CRISPR

CRISPR1-gmds

ID

ZDB-CRISPR-230809-1

Name

CRISPR1-gmds

Previous Names

None

Target

gmds (1)

Sequence

5' - GGTTGGAACCCTTCGGCTGC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
nfl2	gmds

Expression

Gene expression in Wild Types + CRISPR1-gmds

No data available

Phenotype

Phenotype resulting from CRISPR1-gmds

No data available

Phenotype of all Fish created by or utilizing CRISPR1-gmds

Phenotype	Fish	Conditions	Figures
brain vasculature hemorrhagic, ameliorated	gmds^nfl2/nfl2 (AB)	chemical treatment by injection: L-fucose	Fig. 2 from Fowler et al., 2021
neuromast increased amount, abnormal	gmds^nfl2/nfl2 (AB)	chemical treatment by environment: neomycin	Figure 4 from Ameen et al., 2025
neuromast hair cell increased amount, abnormal	gmds^nfl2/nfl2 (AB)	standard conditions	Figure 2 from Ameen et al., 2025
neuromast hair cell gmds expression decreased distribution, abnormal	gmds^nfl2/nfl2 (AB)	standard conditions	Figure 3 from Ameen et al., 2025
brain vasculature hemorrhagic, exacerbated	gmds^nfl2/nfl2 (AB)	chemical treatment by environment: DAPT	Fig. 3 from Fowler et al., 2021
neuromast hair cell kinocilium absence of anatomical entity, abnormal	gmds^nfl2/nfl2 (AB)	chemical treatment by environment: neomycin	Figure 5 , Figure 6 from Ameen et al., 2025
thigmotaxis decreased process quality, abnormal	gmds^nfl2/nfl2 (AB)	standard conditions	Fig. 1 from Fowler et al., 2021
neuromast hair cell increased amount, abnormal	gmds^nfl2/nfl2 (AB)	chemical treatment by environment: neomycin	Figure 7 , Figure 8 from Ameen et al., 2025
neuromast protein O-linked glycosylation via fucose absent process, abnormal	gmds^nfl2/nfl2 (AB)	standard conditions	Figure 1 from Ameen et al., 2025
neuromast hair cell stereocilium absence of anatomical entity, abnormal	gmds^nfl2/nfl2 (AB)	chemical treatment by environment: neomycin	Figure 5 , Figure 6 from Ameen et al., 2025
brain vasculature hemorrhagic, ameliorated	gmds^nfl2/nfl2 (AB)	chemical treatment by injection: GDP-L-fucose	Fig. 2 from Fowler et al., 2021
brain vasculature hemorrhagic, abnormal	gmds^nfl2/nfl2 (AB)	standard conditions	Fig. 1 , Fig. 2 , Fig. 3 from Fowler et al., 2021
post-vent region curved, abnormal	gmds^nfl2/nfl2 (AB)	standard conditions	Fig. 1 from Fowler et al., 2021
neuromast hair cell increased amount, abnormal	gmds^nfl2/nfl2 (AB)	chemical treatment by environment: neomycin, chemical treatment by environment: DAPT	Figure 8 from Ameen et al., 2025
bulbus arteriosus vascular associated smooth muscle cell tagln expression decreased distribution, abnormal	gmds^nfl2/nfl2 (AB)	standard conditions	Fig. S5 from Fowler et al., 2021
neuromast hair cell increased amount, abnormal	gmds^nfl2/+ (AB)	chemical treatment by environment: neomycin, chemical treatment by environment: DAPT	Figure 8 from Ameen et al., 2025
bulbus arteriosus vascular associated smooth muscle cell decreased amount, abnormal	gmds^nfl2/nfl2; ca2Tg (AB)	standard conditions	Fig. 4 from Fowler et al., 2021
pharyngeal arch vascular associated smooth muscle cell decreased amount, abnormal	gmds^nfl2/nfl2; ca2Tg (AB)	standard conditions	Fig. 4 from Fowler et al., 2021
brain vasculature hemorrhagic, exacerbated	gmds^nfl2/nfl2 + MO1-fcsk + MO4-tp53 (AB)	control	Fig. 2 from Fowler et al., 2021

Citations