Morpholino
MO1-gata4
- ID
- ZDB-MRPHLNO-051128-1
- Name
- MO1-gata4
- Previous Names
- None
- Target
- Sequence
-
5' - TCCACAGGTGAGCGATTATTGCTCC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
The published sequence contains typos. This sequence has been confirmed by an author.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-gata4
Expressed Gene | Anatomy | Figures |
---|---|---|
cp |
Fig. 5 ![]() |
|
cxcl12a |
Fig. 5 ![]() |
|
dand5 |
Fig. S4 ![]() |
|
ela2l |
|
Fig. 4 ![]() |
fabp2 |
|
Fig. 4 ![]() |
1 - 5 of 21 Show all
Phenotype
Phenotype resulting from MO1-gata4
1 - 5 of 15 Show all
Phenotype of all Fish created by or utilizing MO1-gata4
1 - 5 of 26 Show all
Citations
- Guo, S., Zhang, Y., Zhou, T., Wang, D., Weng, Y., Chen, Q., Ma, J., Li, Y.P., Wang, L. (2018) GATA4 as a novel regulator involved in the development of the neural crest and craniofacial skeleton via Barx1. Cell death and differentiation. 25(11):1996-2009
- Miyagi, H., Nag, K., Sultana, N., Munakata, K., Hirose, S., Nakamura, N. (2016) Characterization of the zebrafish cx36.7 gene promoter: Its regulation of cardiac-specific expression and skeletal muscle-specific repression. Gene. 577(2):265-74
- Gupta, V., Gemberling, M., Karra, R., Rosenfeld, G.E., Evans, T., and Poss, K.D. (2013) An Injury-Responsive Gata4 Program Shapes the Zebrafish Cardiac Ventricle. Current biology : CB. 23(13):1221-7
- Rawnsley, D.R., Xiao, J., Lee, J.S., Liu, X., Mericko-Ishizuka, P., Kumar, V., He, J., Basu, A., Lu, M., Lynn, F.C., Pack, M., Gasa, R., Kahn, M.L. (2013) The transcription factor Atonal homolog 8 regulates Gata4 and Friend of Gata-2 during vertebrate development. The Journal of biological chemistry. 288:24429-40
- Rosenfeld, G.E., Mercer, E.J., Mason, C.E., and Evans, T. (2013) Small heat shock proteins Hspb7 and Hspb12 regulate early steps of cardiac morphogenesis. Developmental Biology. 381(2):389-400
- Torregroza, I., Holtzinger, A., Mendelson, K., Liu, T.C., Hla, T., and Evans, T. (2012) Regulation of a Vascular Plexus by gata4 Is Mediated in Zebrafish through the Chemokine sdf1a. PLoS One. 7(10):e46844
- Chen, Y.C., Wu, B.K., Chu, C.Y., Cheng, C.H., Han, H.W., Chen, G.D., Lee, M.T., Hwang, P.P., Kawakami, K., Chang, C.C., and Huang, C.J. (2010) Identification and characterization of alternative promoters of zebrafish Rtn-4/Nogo genes in cultured cells and zebrafish embryos. Nucleic acids research. 38(14):4635-4650
- Rikin, A., and Evans, T. (2010) The tbx/bHLH transcription factor mga regulates gata4 and organogenesis. Developmental Dynamics : an official publication of the American Association of Anatomists. 239(2):535-547
- Lin, X., and Xu, X. (2009) Distinct functions of Wnt/{beta}-catenin signaling in KV development and cardiac asymmetry. Development (Cambridge, England). 136(2):207-217
- Shin, D., Shin, C.H., Tucker, J., Ober, E.A., Rentzsch, F., Poss, K.D., Hammerschmidt, M., Mullins, M.C., and Stainier, D.Y. (2007) Bmp and Fgf signaling are essential for liver specification in zebrafish. Development (Cambridge, England). 134(11):2041-2050
1 - 10 of 11
Show