header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-111213-1
Morpholino Name: MO3-csf3r
Target: csf3r (1)
Sequence:
5' - GAAGCACAAGCGAGACGGATGCCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-csf3r No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-csf3r No data available
PHENOTYPE
Phenotype resulting from MO3-csf3r
Phenotype of all Fish created by or utilizing MO3-csf3r
Phenotype Fish Conditions Figures
whole organism decreased life span, abnormal AB + MO3-csf3r bacterial treatment by injection: Burkholderia cenocepacia Fig. 4 from Mesureur et al., 2017
neutrophil decreased amount, abnormal AB + MO3-csf3r control Fig. 3 with image from Ellett et al., 2018
whole organism decreased life span, abnormal AB + MO3-csf3r fungal treatment by injection: Talaromyces marneffei Fig. 3 with image from Ellett et al., 2018
neutrophil increased amount, ameliorated AB + MO3-csf3r fungal treatment by injection: Talaromyces marneffei Fig. 3 with image from Ellett et al., 2018
whole organism has fewer parts of type neutrophil, abnormal TU + MO3-csf3r bacterial treatment by injection: Acinetobacter baumannii ATCC 17978 Fig. S2 with image from Bhuiyan et al., 2016
response to bacterium decreased process quality, abnormal WT + MO3-csf3r bacterial treatment by injection: Mycobacteroides abscessus Fig. 5 with image from Bernut et al., 2016
whole organism decreased life span, abnormal WT + MO3-csf3r bacterial treatment by injection: Mycobacteroides abscessus Fig. 5 with image from Bernut et al., 2016
response to virus process quality, abnormal WT + MO3-csf3r viral treatment: Chikungunya virus Fig. 7 with image from Palha et al., 2013
granuloma formation decreased occurrence, abnormal WT + MO3-csf3r bacterial treatment by injection: Mycobacteroides abscessus Fig. 8 with image from Bernut et al., 2016
whole organism decreased life span, abnormal WT + MO3-csf3r viral treatment: Chikungunya virus Fig. 7 with image from Palha et al., 2013
macrophage increased amount, abnormal gl22Tg + MO3-csf3r standard conditions Fig. S1 with image from Yan et al., 2015
liver size, ameliorated gz32Tg + MO3-csf3r chemical treatment: doxycycline Fig. 3 from Yan et al., 2017
neutrophil decreased amount, abnormal nz50Tg + MO3-csf3r chemical treatment: prostaglandin E2 Fig. S4 with image from Feng et al., 2012
liver neutrophil decreased amount, abnormal nz50Tg + MO3-csf3r chemical treatment: doxycycline monohydrate Fig. 3 with image from Yan et al., 2015
neutrophil differentiation disrupted, abnormal nz50Tg + MO3-csf3r chemical treatment: prostaglandin E2 Fig. S4 with image from Feng et al., 2012
macrophage decreased amount, abnormal nz50Tg + MO3-csf3r standard conditions Fig. S4 with image from Feng et al., 2012
neutrophil decreased amount, abnormal nz50Tg + MO3-csf3r standard conditions Fig. S1 with image from Yan et al., 2015
Fig. S3 with imageFig. S4 with image from Feng et al., 2012
macrophage decreased amount, abnormal nz50Tg + MO3-csf3r chemical treatment: prostaglandin E2 Fig. S4 with image from Feng et al., 2012
neutrophil differentiation disrupted, abnormal nz50Tg + MO3-csf3r standard conditions Fig. S4 with image from Feng et al., 2012
liver macrophage increased amount, abnormal gz32Tg ; gl22Tg + MO3-csf3r chemical treatment: doxycycline Fig. 3 from Yan et al., 2017
liver neutrophil amount, ameliorated gz32Tg; nz50Tg + MO3-csf3r chemical treatment: doxycycline Fig. 3 from Yan et al., 2017
mucus secreting cell proliferative, abnormal hzm1Et; io006Tg + MO3-csf3r chemical treatment: prostaglandin E2 Fig. 3 with image from Feng et al., 2012
neutrophil decreased amount, abnormal hzm1Et; io006Tg + MO3-csf3r chemical treatment: prostaglandin E2 Fig. 3 with image from Feng et al., 2012
mucus secreting cell decreased amount, abnormal hzm1Et; io006Tg + MO3-csf3r chemical treatment: prostaglandin E2 Fig. 3 with image from Feng et al., 2012
mucus secreting cell decreased amount, abnormal hzm1Et; io006Tg + MO3-csf3r standard conditions Fig. 3 with image from Feng et al., 2012
mucus secreting cell proliferative, abnormal hzm1Et; io006Tg + MO3-csf3r standard conditions Fig. 3 with image from Feng et al., 2012
neutrophil decreased amount, abnormal hzm1Et; io006Tg + MO3-csf3r standard conditions Fig. 3 with image from Feng et al., 2012
neutrophil absent, abnormal hzm1Et; io006Tg; nz50Tg + MO3-csf3r control Fig. 3 with image from Antonio et al., 2015
neutrophil absent, abnormal hzm1Et; io006Tg; nz50Tg + MO3-csf3r resection: caudal fin Fig. 3 with image from Antonio et al., 2015
neutrophil decreased amount, abnormal i113Tg ; gl23Tg + MO3-csf3r control Fig. 5 with image from Ellett et al., 2018
