Morpholino

MO1-jag2b

ID

ZDB-MRPHLNO-041207-2

Name

MO1-jag2b

Previous Names

Target

Sequence

5' - TCCTGATACAATTCCACATGCCGCC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

designed to bind 5'-end of gene

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-jag2b

Expressed Gene	Anatomy	Figures
cimap1b	pronephros	Fig. 5 from Liu et al., 2007
ift70	pronephros	Fig. 5 from Liu et al., 2007
myb	dorsal aorta hematopoietic stem cell	Fig. 2 from Wada et al., 2022
rfx2	pronephros	Fig. 5 from Liu et al., 2007
slc13a1	(not) pronephros	Fig. 5 from Liu et al., 2007

Phenotype

Phenotype resulting from MO1-jag2b

Phenotype	Fish	Figures
cell differentiation involved in pronephros development disrupted, abnormal	WT + MO1-jag2b	Fig. 5 from Liu et al., 2007
dorsal aorta hematopoietic stem cell myb expression decreased amount, abnormal	AB + MO1-jag2b	Fig. 2 from Wada et al., 2022
pectoral fin actin filament mislocalised, abnormal	WT + MO1-jag2b	Fig. 4 from Pascoal et al., 2013
pectoral fin endoskeletal disc disorganized, abnormal	WT + MO1-jag2b	Fig. 2 from Pascoal et al., 2013
pectoral fin musculature contractile muscle fiber malformed, abnormal	WT + MO1-jag2b	Fig. 4 from Pascoal et al., 2013
pronephros multi-ciliated epithelial cell increased amount, abnormal	WT + MO1-jag2b	Fig. 5 from Liu et al., 2007

Phenotype of all Fish created by or utilizing MO1-jag2b

Phenotype	Fish	Conditions	Figures
dorsal aorta hematopoietic stem cell myb expression decreased amount, abnormal	AB + MO1-jag2b	standard conditions	Fig. 2 from Wada et al., 2022
pectoral fin musculature contractile muscle fiber malformed, abnormal	WT + MO1-jag2b	standard conditions	Fig. 4 from Pascoal et al., 2013
pectoral fin endoskeletal disc disorganized, abnormal	WT + MO1-jag2b	standard conditions	Fig. 2 from Pascoal et al., 2013
pectoral fin actin filament mislocalised, abnormal	WT + MO1-jag2b	standard conditions	Fig. 4 from Pascoal et al., 2013
pronephros multi-ciliated epithelial cell increased amount, abnormal	WT + MO1-jag2b	standard conditions	Fig. 5 from Liu et al., 2007
cell differentiation involved in pronephros development disrupted, abnormal	WT + MO1-jag2b	standard conditions	Fig. 5 from Liu et al., 2007

Citations