ZFIN ID: ZDB-ALT-190820-1
Genomic Feature: ch308
Synonyms:
Affected Genomic Regions: hoxa13b (1)
Type: Indel (1)
Protocol: embryos treated with CRISPR2-hoxa13bCRISPR1-hoxa13b
Lab Of Origin: Shubin Lab
Location: Chr 16: 20896037 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: 14 bp inserted / 1 bp deleted in Exon 1 (1)
FLANKING SEQUENCE (GENOMIC)
TTAAATGTAAAATTGTATATTTCCATTGCTTTTATTTGTACTTTAATACATGGTATTATTATTTACGAATCTTACTGAAAATCCGGTAAGAAGACAAGTAATATCCCATTGTGCAATGGAATGCCACTTGGCCTCCTCTTATGAAGCTTATCACTAGAATCTTTACAGCTATTTTTGACTAAATCCCACCACTTTGTTTCAGTTCAATGCATTACGTTTGTCATGCTAGATTGGCGTTATCTCTAGTTTAGACGTTTATCAACCTCTTTGCATGTCACGTGCCTGCTCTCGTCCAATAACAGTTGGATCCTGACGCACGCGGGGCGCATGGGTATCTGTTACTCCACTGATCCACAGCTTCTCTTTCAGTCTTGGGGAATTCTAAAAGAGCTGCTGGGCTCCATGTAGGGCGTGCTATGACAGCGTCTTTACTCCTCCATTCCCGCTGGATTGACCCGGTGATGTTTCTCTATGACAACGGTTTGGATGATATGAGCAAA
A/TGGAAGGATGGAGC
ACATGGAAGGATTTGTGGGAGGCAATTTTGCTGCGAACCAGTGTAGGAATCTCATTGCCCATCCGTCTACTTTGGCTCCGAGTACAACCTACACATCGAGTGAGGTGCCAGTGTCGGGCATGGGAGAGCCTGTCAAACAATGCAGCCCGTGTTCGGCCGTGCAAAATACCCCAAGTGCTTCTTTGCCCTATGGATATTTTGGCGGCAGCTATTACCCGTGTAGGATGCCCAAGTCCTGCACGCAACCCACCACATATGGAGAAAAATACATGGACACTTCTGTTTCTGGAGAGGAGTTTCCTTCTCGAGCAAAGGAATTTGCTTTCTACCAGGGCTACTCGTCTGGCCCTTACCAGCCTGTACCAAGTTACCTTGACGTGCCAGTTGTACCTGCGCTGAGCGCTCCTTCGGAACCGAGACATGAATCTCTACTGCCTGTGGAAACGTACCAGCCGTGGGCAATCACTAACGGGTGGAGCAGTCCAGTGTACTGCCCGAAA
OTHER ch308 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous hoxa13bch308/ch308 hoxa13b ♀+/- ♂+/-
Complex hoxa13ach307/ch307 ; hoxa13bch308/ch308 hoxa13a, hoxa13b

CITATIONS  (1)