liver neutrophil amount, ameliorated rj30Tg ; gz26Tg + MO3-csf3r chemical treatment by environment: doxycycline Fig. 5 with image from Zhao et al., 2016
liver size, ameliorated rj30Tg ; gz26Tg + MO3-csf3r chemical treatment by environment: doxycycline Fig. 5 with image from Zhao et al., 2016
regulation of hydrogen peroxide metabolic process disrupted, abnormal WT + MO1-spi1b + MO3-csf3r standard conditions Fig. 1 with image from Pase et al., 2012
liver size, ameliorated gz32Tg + MO1-spi1b + MO3-csf3r chemical treatment: doxycycline Fig. 3 from Yan et al., 2017
macrophage differentiation disrupted, abnormal nz50Tg + MO1-spi1b + MO3-csf3r standard conditions Fig. S4 with image from Feng et al., 2012
neutrophil decreased amount, abnormal nz50Tg + MO1-spi1b + MO3-csf3r standard conditions Fig. S3 with imageFig. S4 with image from Feng et al., 2012
neutrophil differentiation disrupted, abnormal nz50Tg + MO1-spi1b + MO3-csf3r standard conditions Fig. S4 with image from Feng et al., 2012
macrophage decreased amount, abnormal nz50Tg + MO1-spi1b + MO3-csf3r chemical treatment: prostaglandin E2 Fig. S4 with image from Feng et al., 2012
macrophage decreased amount, abnormal nz50Tg + MO1-spi1b + MO3-csf3r standard conditions Fig. S4 with image from Feng et al., 2012
neutrophil differentiation disrupted, abnormal nz50Tg + MO1-spi1b + MO3-csf3r chemical treatment: prostaglandin E2 Fig. S4 with image from Feng et al., 2012
neutrophil decreased amount, abnormal nz50Tg + MO1-spi1b + MO3-csf3r chemical treatment: prostaglandin E2 Fig. S4 with image from Feng et al., 2012
macrophage differentiation disrupted, abnormal nz50Tg + MO1-spi1b + MO3-csf3r chemical treatment: prostaglandin E2 Fig. S4 with image from Feng et al., 2012
muscle cell cell wall repair process quality, abnormal gl22Tg + MO1-irf8 + MO1-spi1b + MO3-csf3r light damage: sarcolemma: muscle cell Fig. 1 with image from Middel et al., 2016
macrophage absent, abnormal gl22Tg + MO1-irf8 + MO1-spi1b + MO3-csf3r light damage: sarcolemma: muscle cell Fig. 1 with image from Middel et al., 2016
liver macrophage amount, ameliorated gz32Tg ; gl22Tg + MO1-spi1b + MO3-csf3r chemical treatment: doxycycline Fig. 3 from Yan et al., 2017
liver neutrophil amount, ameliorated gz32Tg; nz50Tg + MO1-spi1b + MO3-csf3r chemical treatment: doxycycline Fig. 3 from Yan et al., 2017
mucus secreting cell decreased amount, abnormal hzm1Et; io006Tg + MO1-spi1b + MO3-csf3r standard conditions Fig. 3 with image from Feng et al., 2012
neutrophil decreased amount, abnormal hzm1Et; io006Tg + MO1-spi1b + MO3-csf3r standard conditions Fig. 3 with image from Feng et al., 2012
macrophage decreased amount, abnormal hzm1Et; io006Tg + MO1-spi1b + MO3-csf3r standard conditions Fig. 3 with image from Feng et al., 2012
macrophage decreased amount, abnormal hzm1Et; io006Tg + MO1-spi1b + MO3-csf3r chemical treatment: prostaglandin E2 Fig. 3 with image from Feng et al., 2012
mucus secreting cell proliferative, abnormal hzm1Et; io006Tg + MO1-spi1b + MO3-csf3r chemical treatment: prostaglandin E2 Fig. 3 with image from Feng et al., 2012
neutrophil decreased amount, abnormal hzm1Et; io006Tg + MO1-spi1b + MO3-csf3r chemical treatment: prostaglandin E2 Fig. 3 with image from Feng et al., 2012
mucus secreting cell decreased amount, abnormal hzm1Et; io006Tg + MO1-spi1b + MO3-csf3r chemical treatment: prostaglandin E2 Fig. 3 with image from Feng et al., 2012
mucus secreting cell proliferative, abnormal hzm1Et; io006Tg + MO1-spi1b + MO3-csf3r standard conditions Fig. 3 with image from Feng et al., 2012
macrophage absent, abnormal hzm1Et; io006Tg; nz50Tg + MO1-spi1b + MO3-csf3r control Fig. 3 with image from Antonio et al., 2015
macrophage absent, abnormal hzm1Et; io006Tg; nz50Tg + MO1-spi1b + MO3-csf3r resection: caudal fin Fig. 3 with image from Antonio et al., 2015
neutrophil absent, abnormal hzm1Et; io006Tg; nz50Tg + MO1-spi1b + MO3-csf3r control Fig. 3 with image from Antonio et al., 2015
neutrophil absent, abnormal hzm1Et; io006Tg; nz50Tg + MO1-spi1b + MO3-csf3r resection: caudal fin Fig. 3 with image from Antonio et al., 2015
neutrophil decreased amount, abnormal i113Tg ; gl23Tg + MO1-spi1b + MO3-csf3r control Fig. 5 with image from Ellett et al., 2018
defense response to fungus increased efficacy, abnormal i113Tg ; gl23Tg + MO1-spi1b + MO3-csf3r fungal treatment by injection: Talaromyces marneffei Fig. 5 with image from Ellett et al., 2018
macrophage decreased amount, abnormal i113Tg ; gl23Tg + MO1-spi1b + MO3-csf3r control Fig. 5 with image from Ellett et al., 2018
OTHER MO3-csf3r MORPHOLINO PAGESNo links to external sites
CITATIONS (17)