CRISPR

CRISPR1-sacs

ID
ZDB-CRISPR-231003-1
Name
CRISPR1-sacs
Previous Names
None
Target
Sequence
5' - GGACCAATGGAGGGACCCGG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was "CGG" at the 3' end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
irc1 sacs
Expression
Gene expression in Wild Types + CRISPR1-sacs
No data available
Phenotype
Phenotype resulting from CRISPR1-sacs
No data available
Phenotype of all Fish created by or utilizing CRISPR1-sacs
Phenotype Fish Conditions Figures
locomotory behavior process quality, ameliorated sacsirc1/irc1 chemical treatment by environment: tauroursodeoxycholic acid Figure 4 with image from Naef et al., 2021
swimming process quality, ameliorated sacsirc1/irc1 chemical treatment by environment: tauroursodeoxycholic acid Figure 4 with image from Naef et al., 2021
eye decreased size, abnormal sacsirc1/irc1 standard conditions Figure 1 with image from Naef et al., 2021
whole organism sacs expression decreased amount, abnormal sacsirc1/irc1 standard conditions Figure 1 with image from Naef et al., 2021
whole organism vim expression decreased amount, abnormal sacsirc1/irc1 chemical treatment by environment: N-acetyl-L-leucine Figure 5 with image from Naef et al., 2021
whole organism calr expression increased amount, abnormal sacsirc1/irc1 chemical treatment by environment: N-acetyl-L-leucine Figure 5 with image from Naef et al., 2021
whole organism reactive oxygen species increased amount, abnormal sacsirc1/irc1 standard conditions Figure 3 with image from Naef et al., 2021
whole organism vim expression increased amount, abnormal sacsirc1/irc1 control Figure 3 with image,  Figure 5 with image from Naef et al., 2021
swimming process quality, ameliorated sacsirc1/irc1 chemical treatment by environment: N-acetyl-L-leucine Figure 4 with image from Naef et al., 2021
locomotory behavior decreased process quality, abnormal sacsirc1/irc1 control Figure 2 with image,  Figure 4 with image from Naef et al., 2021
eye apoptotic process increased occurrence, abnormal sacsirc1/irc1 standard conditions Figure 3 with image from Naef et al., 2021
eye area, ameliorated sacsirc1/irc1 chemical treatment by environment: N-acetyl-L-leucine Figure 5 with image from Naef et al., 2021
locomotory behavior process quality, ameliorated sacsirc1/irc1 chemical treatment by environment: N-acetyl-L-leucine Figure 4 with image from Naef et al., 2021
whole organism vim expression decreased amount, abnormal sacsirc1/irc1 chemical treatment by environment: tauroursodeoxycholic acid Figure 5 with image from Naef et al., 2021
eye decreased area, abnormal sacsirc1/irc1 control Figure 5 with image from Naef et al., 2021
whole organism calr expression decreased amount, abnormal sacsirc1/irc1 control Figure 3 with image,  Figure 5 with image from Naef et al., 2021
whole organism calr expression amount, ameliorated sacsirc1/irc1 chemical treatment by environment: tauroursodeoxycholic acid Figure 5 with image from Naef et al., 2021
whole organism mitochondrion decreased functionality, abnormal sacsirc1/irc1 control Figure 3 with image,  Figure 5 with image from Naef et al., 2021
whole organism mitochondrion functionality, ameliorated sacsirc1/irc1 chemical treatment by environment: tauroursodeoxycholic acid Figure 5 with image from Naef et al., 2021
whole organism mitochondrion functionality, ameliorated sacsirc1/irc1 chemical treatment by environment: N-acetyl-L-leucine Figure 5 with image from Naef et al., 2021
whole organism apoptotic process occurrence, ameliorated sacsirc1/irc1 chemical treatment by environment: N-acetyl-L-leucine Figure 5 with image from Naef et al., 2021
whole organism ab2-sqstm1 labeling decreased amount, abnormal sacsirc1/irc1 standard conditions Figure 3 with image from Naef et al., 2021
whole organism apoptotic process occurrence, ameliorated sacsirc1/irc1 chemical treatment by environment: tauroursodeoxycholic acid Figure 5 with image from Naef et al., 2021
swimming decreased linear velocity, abnormal sacsirc1/irc1 control Figure 2 with image,  Figure 4 with image from Naef et al., 2021
whole organism apoptotic process increased occurrence, abnormal sacsirc1/irc1 control Figure 5 with image from Naef et al., 2021
Purkinje cell ab1-pvalb7 labeling decreased amount, abnormal sacsirc1/irc1 standard conditions Figure 2 with image from Naef et al., 2021
eye area, ameliorated sacsirc1/irc1 chemical treatment by environment: tauroursodeoxycholic acid Figure 5 with image from Naef et al., 2021
Purkinje cell decreased amount, abnormal sacsirc1/irc1; bz6Tg standard conditions Figure 2 with image from Naef et al., 2021
cerebellum decreased area, abnormal sacsirc1/irc1; bz6Tg standard conditions Figure 2 with image from Naef et al., 2021
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.