Morpholino

MO2-zic2b

ID
ZDB-MRPHLNO-130809-1
Name
MO2-zic2b
Previous Names
  • exon 1–intron 2 splice donor site (1)
Target
Sequence
5' - ATTGAAATAATTACCAGTGTGTGTC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-zic2b
Phenotype
Phenotype resulting from MO2-zic2b
Phenotype Fish Figures
cranial neural crest mislocalised dorsally, abnormal WT + MO2-zic2b Fig. 5 with image from Teslaa et al., 2013
embryonic viscerocranium morphogenesis decreased process quality, abnormal WT + MO2-zic2b Fig. 1 with image from Teslaa et al., 2013
forebrain development decreased process quality, abnormal WT + MO2-zic2b Fig. 8 with image from Teslaa et al., 2013
melanoblast aggregated, abnormal WT + MO2-zic2b Fig. 6 with image from Teslaa et al., 2013
melanoblast mislocalised, abnormal WT + MO2-zic2b Fig. 6 with image from Teslaa et al., 2013
melanocyte differentiation decreased process quality, abnormal WT + MO2-zic2b Fig. 6 with image from Teslaa et al., 2013
melanocyte migration decreased process quality, abnormal WT + MO2-zic2b Fig. 6 with image from Teslaa et al., 2013
neural crest cell cellular quality, abnormal WT + MO2-zic2b Fig. 4 with image from Teslaa et al., 2013
neural crest cell differentiation decreased process quality, abnormal WT + MO2-zic2b Fig. 4 with image from Teslaa et al., 2013
neural crest cell migration decreased process quality, abnormal WT + MO2-zic2b Fig. 5 with image from Teslaa et al., 2013
pharyngeal arch 2 shortened, abnormal WT + MO2-zic2b Fig. 1 with image from Teslaa et al., 2013
pharyngeal arch cartilage hypoplastic, abnormal WT + MO2-zic2b Fig. 1 with image from Teslaa et al., 2013
trunk has fewer parts of type melanoblast, abnormal WT + MO2-zic2b Fig. 6 with image from Teslaa et al., 2013
trunk has fewer parts of type xanthoblast, abnormal WT + MO2-zic2b Fig. 6 with image from Teslaa et al., 2013
ventral mandibular arch shortened, abnormal WT + MO2-zic2b Fig. 1 with image from Teslaa et al., 2013
ventral thalamus cellular quality, abnormal WT + MO2-zic2b Fig. 8 with image from Teslaa et al., 2013
xanthophore differentiation decreased process quality, abnormal WT + MO2-zic2b Fig. 6 with image from Teslaa et al., 2013
Phenotype of all Fish created by or utilizing MO2-zic2b
Phenotype Fish Conditions Figures
neural crest cell migration decreased process quality, abnormal WT + MO2-zic2b standard conditions Fig. 5 with image from Teslaa et al., 2013
neural crest cell differentiation decreased process quality, abnormal WT + MO2-zic2b standard conditions Fig. 4 with image from Teslaa et al., 2013
ventral mandibular arch shortened, abnormal WT + MO2-zic2b standard conditions Fig. 1 with image from Teslaa et al., 2013
melanocyte differentiation decreased process quality, abnormal WT + MO2-zic2b standard conditions Fig. 6 with image from Teslaa et al., 2013
xanthophore differentiation decreased process quality, abnormal WT + MO2-zic2b standard conditions Fig. 6 with image from Teslaa et al., 2013
pharyngeal arch cartilage hypoplastic, abnormal WT + MO2-zic2b standard conditions Fig. 1 with image from Teslaa et al., 2013
neural crest cell cellular quality, abnormal WT + MO2-zic2b standard conditions Fig. 4 with image from Teslaa et al., 2013
pharyngeal arch 2 shortened, abnormal WT + MO2-zic2b standard conditions Fig. 1 with image from Teslaa et al., 2013
melanoblast aggregated, abnormal WT + MO2-zic2b standard conditions Fig. 6 with image from Teslaa et al., 2013
trunk has fewer parts of type melanoblast, abnormal WT + MO2-zic2b standard conditions Fig. 6 with image from Teslaa et al., 2013
melanoblast mislocalised, abnormal WT + MO2-zic2b standard conditions Fig. 6 with image from Teslaa et al., 2013
forebrain development decreased process quality, abnormal WT + MO2-zic2b standard conditions Fig. 8 with image from Teslaa et al., 2013
trunk has fewer parts of type xanthoblast, abnormal WT + MO2-zic2b standard conditions Fig. 6 with image from Teslaa et al., 2013
