Morpholino

MO1-vangl2

ID
ZDB-MRPHLNO-041217-5
Name
MO1-vangl2
Previous Names
  • MO-tri (1)
  • stbm MO (1)
  • stbm-Mo (1)
  • StbmMO (1)
  • vangl2 MO (1)
Target
Sequence
5' - GTACTGCGACTCGTTATCCATGTC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-vangl2
No data available
Phenotype
Phenotype resulting from MO1-vangl2
Phenotype Fish Figures
cilium movement decreased frequency, abnormal WT + MO1-vangl2 Fig. 9 from Leightner et al., 2013
convergent extension disrupted, abnormal AB + MO1-vangl2 Fig. 6 with image from Vervenne et al., 2008
convergent extension involved in axis elongation decreased process quality, abnormal AB + MO1-vangl2 Fig. 5 with image from Feng et al., 2024
convergent extension involved in axis elongation disrupted, abnormal WT + MO1-vangl2 Fig. 2 with image from Reynolds et al., 2010
Fig. 5 with image from Waxman et al., 2004
convergent extension involved in gastrulation disrupted, abnormal WT + MO1-vangl2 Fig. 4 with image from Li et al., 2011
convergent extension involved in gastrulation process quality, abnormal WT + MO1-vangl2 Fig. 4 from Burcklé et al., 2011
ectoderm cell orientation ectoderm, abnormal WT + MO1-vangl2 Fig. 3 with image from Young et al., 2014
ectoderm cell shape, abnormal WT + MO1-vangl2 Fig. 3 with image from Young et al., 2014
establishment of cell polarity disrupted, abnormal WT + MO1-vangl2 Fig. 3 with image from Li et al., 2011
eye decreased distance eye, abnormal WT + MO1-vangl2 Fig. 5 with image from Waxman et al., 2004
eye decreased width, abnormal WT + MO1-vangl2 Fig. 5 with image from Waxman et al., 2004
facial nerve motor nucleus motor neuron mislocalised, abnormal rw0Tg + MO1-vangl2 Fig. 5 with imageFig. 6 with image from Sittaramane et al., 2009
head hydrocephalic, abnormal WT + MO1-vangl2 Fig. 9 from Leightner et al., 2013
hindbrain motor neuron migration process quality, abnormal ch100Tg + MO1-vangl2 Fig. 8 with image from Sittaramane et al., 2013
migratory neural crest ovate, abnormal vu234Tg + MO1-vangl2 Fig. 2 with image from Ahsan et al., 2019
neural plate increased width, abnormal WT + MO1-vangl2 Fig. 6 from Ferrante et al., 2009
neuron migration disrupted, abnormal rw0Tg + MO1-vangl2 Fig. 5 with imageFig. 6 with image from Sittaramane et al., 2009
notochord decreased length, abnormal WT + MO1-vangl2 Fig. S1 with image from Nambiar et al., 2007
notochord increased width, abnormal WT + MO1-vangl2 Fig. 3 with image from Li et al., 2011
notochord undulate, abnormal WT + MO1-vangl2 Fig. 2 with imageFig. 3 with image from Li et al., 2011
notochord apoptotic process increased process quality, abnormal WT + MO1-vangl2 Fig. 7 with image from Wang et al., 2024
notochord cell orientation notochord, abnormal WT + MO1-vangl2 Fig. 3 with image from Young et al., 2014
notochord cell shape, abnormal WT + MO1-vangl2 Fig. 3 with image from Young et al., 2014
paraxial mesoderm increased width, abnormal WT + MO1-vangl2 Fig. 10 with image from Harrington et al., 2007
pronephric duct cilium decreased functionality, abnormal WT + MO1-vangl2 Fig. 9 from Leightner et al., 2013
pronephric duct cilium disorganized, abnormal WT + MO1-vangl2 Fig. 9 from Leightner et al., 2013
pronephros cystic, abnormal WT + MO1-vangl2 Fig. 9 from Leightner et al., 2013
rhombomere 4 branchiomotor neuron mislocalised, abnormal ch100Tg; zou002Tg + MO1-vangl2 Fig. 8 with image from Sittaramane et al., 2013
rhombomere 6 lacks all parts of type branchiomotor neuron, abnormal ch100Tg + MO1-vangl2 Fig. 8 with image from Sittaramane et al., 2013
somite condensed, abnormal WT + MO1-vangl2 Fig. S1 with image from Nambiar et al., 2007
somite flat, abnormal WT + MO1-vangl2 Fig. 5 with image from Waxman et al., 2004
somite increased width, abnormal WT + MO1-vangl2 Fig. 2 with image from Li et al., 2011
