CRISPR

CRISPR1-hoxa13b

ID

ZDB-CRISPR-190403-3

Name

CRISPR1-hoxa13b

Previous Names

None

Target

hoxa13b (1)

Sequence

5' - GGATGATATGAGCAAAAACA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
ch308	hoxa13b
Df(Chr16:hoxa13b,hoxa11b,hoxa10b,hoxa9b,hoxa2b)sud112	hoxa2b, hoxa9b, hoxa10b, hoxa11b, hoxa13b
ot1014	hoxa13b

Expression

Gene expression in Wild Types + CRISPR1-hoxa13b

No data available

Phenotype

Phenotype resulting from CRISPR1-hoxa13b

No data available

Phenotype of all Fish created by or utilizing CRISPR1-hoxa13b

Phenotype	Fish	Conditions	Figures
pectoral fin lepidotrichium decreased length, abnormal	hoxa13b^ch308/ch308	standard conditions	Fig. 3 from Nakamura et al., 2016
whole organism dead, abnormal	Df(Chr16:hoxa13b,hoxa11b,hoxa10b,hoxa9b,hoxa2b)sud112/sud112 (RW)	standard conditions	Table 1 from Yamada et al., 2021
somite increased amount, abnormal	Df(Chr16:hoxa13b,hoxa11b,hoxa10b,hoxa9b,hoxa2b)sud112/sud112 (RW)	standard conditions	Fig. 5 from Yamada et al., 2021
pectoral fin fold proximal-distal axis decreased length, abnormal	Df(Chr16:hoxa13b,hoxa11b,hoxa10b,hoxa9b,hoxa2b)sud112/sud112 (RW)	standard conditions	Fig. 3 from Yamada et al., 2021
somite border increased amount, abnormal	Df(Chr16:hoxa13b,hoxa11b,hoxa10b,hoxa9b,hoxa2b)sud112/sud112 (RW)	standard conditions	Fig. 5 from Yamada et al., 2021
whole organism decreased life span, abnormal	Df(Chr16:hoxa13b,hoxa11b,hoxa10b,hoxa9b,hoxa2b)sud112/sud112 (RW)	standard conditions	Table 1 from Yamada et al., 2021
endochondral element cell increased amount, abnormal	hoxa13b^ch308/ch308; hoxa13a^ch307/ch307	standard conditions	Fig. S5 from Nakamura et al., 2016
pectoral fin fold decreased length, abnormal	hoxa13b^ch308/ch308; hoxa13a^ch307/ch307	standard conditions	Fig. S5 from Nakamura et al., 2016
pectoral fin lepidotrichium decreased length, abnormal	hoxa13b^ch308/ch308; hoxa13a^ch307/ch307	standard conditions	Fig. 3 from Nakamura et al., 2016
pectoral fin distal radial increased amount, abnormal	hoxa13b^ch308/ch308; hoxa13a^ch307/ch307	standard conditions	Fig. 3 from Nakamura et al., 2016
pectoral fin proximal radial fused with pectoral fin proximal radial, abnormal	hoxa13b^ch308/ch308; hoxa13a^ch307/ch307	standard conditions	Fig. 3 from Nakamura et al., 2016
pelvic fin lepidotrichium shortened, abnormal	hoxa13a^ot1013/+; hoxa13b^{ot1014/ot1014}; hoxd13a^{ot1015/ot1015}	standard conditions	Fig 2 from Corcoran et al., 2026
anal fin lepidotrichium shortened, abnormal	hoxa13a^ot1013/+; hoxa13b^{ot1014/ot1014}; hoxd13a^{ot1015/ot1015}	standard conditions	Fig 2 from Corcoran et al., 2026
pectoral fin lepidotrichium shortened, abnormal	hoxa13a^ot1013/+; hoxa13b^{ot1014/ot1014}; hoxd13a^{ot1015/ot1015}	standard conditions	Fig 2 from Corcoran et al., 2026
branched caudal fin ray shortened, abnormal	hoxa13a^ot1013/+; hoxa13b^{ot1014/ot1014}; hoxd13a^{ot1015/ot1015}	standard conditions	Fig 2 from Corcoran et al., 2026
branched anal fin ray shortened, abnormal	hoxa13a^ot1013/+; hoxa13b^{ot1014/ot1014}; hoxd13a^{ot1015/ot1015}	standard conditions	Fig 2 from Corcoran et al., 2026
pelvic fin lepidotrichium shortened, abnormal	hoxa13a^{ot1013/ot1013}; hoxa13b^ot1014/+; hoxd13a^{ot1015/ot1015}	standard conditions	Fig 2 from Corcoran et al., 2026
anal fin lepidotrichium shortened, abnormal	hoxa13a^{ot1013/ot1013}; hoxa13b^ot1014/+; hoxd13a^{ot1015/ot1015}	standard conditions	Fig 2 from Corcoran et al., 2026
pectoral fin lepidotrichium shortened, abnormal	hoxa13a^{ot1013/ot1013}; hoxa13b^ot1014/+; hoxd13a^{ot1015/ot1015}	standard conditions	Fig 2 from Corcoran et al., 2026
branched caudal fin ray shortened, abnormal	hoxa13a^{ot1013/ot1013}; hoxa13b^ot1014/+; hoxd13a^{ot1015/ot1015}	standard conditions	Fig 2 from Corcoran et al., 2026
branched anal fin ray shortened, abnormal	hoxa13a^{ot1013/ot1013}; hoxa13b^ot1014/+; hoxd13a^{ot1015/ot1015}	standard conditions	Fig 2 from Corcoran et al., 2026
pelvic fin joint decreased object quality, abnormal	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^ot1015/+	standard conditions	Fig 3 from Corcoran et al., 2026
