header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-160119-3
Morpholino Name: MO1-lnx2a
Target: lnx2a (1)
Sequence:
5' - TTGAGAACTTTACCTGTGTTTGAGA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-lnx2a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-lnx2a
Expressed Gene Anatomy Figures
foxa3 Fig. S2 with image from Won et al., 2015
gata6 Fig. S2 with image from Won et al., 2015
gcga Fig. 2 with imageFig. 5 with imageFig. S2 with image from Won et al., 2015
hhex Fig. S2 with image from Won et al., 2015
ins Fig. 2 with imageFig. 5 with imageFig. S2 with image from Won et al., 2015
mnx2a Fig. S2 with imageFig. S7 with image from Won et al., 2015
numb Fig. 6 with imageFig. 7 with image from Won et al., 2015
pdx1 Fig. S2 with image from Won et al., 2015
prss1 Fig. 2 with imageFig. 5 with image from Won et al., 2015
ptf1a Fig. 2 with imageFig. 5 with imageFig. S2 with imageFig. S7 with image from Won et al., 2015
PHENOTYPE
Phenotype resulting from MO1-lnx2a
Phenotype of all Fish created by or utilizing MO1-lnx2a
Phenotype Fish Conditions Figures
exocrine pancreas ptf1a expression decreased amount, abnormal AB + MO1-lnx2a control Fig. 2 with imageFig. 5 with image from Won et al., 2015
anterior pancreatic bud ptf1a expression decreased distribution, abnormal AB + MO1-lnx2a control Fig. S2 with imageFig. S7 with image from Won et al., 2015
exocrine pancreas development decreased process quality, abnormal AB + MO1-lnx2a control Fig. S5 with imageFig. S7 with image from Won et al., 2015
exocrine pancreas development disrupted, abnormal AB + MO1-lnx2a control Fig. 2 with imageFig. 5 with image from Won et al., 2015
exocrine pancreas ptf1a expression decreased distribution, abnormal AB + MO1-lnx2a control Fig. 2 with imageFig. 5 with image from Won et al., 2015
exocrine pancreas prss1 expression decreased amount, abnormal AB + MO1-lnx2a control Fig. 2 with imageFig. 5 with image from Won et al., 2015
anterior pancreatic bud mnx2a expression decreased distribution, abnormal AB + MO1-lnx2a control Fig. S2 with imageFig. S7 with image from Won et al., 2015
exocrine pancreas prss1 expression decreased distribution, abnormal AB + MO1-lnx2a control Fig. 2 with imageFig. 5 with image from Won et al., 2015
anterior pancreatic bud EGFP expression decreased distribution, abnormal jh1Tg + MO1-lnx2a control Fig. 7 with imageFig. S2 with image from Won et al., 2015
anterior pancreatic bud cell population proliferation decreased process quality, abnormal jh1Tg + MO1-lnx2a control Fig. 7 with image from Won et al., 2015
pancreatic bud numb expression increased distribution, abnormal jh1Tg + MO1-lnx2a control Fig. 7 with image from Won et al., 2015
pancreas mCherry expression decreased distribution, abnormal s939Tg; s940Tg + MO1-lnx2a control Fig. 6 with image from Won et al., 2015
pancreas numb expression increased distribution, abnormal s939Tg; s940Tg + MO1-lnx2a control Fig. 6 with image from Won et al., 2015
pancreas Venus expression decreased distribution, abnormal s939Tg; s940Tg + MO1-lnx2a control Fig. 6 with image from Won et al., 2015
exocrine pancreas development process quality, ameliorated AB + MO1-lnx2a + MO4-numb standard conditions Fig. 5 with imageFig. S5 with image from Won et al., 2015
exocrine pancreas ptf1a expression amount, ameliorated AB + MO1-lnx2a + MO4-numb control Fig. 5 with image from Won et al., 2015
exocrine pancreas prss1 expression amount, ameliorated AB + MO1-lnx2a + MO4-numb control Fig. 5 with image from Won et al., 2015
exocrine pancreas prss1 expression spatial pattern, ameliorated AB + MO1-lnx2a + MO4-numb control Fig. 5 with image from Won et al., 2015
exocrine pancreas ptf1a expression spatial pattern, ameliorated AB + MO1-lnx2a + MO4-numb control Fig. 5 with image from Won et al., 2015
pancreas Venus expression spatial pattern, ameliorated s939Tg; s940Tg + MO1-lnx2a + MO4-numb control Fig. 6 with image from Won et al., 2015
pancreas numb expression spatial pattern, ameliorated s939Tg; s940Tg + MO1-lnx2a + MO4-numb control Fig. 6 with image from Won et al., 2015
pancreas mCherry expression spatial pattern, ameliorated s939Tg; s940Tg + MO1-lnx2a + MO4-numb control Fig. 6 with image from Won et al., 2015
OTHER MO1-lnx2a MORPHOLINO PAGESNo links to external sites
CITATIONS (1)