ventral thalamus cellular quality, abnormal WT + MO2-zic2b standard conditions Fig. 8 with image from Teslaa et al., 2013
cranial neural crest mislocalised dorsally, abnormal WT + MO2-zic2b standard conditions Fig. 5 with image from Teslaa et al., 2013
melanocyte migration decreased process quality, abnormal WT + MO2-zic2b standard conditions Fig. 6 with image from Teslaa et al., 2013
embryonic viscerocranium morphogenesis decreased process quality, abnormal WT + MO2-zic2b standard conditions Fig. 1 with image from Teslaa et al., 2013
melanocyte differentiation decreased process quality, abnormal WT + MO2-zic2b + MO3-zic2a standard conditions Fig. 6 with image from Teslaa et al., 2013
embryonic viscerocranium morphogenesis decreased process quality, abnormal WT + MO2-zic2b + MO3-zic2a standard conditions Fig. 7 with image from Teslaa et al., 2013
ventral thalamus cellular quality, abnormal WT + MO2-zic2b + MO3-zic2a standard conditions Fig. 8 with image from Teslaa et al., 2013
xanthophore differentiation decreased process quality, abnormal WT + MO2-zic2b + MO3-zic2a standard conditions Fig. 6 with image from Teslaa et al., 2013
pharyngeal arch 3 decreased size, abnormal WT + MO2-zic2b + MO3-zic2a standard conditions Fig. 7 with image from Teslaa et al., 2013
cranial neural crest mislocalised dorsally, abnormal WT + MO2-zic2b + MO3-zic2a standard conditions Fig. 5 with image from Teslaa et al., 2013
melanoblast mislocalised, abnormal WT + MO2-zic2b + MO3-zic2a standard conditions Fig. 6 with image from Teslaa et al., 2013
neural crest cell differentiation decreased process quality, abnormal WT + MO2-zic2b + MO3-zic2a standard conditions Fig. 4 with image from Teslaa et al., 2013
head has fewer parts of type xanthoblast, abnormal WT + MO2-zic2b + MO3-zic2a standard conditions Fig. 6 with image from Teslaa et al., 2013
pharyngeal arch 4 decreased size, abnormal WT + MO2-zic2b + MO3-zic2a standard conditions Fig. 7 with image from Teslaa et al., 2013
pharyngeal arch 1 decreased size, abnormal WT + MO2-zic2b + MO3-zic2a standard conditions Fig. 7 with image from Teslaa et al., 2013
melanocyte migration decreased process quality, abnormal WT + MO2-zic2b + MO3-zic2a standard conditions Fig. 6 with image from Teslaa et al., 2013
pharyngeal arch 2 decreased size, abnormal WT + MO2-zic2b + MO3-zic2a standard conditions Fig. 7 with image from Teslaa et al., 2013
neural crest cell cellular quality, abnormal WT + MO2-zic2b + MO3-zic2a standard conditions Fig. 4 with image from Teslaa et al., 2013
neural crest cell migration decreased process quality, abnormal WT + MO2-zic2b + MO3-zic2a standard conditions Fig. 5 with image from Teslaa et al., 2013
trunk has fewer parts of type melanoblast, abnormal WT + MO2-zic2b + MO3-zic2a standard conditions Fig. 6 with image from Teslaa et al., 2013
hypothalamus cellular quality, abnormal WT + MO2-zic2b + MO3-zic2a standard conditions Fig. 8 with image from Teslaa et al., 2013
melanoblast aggregated, abnormal WT + MO2-zic2b + MO3-zic2a standard conditions Fig. 6 with image from Teslaa et al., 2013
forebrain development decreased process quality, abnormal WT + MO2-zic2b + MO3-zic2a standard conditions Fig. 8 with image from Teslaa et al., 2013
head has fewer parts of type melanoblast, abnormal WT + MO2-zic2b + MO3-zic2a standard conditions Fig. 6 with image from Teslaa et al., 2013
rhombomere 3 decreased size, abnormal WT + MO2-zic2b + MO2-zic3 + MO3-zic2a standard conditions Fig. 6 with image from Drummond et al., 2013
rhombomere 5 decreased size, abnormal WT + MO2-zic2b + MO2-zic3 + MO3-zic2a standard conditions Fig. 6 with image from Drummond et al., 2013
motor nucleus of vagal nerve anatomical region decreased size, abnormal rw0Tg + MO2-zic2b + MO3-zic2a + MO4-tp53 standard conditions Fig. 10 with image from Drummond et al., 2013
retinoic acid receptor signaling pathway decreased process quality, abnormal sk71Tg + MO2-zic2b + MO3-zic2a + MO4-tp53 standard conditions Fig. 8 with image from Drummond et al., 2013
Citations