header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-120127-9
Morpholino Name: MO1-glrx2
Target: glrx2
Sequence:
5' - GTTGAAGATACTAGGAAAGCAAACG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-glrx2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-glrx2
Expressed Gene Anatomy Figures
crestin Fig. 3 from Berndt et al., 2014
foxd3 Fig. 5 from Berndt et al., 2014
glrx2 Fig. 1 with image from Bräutigam et al., 2011
myl7 Fig. 2Fig. 3 from Berndt et al., 2014
PHENOTYPE
Phenotype resulting from MO1-glrx2
Phenotype Figures
apoptotic process increased occurrence, abnormal Fig. 1 with image from Bräutigam et al., 2011
apoptotic process increased process quality, abnormal Fig. 5 from Berndt et al., 2014
cell death increased process quality, abnormal Fig. 5 from Berndt et al., 2014
central nervous system apoptotic, abnormal Fig. 1 with image from Bräutigam et al., 2011
central nervous system has fewer parts of type white matter, abnormal Fig. 2 with image from Bräutigam et al., 2011
central nervous system development disrupted, abnormal Fig. 2 with imageFig. 4 with image from Bräutigam et al., 2011
central nervous system projection neuron axonogenesis disrupted, abnormal Fig. 2 with imageFig. 3 with image from Bräutigam et al., 2011
common cardinal vein blood circulation decreased process quality, abnormal Fig. 1 from Berndt et al., 2014
dopaminergic neuron decreased amount, abnormal Fig. 2 with image from Bräutigam et al., 2011
dorsal aorta blood circulation decreased process quality, abnormal Fig. 1 from Berndt et al., 2014
eye apoptotic, abnormal Fig. 1 with image from Bräutigam et al., 2011
forebrain apoptotic, abnormal Fig. 1 with image from Bräutigam et al., 2011
glutamatergic neuron decreased amount, abnormal Fig. 2 with image from Bräutigam et al., 2011
heart contraction process quality, abnormal Fig. 1 from Berndt et al., 2014
heart looping process quality, abnormal Fig. 2 from Berndt et al., 2014
hindbrain apoptotic, abnormal Fig. 1 with imageFig. S3 with image from Bräutigam et al., 2011
intersegmental vessel malformed, abnormal Fig. 1 with image from Bräutigam et al., 2013
mechanosensory behavior disrupted, abnormal text only from Bräutigam et al., 2011
neural crest cell migration process quality, abnormal Fig. 3 from Berndt et al., 2014
neural crest cell migration involved in heart formation process quality, abnormal Fig. 3 from Berndt et al., 2014
neuron apoptotic, abnormal Fig. S3 with image from Bräutigam et al., 2011
neuron decreased amount, abnormal Fig. 2 with image from Bräutigam et al., 2011
neuron axon decreased branchiness, abnormal Fig. 3 with image from Bräutigam et al., 2011
neuron axon decreased length, abnormal Fig. 3 with image from Bräutigam et al., 2011
neuron projection development disrupted, abnormal Fig. 3 with image from Bräutigam et al., 2011
secondary motor neuron decreased amount, abnormal Fig. 2 with image from Bräutigam et al., 2011
spinal cord apoptotic, abnormal Fig. 1 with imageFig. S3 with image from Bräutigam et al., 2011
swimming disrupted, abnormal text only from Bräutigam et al., 2011
trunk vasculature malformed, abnormal Fig. 1 with image from Bräutigam et al., 2013
vasculature development process quality, abnormal Fig. 1 with image from Bräutigam et al., 2013

Phenotype of all Fish created by or utilizing MO1-glrx2
Phenotype Fish Conditions Figures
neuron projection development disrupted, abnormal WT + MO1-glrx2 standard conditions Fig. 3 with image from Bräutigam et al., 2011
secondary motor neuron decreased amount, abnormal WT + MO1-glrx2 standard conditions Fig. 2 with image from Bräutigam et al., 2011