Fig. 2 with image from Reynolds et al., 2010
Fig. 10 with image from Harrington et al., 2007
trunk decreased length, abnormal WT + MO1-vangl2 Fig. 1 with imageFig. 2 with image from Reynolds et al., 2010
vertebral column increased curvature, abnormal WT + MO1-vangl2 Fig. 7 with image from Wang et al., 2024
whole organism decreased length, abnormal AB + MO1-vangl2 Fig. 5 with image from Feng et al., 2024
Fig. 2 with image from Li et al., 2011
Fig. 6 from Ferrante et al., 2009
Fig. 5 with image from Waxman et al., 2004
whole organism increased curvature, abnormal WT + MO1-vangl2 Fig. 9 from Leightner et al., 2013
whole organism morphology, abnormal WT + MO1-vangl2 Fig. 2 with image from Young et al., 2014
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-vangl2 Fig. 2 with image from Ahsan et al., 2019
Fig. 1 with image from Reynolds et al., 2010
Fig. 1 from Jessen et al., 2002
whole organism medial-lateral axis increased length, abnormal vu234Tg + MO1-vangl2 Fig. 2 with image from Ahsan et al., 2019
Phenotype of all Fish created by or utilizing MO1-vangl2
Phenotype Fish Conditions Figures
whole organism anterior-posterior axis decreased length, abnormal vangl2m209/m209 + MO1-vangl2 standard conditions Fig. 1 from Jessen et al., 2002
whole organism decreased length, abnormal AB + MO1-vangl2 control Fig. 5 with image from Feng et al., 2024
convergent extension involved in axis elongation decreased process quality, abnormal AB + MO1-vangl2 control Fig. 5 with image from Feng et al., 2024
convergent extension disrupted, abnormal AB + MO1-vangl2 standard conditions Fig. 6 with image from Vervenne et al., 2008
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-vangl2 standard conditions Fig. 1 with image from Reynolds et al., 2010
Fig. 1 from Jessen et al., 2002
ectoderm cell shape, abnormal WT + MO1-vangl2 standard conditions Fig. 3 with image from Young et al., 2014
paraxial mesoderm increased width, abnormal WT + MO1-vangl2 standard conditions Fig. 10 with image from Harrington et al., 2007
notochord decreased length, abnormal WT + MO1-vangl2 standard conditions Fig. S1 with image from Nambiar et al., 2007
whole organism increased curvature, abnormal WT + MO1-vangl2 standard conditions Fig. 9 from Leightner et al., 2013
cilium movement decreased frequency, abnormal WT + MO1-vangl2 standard conditions Fig. 9 from Leightner et al., 2013
notochord apoptotic process increased process quality, abnormal WT + MO1-vangl2 standard conditions Fig. 7 with image from Wang et al., 2024
somite flat, abnormal WT + MO1-vangl2 standard conditions Fig. 5 with image from Waxman et al., 2004
vertebral column increased curvature, abnormal WT + MO1-vangl2 standard conditions Fig. 7 with image from Wang et al., 2024
whole organism morphology, abnormal WT + MO1-vangl2 standard conditions Fig. 2 with image from Young et al., 2014
whole organism decreased length, abnormal WT + MO1-vangl2 standard conditions Fig. 2 with image from Li et al., 2011
Fig. 6 from Ferrante et al., 2009
Fig. 5 with image from Waxman et al., 2004
pronephric duct cilium disorganized, abnormal WT + MO1-vangl2 standard conditions Fig. 9 from Leightner et al., 2013
pronephric duct cilium decreased functionality, abnormal WT + MO1-vangl2 standard conditions Fig. 9 from Leightner et al., 2013
eye decreased distance eye, abnormal WT + MO1-vangl2 standard conditions Fig. 5 with image from Waxman et al., 2004
notochord cell orientation notochord, abnormal WT + MO1-vangl2 standard conditions Fig. 3 with image from Young et al., 2014
head hydrocephalic, abnormal WT + MO1-vangl2 standard conditions Fig. 9 from Leightner et al., 2013
notochord undulate, abnormal WT + MO1-vangl2 standard conditions Fig. 2 with imageFig. 3 with image from Li et al., 2011
