Morpholino

MO1-atp1a2a

ID
ZDB-MRPHLNO-060215-2
Name
MO1-atp1a2a
Previous Names
  • a2MO (1)
Target
Sequence
5' - TTTCATGTCCGTACCCTTTCCCCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-atp1a2a
Phenotype
Phenotype resulting from MO1-atp1a2a
Phenotype Fish Figures
determination of heart left/right asymmetry disrupted, abnormal TU + MO1-atp1a2a Fig. 2 with image from Doganli et al., 2012
determination of left/right symmetry disrupted, abnormal TL + MO1-atp1a2a Fig. 1 with imageFig. 2 with imageFig. 6 with image from Shu et al., 2007
digestive tract development disrupted, abnormal TL + MO1-atp1a2a Fig. 1 with image from Shu et al., 2007
embryonic heart tube development disrupted, abnormal TL + MO1-atp1a2a Fig. 1 with imageFig. 6 with image from Shu et al., 2007
gut mislocalised, abnormal TL + MO1-atp1a2a Fig. 1 with image from Shu et al., 2007
heart mislocalised, abnormal TL + MO1-atp1a2a Fig. 1 with imageFig. 6 with image from Shu et al., 2007
heart contraction decreased rate, abnormal TU + MO1-atp1a2a Fig. 2 with image from Doganli et al., 2012
heart looping disrupted, abnormal TL + MO1-atp1a2a Fig. 1 with imageFig. 6 with image from Shu et al., 2007
Kupffer's vesicle cilium movement quality, abnormal TL + MO1-atp1a2a Fig. T2 from Shu et al., 2007
liver mislocalised, abnormal TL + MO1-atp1a2a Fig. 1 with image from Shu et al., 2007
liver development disrupted, abnormal TL + MO1-atp1a2a Fig. 1 with image from Shu et al., 2007
mechanosensory behavior process quality, abnormal TU + MO1-atp1a2a Fig. 4 with image from Doganli et al., 2012
membrane depolarization process quality, abnormal TU + MO1-atp1a2a Fig. 3 with image from Doganli et al., 2012
pericardium edematous, abnormal TU + MO1-atp1a2a Fig. 2 with image from Doganli et al., 2012
post-vent region curved dorsal, abnormal TU + MO1-atp1a2a + MO4-tp53 Fig. 2 with image from Doganli et al., 2012
regulation of resting membrane potential disrupted, abnormal TU + MO1-atp1a2a Fig. 3 with image from Doganli et al., 2012
somite morphology, abnormal TU + MO1-atp1a2a + MO4-tp53 Fig. 2 with image from Doganli et al., 2012
thigmotaxis disrupted, abnormal TU + MO1-atp1a2a Fig. 4 with imageFig. SMovie6 from Doganli et al., 2012
Phenotype of all Fish created by or utilizing MO1-atp1a2a
Phenotype Fish Conditions Figures
digestive tract development disrupted, abnormal TL + MO1-atp1a2a standard conditions Fig. 1 with image from Shu et al., 2007
heart looping disrupted, abnormal TL + MO1-atp1a2a standard conditions Fig. 1 with imageFig. 6 with image from Shu et al., 2007
determination of left/right symmetry disrupted, abnormal TL + MO1-atp1a2a standard conditions Fig. 1 with imageFig. 2 with imageFig. 6 with image from Shu et al., 2007
gut mislocalised, abnormal TL + MO1-atp1a2a standard conditions Fig. 1 with image from Shu et al., 2007
heart mislocalised, abnormal TL + MO1-atp1a2a standard conditions Fig. 1 with imageFig. 6 with image from Shu et al., 2007
liver mislocalised, abnormal TL + MO1-atp1a2a standard conditions Fig. 1 with image from Shu et al., 2007
embryonic heart tube development disrupted, abnormal TL + MO1-atp1a2a standard conditions Fig. 1 with imageFig. 6 with image from Shu et al., 2007
Kupffer's vesicle cilium movement quality, abnormal TL + MO1-atp1a2a standard conditions Fig. T2 from Shu et al., 2007
liver development disrupted, abnormal TL + MO1-atp1a2a standard conditions Fig. 1 with image from Shu et al., 2007
mechanosensory behavior process quality, abnormal TU + MO1-atp1a2a standard conditions Fig. 4 with image from Doganli et al., 2012
membrane depolarization process quality, abnormal TU + MO1-atp1a2a standard conditions Fig. 3 with image from Doganli et al., 2012
determination of heart left/right asymmetry disrupted, abnormal TU + MO1-atp1a2a standard conditions Fig. 2 with image from Doganli et al., 2012
somite morphology, abnormal TU + MO1-atp1a2a standard conditions Fig. 2 with image from Doganli et al., 2012
regulation of resting membrane potential disrupted, abnormal TU + MO1-atp1a2a standard conditions Fig. 3 with image from Doganli et al., 2012
pericardium edematous, abnormal TU + MO1-atp1a2a standard conditions Fig. 2 with image from Doganli et al., 2012
post-vent region curved dorsal, abnormal TU + MO1-atp1a2a standard conditions Fig. 2 with image from Doganli et al., 2012
thigmotaxis disrupted, abnormal TU + MO1-atp1a2a standard conditions Fig. 4 with imageFig. SMovie6 from Doganli et al., 2012
heart contraction decreased rate, abnormal TU + MO1-atp1a2a standard conditions Fig. 2 with image from Doganli et al., 2012
post-vent region curved dorsal, abnormal TU + MO1-atp1a2a + MO4-tp53 standard conditions Fig. 2 with image from Doganli et al., 2012
pericardium edematous, abnormal TU + MO1-atp1a2a + MO4-tp53 standard conditions Fig. 2 with image from Doganli et al., 2012
somite morphology, abnormal TU + MO1-atp1a2a + MO4-tp53 standard conditions Fig. 2 with image from Doganli et al., 2012
determination of left/right symmetry disrupted, abnormal TL + MO1-atp1a2a + MO1-slc8a4a standard conditions Fig. 5 with image from Shu et al., 2007
Citations