ZFIN ID: ZDB-GENE-980526-416

Mapping Details

Gene Name: wingless-type MMTV integration site family member 2
Symbol: wnt2
PHYSICAL MAP AND BROWSER
Genome Browser Chr Position Assembly
ZFIN Gbrowse 18 20,613,241 - 20,636,549 GRCz11
Ensembl 18 20,613,241 - 20,636,549 GRCz11
Vega 18 20,624,175 - 20,647,483 GRCv10
NCBI Map Viewer 18 20,613,241 - 20,636,525 GRCz11
UCSC 18 - GRCv10
Mapped Clones containing wnt2
DKEY-270I2 Chr: 18 Details
CH211-238N5 Chr: 18 Details
PHYSICAL MAPPING No data available

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
18 77.7 cM wnt2 Mother of Pearl (MOP) Postlethwait, John H. Data
18 1579.0 cR wnt2 Goodfellow T51 (T51) Geisler, Robert Data
18 63.6 cM wnt2 Heat Shock (HS) Woods, Ian G. Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.
MAPPING FROM PUBLICATIONS
Marker Type Chr Distance Publication / Person Comments
unp279 STS 18 18.0 cR Blake et al., 2000 Blake et al. (Blood 96(13):4178-4184) Report mapping cbfb to LG18 on the T51 panel using multiple markers.
cbfb GENE 18 33.0 cR Blake et al., 2000 Blake et al. (Blood 96(13):4178-4184) Report mapping cbfb to LG18 on the T51 panel using multiple markers.
mef2aa GENE 18 Blake et al., 2000 Blake et al. (Blood 96(13):4178-4184) Report mapping cbfb to LG18 on the T51 panel using multiple markers.
z4755 SSLP 18 Blake et al., 2000 Blake et al. (Blood 96(13):4178-4184) Report mapping cbfb to LG18 on the T51 panel using multiple markers.
z13426 SSLP 18 Blake et al., 2000 Blake et al. (Blood 96(13):4178-4184) Report mapping cbfb to LG18 on the T51 panel using multiple markers.
z5479 SSLP 18 Blake et al., 2000 Blake et al. (Blood 96(13):4178-4184) Report mapping cbfb to LG18 on the T51 panel using multiple markers.
unp4 STS 18 Blake et al., 2000 Blake et al. (Blood 96(13):4178-4184) Report mapping cbfb to LG18 on the T51 panel using multiple markers.
unp140 STS 18 Blake et al., 2000 Blake et al. (Blood 96(13):4178-4184) Report mapping cbfb to LG18 on the T51 panel using multiple markers.

OTHER MAPPING INFORMATION
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
SJD 260 Dpn II 36.0
Forward Primer GGGGCTACGACACATCAAGA
Reverse Primer CAAAACAGCGAATAAAGACGG