ZFIN ID: ZDB-MRPHLNO-111213-1
Morpholino Name: MO3-csf3r
Target: csf3r (1)
Sequence:
5' - GAAGCACAAGCGAGACGGATGCCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-csf3r No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-csf3r No data available
PHENOTYPE
Phenotype resulting from MO3-csf3r
Phenotype Figures
macrophage decreased amount, abnormal Fig. S4 with image from Feng et al., 2012
macrophage increased amount, abnormal Fig. S1 with image from Yan et al., 2015
neutrophil decreased amount, abnormal Fig. S1 with image from Yan et al., 2015
Fig. S3 with imageFig. S4 with image from Feng et al., 2012
neutrophil differentiation disrupted, abnormal Fig. S4 with image from Feng et al., 2012

Phenotype of all Fish created by or utilizing MO3-csf3r
Phenotype Fish Conditions Figures
whole organism decreased life span, abnormal AB + MO3-csf3r bacterial treatment by injection: Burkholderia cenocepacia Fig. 4 from Mesureur et al., 2017
whole organism has fewer parts of type neutrophil, abnormal TU + MO3-csf3r bacterial treatment by injection: Acinetobacter baumannii ATCC 17978 Fig. S2 with image from Bhuiyan et al., 2016
response to bacterium decreased process quality, abnormal WT + MO3-csf3r bacterial treatment by injection: Mycobacterium abscessus Fig. 5 with image from Bernut et al., 2016
whole organism decreased life span, abnormal WT + MO3-csf3r bacterial treatment by injection: Mycobacterium abscessus Fig. 5 with image from Bernut et al., 2016
response to virus process quality, abnormal WT + MO3-csf3r viral treatment: Chikungunya virus Fig. 7 with image from Palha et al., 2013
granuloma formation decreased occurrence, abnormal WT + MO3-csf3r bacterial treatment by injection: Mycobacterium abscessus Fig. 8 with image from Bernut et al., 2016
whole organism decreased life span, abnormal WT + MO3-csf3r viral treatment: Chikungunya virus Fig. 7 with image from Palha et al., 2013
macrophage increased amount, abnormal gl22Tg + MO3-csf3r standard conditions Fig. S1 with image from Yan et al., 2015
liver size, ameliorated gz32Tg + MO3-csf3r chemical treatment: doxycycline Fig. 3 from Yan et al., 2017
neutrophil decreased amount, abnormal nz50Tg + MO3-csf3r chemical treatment: prostaglandin E2 Fig. S4 with image from Feng et al., 2012
liver neutrophil decreased amount, abnormal nz50Tg + MO3-csf3r chemical treatment: doxycycline monohydrate Fig. 3 with image from Yan et al., 2015
neutrophil differentiation disrupted, abnormal nz50Tg + MO3-csf3r chemical treatment: prostaglandin E2 Fig. S4 with image from Feng et al., 2012
macrophage decreased amount, abnormal nz50Tg + MO3-csf3r standard conditions Fig. S4 with image from Feng et al., 2012
neutrophil decreased amount, abnormal nz50Tg + MO3-csf3r standard conditions Fig. S1 with image from Yan et al., 2015
Fig. S3 with imageFig. S4 with image from Feng et al., 2012
macrophage decreased amount, abnormal nz50Tg + MO3-csf3r chemical treatment: prostaglandin E2 Fig. S4 with image from Feng et al., 2012
neutrophil differentiation disrupted, abnormal nz50Tg + MO3-csf3r standard conditions Fig. S4 with image from Feng et al., 2012
liver macrophage increased amount, abnormal gz32Tg ; gl22Tg + MO3-csf3r chemical treatment: doxycycline Fig. 3 from Yan et al., 2017
liver neutrophil amount, ameliorated gz32Tg; nz50Tg + MO3-csf3r chemical treatment: doxycycline Fig. 3 from Yan et al., 2017
mucus secreting cell proliferative, abnormal hzm1Et; io006Tg + MO3-csf3r chemical treatment: prostaglandin E2 Fig. 3 with image from Feng et al., 2012
mucus secreting cell decreased amount, abnormal hzm1Et; io006Tg + MO3-csf3r chemical treatment: prostaglandin E2 Fig. 3 with image from Feng et al., 2012
neutrophil decreased amount, abnormal hzm1Et; io006Tg + MO3-csf3r chemical treatment: prostaglandin E2 Fig. 3 with image from Feng et al., 2012
mucus secreting cell decreased amount, abnormal hzm1Et; io006Tg + MO3-csf3r standard conditions Fig. 3 with image from Feng et al., 2012
mucus secreting cell proliferative, abnormal hzm1Et; io006Tg + MO3-csf3r standard conditions Fig. 3 with image from Feng et al., 2012
neutrophil decreased amount, abnormal hzm1Et; io006Tg + MO3-csf3r standard conditions Fig. 3 with image from Feng et al., 2012
neutrophil absent, abnormal hzm1Et; io006Tg; nz50Tg + MO3-csf3r control Fig. 3 with image from Antonio et al., 2015