somite increased width, abnormal WT + MO1-vangl2 standard conditions Fig. 2 with image from Li et al., 2011
Fig. 2 with image from Reynolds et al., 2010
Fig. 10 with image from Harrington et al., 2007
notochord cell shape, abnormal WT + MO1-vangl2 standard conditions Fig. 3 with image from Young et al., 2014
neural plate increased width, abnormal WT + MO1-vangl2 standard conditions Fig. 6 from Ferrante et al., 2009
establishment of cell polarity disrupted, abnormal WT + MO1-vangl2 standard conditions Fig. 3 with image from Li et al., 2011
trunk decreased length, abnormal WT + MO1-vangl2 standard conditions Fig. 1 with imageFig. 2 with image from Reynolds et al., 2010
somite condensed, abnormal WT + MO1-vangl2 standard conditions Fig. S1 with image from Nambiar et al., 2007
notochord increased width, abnormal WT + MO1-vangl2 standard conditions Fig. 3 with image from Li et al., 2011
eye decreased width, abnormal WT + MO1-vangl2 standard conditions Fig. 5 with image from Waxman et al., 2004
ectoderm cell orientation ectoderm, abnormal WT + MO1-vangl2 standard conditions Fig. 3 with image from Young et al., 2014
convergent extension involved in gastrulation disrupted, abnormal WT + MO1-vangl2 standard conditions Fig. 4 with image from Li et al., 2011
convergent extension involved in gastrulation process quality, abnormal WT + MO1-vangl2 standard conditions Fig. 4 from Burcklé et al., 2011
pronephros cystic, abnormal WT + MO1-vangl2 standard conditions Fig. 9 from Leightner et al., 2013
convergent extension involved in axis elongation disrupted, abnormal WT + MO1-vangl2 standard conditions Fig. 2 with image from Reynolds et al., 2010
Fig. 5 with image from Waxman et al., 2004
rhombomere 6 lacks all parts of type branchiomotor neuron, abnormal ch100Tg + MO1-vangl2 standard conditions Fig. 8 with image from Sittaramane et al., 2013
hindbrain motor neuron migration process quality, abnormal ch100Tg + MO1-vangl2 standard conditions Fig. 8 with image from Sittaramane et al., 2013
rhombomere 4 branchiomotor neuron mislocalised, abnormal ch100Tg + MO1-vangl2 standard conditions Fig. 8 with image from Sittaramane et al., 2013
facial nerve motor nucleus motor neuron mislocalised, abnormal rw0Tg + MO1-vangl2 standard conditions Fig. 5 with imageFig. 6 with image from Sittaramane et al., 2009
neuron migration disrupted, abnormal rw0Tg + MO1-vangl2 standard conditions Fig. 5 with imageFig. 6 with image from Sittaramane et al., 2009
whole organism medial-lateral axis increased length, abnormal vu234Tg + MO1-vangl2 standard conditions Fig. 2 with image from Ahsan et al., 2019
migratory neural crest ovate, abnormal vu234Tg + MO1-vangl2 standard conditions Fig. 2 with image from Ahsan et al., 2019
whole organism anterior-posterior axis decreased length, abnormal vu234Tg + MO1-vangl2 standard conditions Fig. 2 with image from Ahsan et al., 2019
rhombomere 4 branchiomotor neuron mislocalised, abnormal ch100Tg; zou002Tg + MO1-vangl2 standard conditions Fig. 8 with image from Sittaramane et al., 2013
post-vent region vacuolated, abnormal cdh2m117/m117 + MO1-vangl2 standard conditions Fig. 8 with image from Harrington et al., 2007
post-vent region clavate, abnormal cdh2m117/m117 + MO1-vangl2 standard conditions Fig. 8 with image from Harrington et al., 2007
post-vent region decreased length, abnormal cdh2m117/m117 + MO1-vangl2 standard conditions Fig. 8 with image from Harrington et al., 2007
trunk somite morphology, abnormal cdh2m117/m117 + MO1-vangl2 standard conditions Fig. 8 with image from Harrington et al., 2007
post-vent region somite morphology, abnormal cdh2m117/m117 + MO1-vangl2 standard conditions Fig. 8 with image from Harrington et al., 2007
post-vent region somite morphology, abnormal cdh2p79emcf/p79emcf + MO1-vangl2 standard conditions Fig. 8 with image from Harrington et al., 2007