branched dorsal fin ray shortened, exacerbated	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^ot1015/+	standard conditions	Fig 2 , Fig 3 from Corcoran et al., 2026
pectoral fin lepidotrichium decreased object quality, abnormal	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^ot1015/+	standard conditions	Fig 3 from Corcoran et al., 2026
anal fin lepidotrichium shortened, exacerbated	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^ot1015/+	standard conditions	Fig 2 , Fig 3 from Corcoran et al., 2026
branched caudal fin ray shortened, exacerbated	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^ot1015/+	standard conditions	Fig 3 from Corcoran et al., 2026
pectoral fin lepidotrichium shortened, exacerbated	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^ot1015/+	standard conditions	Fig 2 , Fig 3 from Corcoran et al., 2026
pectoral fin joint decreased object quality, abnormal	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^ot1015/+	standard conditions	Fig 3 from Corcoran et al., 2026
dorsal fin joint decreased object quality, abnormal	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^ot1015/+	standard conditions	Fig 3 from Corcoran et al., 2026
pelvic fin lepidotrichium shortened, exacerbated	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^ot1015/+	standard conditions	Fig 2 , Fig 3 from Corcoran et al., 2026
anal fin joint decreased object quality, abnormal	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^ot1015/+	standard conditions	Fig 3 from Corcoran et al., 2026
branched anal fin ray shortened, exacerbated	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^ot1015/+	standard conditions	Fig 2 , Fig 3 from Corcoran et al., 2026
dorsal fin lepidotrichium decreased object quality, abnormal	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^ot1015/+	standard conditions	Fig 3 from Corcoran et al., 2026
dorsal fin grem1b expression decreased amount, abnormal	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^{ot1015/ot1015}	standard conditions	Fig 8 from Corcoran et al., 2026
branched dorsal fin ray joint absent, abnormal	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^{ot1015/ot1015}	standard conditions	Fig 6 from Corcoran et al., 2026
branched dorsal fin ray actinotrichium absent, abnormal	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^{ot1015/ot1015}	standard conditions	Fig 1 , Fig 3 , Fig 4 from Corcoran et al., 2026
pelvic fin joint decreased object quality, abnormal	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^{ot1015/ot1015}	standard conditions	Fig 3 , Fig 4 from Corcoran et al., 2026
pelvic fin lepidotrichium decreased object quality, abnormal	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^{ot1015/ot1015}	standard conditions	Fig 1 from Corcoran et al., 2026
branched dorsal fin ray shortened, abnormal	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^{ot1015/ot1015}	standard conditions	Fig 6 from Corcoran et al., 2026
dorsal fin lepidotrichium 4 increased thickness, abnormal	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^{ot1015/ot1015}	standard conditions	Fig 7 from Corcoran et al., 2026
anal fin grem1b expression decreased amount, abnormal	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^{ot1015/ot1015}	standard conditions	Fig 8 from Corcoran et al., 2026
caudal fin procurrent ray actinotrichium absent, abnormal	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^{ot1015/ot1015}	standard conditions	Fig 4 from Corcoran et al., 2026
dorsal fin lepidotrichium 2 increased thickness, abnormal	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^{ot1015/ot1015}	standard conditions	Fig 7 from Corcoran et al., 2026
pectoral fin lepidotrichium bifurcated, abnormal	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^{ot1015/ot1015}	standard conditions	Fig 4 from Corcoran et al., 2026
branched dorsal fin ray shortened, exacerbated	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^{ot1015/ot1015}	standard conditions	Fig 2 , Fig 3 from Corcoran et al., 2026