eye apoptotic, abnormal WT + MO1-glrx2 standard conditions Fig. 1 with image from Bräutigam et al., 2011
dopaminergic neuron decreased amount, abnormal WT + MO1-glrx2 standard conditions Fig. 2 with image from Bräutigam et al., 2011
swimming disrupted, abnormal WT + MO1-glrx2 standard conditions text only from Bräutigam et al., 2011
heart contraction process quality, abnormal WT + MO1-glrx2 standard conditions Fig. 1 from Berndt et al., 2014
mechanosensory behavior disrupted, abnormal WT + MO1-glrx2 standard conditions text only from Bräutigam et al., 2011
apoptotic process increased occurrence, abnormal WT + MO1-glrx2 standard conditions Fig. 1 with image from Bräutigam et al., 2011
heart looping process quality, abnormal WT + MO1-glrx2 standard conditions Fig. 2 from Berndt et al., 2014
dorsal aorta blood circulation decreased process quality, abnormal WT + MO1-glrx2 standard conditions Fig. 1 from Berndt et al., 2014
hindbrain apoptotic, abnormal WT + MO1-glrx2 standard conditions Fig. 1 with imageFig. S3 with image from Bräutigam et al., 2011
central nervous system projection neuron axonogenesis disrupted, abnormal WT + MO1-glrx2 standard conditions Fig. 2 with imageFig. 3 with image from Bräutigam et al., 2011
central nervous system apoptotic, abnormal WT + MO1-glrx2 standard conditions Fig. 1 with image from Bräutigam et al., 2011
cell death increased process quality, abnormal WT + MO1-glrx2 standard conditions Fig. 5 from Berndt et al., 2014
common cardinal vein blood circulation decreased process quality, abnormal WT + MO1-glrx2 standard conditions Fig. 1 from Berndt et al., 2014
spinal cord apoptotic, abnormal WT + MO1-glrx2 standard conditions Fig. 1 with imageFig. S3 with image from Bräutigam et al., 2011
central nervous system has fewer parts of type white matter, abnormal WT + MO1-glrx2 standard conditions Fig. 2 with image from Bräutigam et al., 2011
neural crest cell migration involved in heart formation process quality, abnormal WT + MO1-glrx2 standard conditions Fig. 3 from Berndt et al., 2014
central nervous system development disrupted, abnormal WT + MO1-glrx2 standard conditions Fig. 2 with imageFig. 4 with image from Bräutigam et al., 2011
apoptotic process increased process quality, abnormal WT + MO1-glrx2 standard conditions Fig. 5 from Berndt et al., 2014
forebrain apoptotic, abnormal WT + MO1-glrx2 standard conditions Fig. 1 with image from Bräutigam et al., 2011
neural crest cell migration process quality, abnormal WT + MO1-glrx2 standard conditions Fig. 3 from Berndt et al., 2014
neuron axon decreased branchiness, abnormal WT + MO1-glrx2 standard conditions Fig. 3 with image from Bräutigam et al., 2011
neuron decreased amount, abnormal WT + MO1-glrx2 standard conditions Fig. 2 with image from Bräutigam et al., 2011
neuron axon decreased length, abnormal WT + MO1-glrx2 standard conditions Fig. 3 with image from Bräutigam et al., 2011
neuron apoptotic, abnormal WT + MO1-glrx2 standard conditions Fig. S3 with image from Bräutigam et al., 2011
glutamatergic neuron decreased amount, abnormal WT + MO1-glrx2 standard conditions Fig. 2 with image from Bräutigam et al., 2011
neuron decreased amount, abnormal nns1Tg + MO1-glrx2 standard conditions Fig. 2 with image from Bräutigam et al., 2011
trunk vasculature malformed, abnormal y1Tg + MO1-glrx2 standard conditions Fig. 1 with image from Bräutigam et al., 2013
intersegmental vessel malformed, abnormal y1Tg + MO1-glrx2 standard conditions Fig. 1 with image from Bräutigam et al., 2013
vasculature development process quality, abnormal y1Tg + MO1-glrx2 standard conditions Fig. 1 with image from Bräutigam et al., 2013
OTHER MO1-glrx2 MORPHOLINO PAGESNo links to external sites
CITATIONS (3)