somite increased width, abnormal cdh2p79emcf/p79emcf + MO1-vangl2 standard conditions Fig. 10 with image from Harrington et al., 2007
post-vent region clavate, abnormal cdh2p79emcf/p79emcf + MO1-vangl2 standard conditions Fig. 8 with image from Harrington et al., 2007
post-vent region vacuolated, abnormal cdh2p79emcf/p79emcf + MO1-vangl2 standard conditions Fig. 8 with image from Harrington et al., 2007
paraxial mesoderm increased width, abnormal cdh2p79emcf/p79emcf + MO1-vangl2 standard conditions Fig. 10 with image from Harrington et al., 2007
post-vent region decreased length, abnormal cdh2p79emcf/p79emcf + MO1-vangl2 standard conditions Fig. 8 with image from Harrington et al., 2007
whole organism decreased length, abnormal ptk7audm400/+ + MO1-vangl2 standard conditions Fig. 7 with image from Wang et al., 2024
convergent extension disrupted, abnormal AB + MO1-lpp + MO1-vangl2 standard conditions Fig. 6 with image from Vervenne et al., 2008
whole organism decreased length, abnormal WT + MO1-dact2 + MO1-vangl2 standard conditions Fig. 5 with image from Waxman et al., 2004
convergent extension involved in axis elongation disrupted, abnormal WT + MO1-dact2 + MO1-vangl2 standard conditions Fig. 5 with image from Waxman et al., 2004
eye decreased distance eye, abnormal WT + MO1-dact2 + MO1-vangl2 standard conditions Fig. 5 with image from Waxman et al., 2004
somite flat, abnormal WT + MO1-dact2 + MO1-vangl2 standard conditions Fig. 5 with image from Waxman et al., 2004
eye decreased width, abnormal WT + MO1-dact2 + MO1-vangl2 standard conditions Fig. 5 with image from Waxman et al., 2004
establishment of planar polarity disrupted, abnormal WT + MO1-ift70 + MO1-vangl2 standard conditions Fig. 7 from Zhao et al., 2011
neuromast hair cell disoriented, abnormal WT + MO1-ift70 + MO1-vangl2 standard conditions Fig. 7 from Zhao et al., 2011
convergent extension involved in gastrulation process quality, abnormal WT + MO1-nphp4 + MO1-vangl2 standard conditions Fig. 4 from Burcklé et al., 2011
whole organism decreased length, abnormal WT + MO1-ofd1 + MO1-vangl2 standard conditions Fig. 6 from Ferrante et al., 2009
neural plate increased width, abnormal WT + MO1-ofd1 + MO1-vangl2 standard conditions Fig. 6 from Ferrante et al., 2009
establishment of planar polarity disrupted, abnormal WT + MO1-vangl2 + MO2-b9d2 standard conditions Fig. 7 from Zhao et al., 2011
neuromast hair cell disoriented, abnormal WT + MO1-vangl2 + MO2-b9d2 standard conditions Fig. 7 from Zhao et al., 2011
establishment of planar polarity disrupted, abnormal WT + MO1-vangl2 + MO2-invs standard conditions Fig. 7 from Zhao et al., 2011
neuromast hair cell disoriented, abnormal WT + MO1-vangl2 + MO2-invs standard conditions Fig. 7 from Zhao et al., 2011
whole organism decreased length, abnormal WT + MO1-vangl2 + MO3-rack1 standard conditions Fig. 2 with image from Li et al., 2011
somite increased width, abnormal WT + MO1-vangl2 + MO3-rack1 standard conditions Fig. 2 with image from Li et al., 2011
notochord undulate, abnormal WT + MO1-vangl2 + MO3-rack1 standard conditions Fig. 2 with image from Li et al., 2011
neuron migration disrupted, abnormal rw0Tg + MO1-cntn2 + MO1-vangl2 standard conditions Fig. 5 with image from Sittaramane et al., 2009
facial nerve motor nucleus motor neuron mislocalised, abnormal rw0Tg + MO1-cntn2 + MO1-vangl2 standard conditions Fig. 5 with image from Sittaramane et al., 2009
neuron migration disrupted, abnormal rw0Tg + MO1-lama1 + MO1-vangl2 standard conditions Fig. 6 with image from Sittaramane et al., 2009
facial nerve motor nucleus motor neuron mislocalised, abnormal rw0Tg + MO1-lama1 + MO1-vangl2 standard conditions Fig. 6 with image from Sittaramane et al., 2009
Citations