pectoral fin lepidotrichium decreased object quality, abnormal	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^{ot1015/ot1015}	standard conditions	Fig 1 , Fig 3 from Corcoran et al., 2026
branched anal fin ray bifurcated, abnormal	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^{ot1015/ot1015}	standard conditions	Fig 4 from Corcoran et al., 2026
pelvic fin lepidotrichium bifurcated, abnormal	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^{ot1015/ot1015}	standard conditions	Fig 4 from Corcoran et al., 2026
branched caudal fin ray actinotrichium absent, abnormal	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^{ot1015/ot1015}	standard conditions	Fig 1 , Fig 3 , Fig 4 from Corcoran et al., 2026
pectoral fin lepidotrichium shortened, exacerbated	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^{ot1015/ot1015}	standard conditions	Fig 2 , Fig 3 from Corcoran et al., 2026
anal fin lepidotrichium shortened, exacerbated	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^{ot1015/ot1015}	standard conditions	Fig 2 , Fig 3 from Corcoran et al., 2026
anal fin anterior-posterior axis shortened, abnormal	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^{ot1015/ot1015}	standard conditions	Fig 5 from Corcoran et al., 2026
branched caudal fin ray shortened, exacerbated	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^{ot1015/ot1015}	standard conditions	Fig 3 from Corcoran et al., 2026
anal fin lepidotrichium shortened, abnormal	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^{ot1015/ot1015}	standard conditions	Fig 1 from Corcoran et al., 2026
pectoral fin joint decreased object quality, abnormal	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^{ot1015/ot1015}	standard conditions	Fig 3 , Fig 4 from Corcoran et al., 2026
branched dorsal fin ray increased thickness, abnormal	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^{ot1015/ot1015}	standard conditions	Fig 6 from Corcoran et al., 2026
dorsal fin joint decreased object quality, abnormal	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^{ot1015/ot1015}	standard conditions	Fig 3 , Fig 4 from Corcoran et al., 2026
dorsal fin anterior-posterior axis shortened, abnormal	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^{ot1015/ot1015}	standard conditions	Fig 5 from Corcoran et al., 2026
pelvic fin lepidotrichium shortened, exacerbated	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^{ot1015/ot1015}	standard conditions	Fig 2 , Fig 3 from Corcoran et al., 2026
branched anal fin ray shortened, exacerbated	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^{ot1015/ot1015}	standard conditions	Fig 2 , Fig 3 from Corcoran et al., 2026
anal fin joint decreased object quality, abnormal	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^{ot1015/ot1015}	standard conditions	Fig 3 , Fig 4 from Corcoran et al., 2026
branched dorsal fin ray bifurcated, abnormal	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^{ot1015/ot1015}	standard conditions	Fig 4 from Corcoran et al., 2026
dorsal fin lepidotrichium decreased object quality, abnormal	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^{ot1015/ot1015}	standard conditions	Fig 1 , Fig 3 from Corcoran et al., 2026
dorsal fin lepidotrichium 6 increased thickness, abnormal	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^{ot1015/ot1015}	standard conditions	Fig 7 from Corcoran et al., 2026
branched caudal fin ray bifurcated, abnormal	hoxa13a^{ot1013/ot1013}; hoxa13b^{ot1014/ot1014}; hoxd13a^{ot1015/ot1015}	standard conditions	Fig 4 from Corcoran et al., 2026
pectoral fin lepidotrichium decreased length, abnormal	hoxa13b^ch308/ch308; hoxa13a^ch307/ch307 + CRISPR1-hoxd13a + CRISPR2-hoxd13a	standard conditions	Fig. 3 from Nakamura et al., 2016
pectoral fin distal radial increased amount, abnormal	hoxa13b^ch308/ch308; hoxa13a^ch307/ch307 + CRISPR1-hoxd13a + CRISPR2-hoxd13a	standard conditions	Fig. 3 from Nakamura et al., 2016
pectoral fin proximal radial fused with pectoral fin proximal radial, abnormal	hoxa13b^ch308/ch308; hoxa13a^ch307/ch307 + CRISPR1-hoxd13a + CRISPR2-hoxd13a	standard conditions	Fig. 3 from Nakamura et al., 2016

Citations