neutrophil absent, abnormal hzm1Et; io006Tg; nz50Tg + MO3-csf3r resection: caudal fin Fig. 3 with image from Antonio et al., 2015
liver neutrophil amount, ameliorated rj30Tg ; gz26Tg + MO3-csf3r chemical treatment by environment: doxycycline Fig. 5 with image from Zhao et al., 2016
liver size, ameliorated rj30Tg ; gz26Tg + MO3-csf3r chemical treatment by environment: doxycycline Fig. 5 with image from Zhao et al., 2016
regulation of hydrogen peroxide metabolic process disrupted, abnormal WT + MO1-spi1b + MO3-csf3r standard conditions Fig. 1 with image from Pase et al., 2012
liver size, ameliorated gz32Tg + MO1-spi1b + MO3-csf3r chemical treatment: doxycycline Fig. 3 from Yan et al., 2017
macrophage differentiation disrupted, abnormal nz50Tg + MO1-spi1b + MO3-csf3r standard conditions Fig. S4 with image from Feng et al., 2012
neutrophil decreased amount, abnormal nz50Tg + MO1-spi1b + MO3-csf3r standard conditions Fig. S3 with imageFig. S4 with image from Feng et al., 2012
neutrophil differentiation disrupted, abnormal nz50Tg + MO1-spi1b + MO3-csf3r standard conditions Fig. S4 with image from Feng et al., 2012
macrophage decreased amount, abnormal nz50Tg + MO1-spi1b + MO3-csf3r chemical treatment: prostaglandin E2 Fig. S4 with image from Feng et al., 2012
macrophage decreased amount, abnormal nz50Tg + MO1-spi1b + MO3-csf3r standard conditions Fig. S4 with image from Feng et al., 2012
neutrophil differentiation disrupted, abnormal nz50Tg + MO1-spi1b + MO3-csf3r chemical treatment: prostaglandin E2 Fig. S4 with image from Feng et al., 2012
neutrophil decreased amount, abnormal nz50Tg + MO1-spi1b + MO3-csf3r chemical treatment: prostaglandin E2 Fig. S4 with image from Feng et al., 2012
macrophage differentiation disrupted, abnormal nz50Tg + MO1-spi1b + MO3-csf3r chemical treatment: prostaglandin E2 Fig. S4 with image from Feng et al., 2012
muscle cell cell wall repair process quality, abnormal gl22Tg + MO1-irf8 + MO1-spi1b + MO3-csf3r light damage: sarcolemma: muscle cell Fig. 1 with image from Middel et al., 2016
macrophage absent, abnormal gl22Tg + MO1-irf8 + MO1-spi1b + MO3-csf3r light damage: sarcolemma: muscle cell Fig. 1 with image from Middel et al., 2016
liver macrophage amount, ameliorated gz32Tg ; gl22Tg + MO1-spi1b + MO3-csf3r chemical treatment: doxycycline Fig. 3 from Yan et al., 2017
liver neutrophil amount, ameliorated gz32Tg; nz50Tg + MO1-spi1b + MO3-csf3r chemical treatment: doxycycline Fig. 3 from Yan et al., 2017
mucus secreting cell decreased amount, abnormal hzm1Et; io006Tg + MO1-spi1b + MO3-csf3r standard conditions Fig. 3 with image from Feng et al., 2012
neutrophil decreased amount, abnormal hzm1Et; io006Tg + MO1-spi1b + MO3-csf3r standard conditions Fig. 3 with image from Feng et al., 2012
macrophage decreased amount, abnormal hzm1Et; io006Tg + MO1-spi1b + MO3-csf3r standard conditions Fig. 3 with image from Feng et al., 2012
macrophage decreased amount, abnormal hzm1Et; io006Tg + MO1-spi1b + MO3-csf3r chemical treatment: prostaglandin E2 Fig. 3 with image from Feng et al., 2012
mucus secreting cell proliferative, abnormal hzm1Et; io006Tg + MO1-spi1b + MO3-csf3r chemical treatment: prostaglandin E2 Fig. 3 with image from Feng et al., 2012
neutrophil decreased amount, abnormal hzm1Et; io006Tg + MO1-spi1b + MO3-csf3r chemical treatment: prostaglandin E2 Fig. 3 with image from Feng et al., 2012
mucus secreting cell decreased amount, abnormal hzm1Et; io006Tg + MO1-spi1b + MO3-csf3r chemical treatment: prostaglandin E2 Fig. 3 with image from Feng et al., 2012
mucus secreting cell proliferative, abnormal hzm1Et; io006Tg + MO1-spi1b + MO3-csf3r standard conditions Fig. 3 with image from Feng et al., 2012
macrophage absent, abnormal hzm1Et; io006Tg; nz50Tg + MO1-spi1b + MO3-csf3r control Fig. 3 with image from Antonio et al., 2015
macrophage absent, abnormal hzm1Et; io006Tg; nz50Tg + MO1-spi1b + MO3-csf3r resection: caudal fin Fig. 3 with image from Antonio et al., 2015
neutrophil absent, abnormal hzm1Et; io006Tg; nz50Tg + MO1-spi1b + MO3-csf3r control Fig. 3 with image from Antonio et al., 2015
neutrophil absent, abnormal hzm1Et; io006Tg; nz50Tg + MO1-spi1b + MO3-csf3r resection: caudal fin Fig. 3 with image from Antonio et al., 2015
OTHER MO3-csf3r MORPHOLINO PAGESNo links to external sites
CITATIONS (16)