrium has extra parts of type cardiac muscle cell, abnormal f2Tg + MO1-tcf7l1a + MO1-tcf7l1b + MO4-tp53 standard conditions Fig. 1 with image from Sorrell et al., 2013
heart has extra parts of type cardiac muscle cell, abnormal f2Tg + MO1-tcf7l1a + MO1-tcf7l1b + MO4-tp53 standard conditions Fig. 1 with image from Sorrell et al., 2013
heart increased size, abnormal f2Tg + MO1-tcf7l1a + MO1-tcf7l1b + MO4-tp53 standard conditions Fig. 1 with image from Sorrell et al., 2013
heart linear, abnormal f2Tg + MO1-tcf7l1a + MO1-tcf7l1b + MO4-tp53 standard conditions Fig. 1 with image from Sorrell et al., 2013
cranial vasculature anterior region absent, abnormal s843Tg + MO1-tcf7l1a + MO1-tcf7l1b + MO4-tp53 standard conditions Fig. 9 with image from Sorrell et al., 2013
Genome Resources:
CITATIONS (12)