header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-041207-2
Morpholino Name: MO1-jag2b
Target: jag2b (1)
Previous Names: J2ATG-MO (1), J2atgMO (1), MO-jag2-1 (1), MO1-jag2

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TCCTGATACAATTCCACATGCCGCC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: designed to bind 5'-end of gene
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-jag2b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-jag2b
Expressed Gene Anatomy Figures
flr Fig. 5 with image from Liu et al., 2007
odf3b Fig. 5 with image from Liu et al., 2007
rfx2 Fig. 5 with image from Liu et al., 2007
slc13a1 Fig. 5 with image from Liu et al., 2007
PHENOTYPE
Phenotype resulting from MO1-jag2b
Phenotype of all Fish created by or utilizing MO1-jag2b
OTHER MO1-jag2b MORPHOLINO PAGESNo links to external sites
CITATIONS (10)