ZFIN ID: ZDB-MRPHLNO-110301-10
Morpholino Name: MO2-neo1a
Target: neo1a (1)
Previous Name: ATG-MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GGCTCCCCGCTCCGCCATCACTTTA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-neo1a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-neo1a
Expressed Gene Anatomy Figures
dbx1a diencephalon, hindbrain, neural tube (all 5) expand Fig. 5 with image from Mawdsley et al., 2004
egr2b rhombomere 3, rhombomere 5 Fig. 6 with image from Mawdsley et al., 2004
isl1 dorso-rostral cluster, epiphysis, hindbrain interneuron (all 7) expand Fig. 5 with image from Mawdsley et al., 2004
pax2a hindbrain, midbrain hindbrain boundary, otic vesicle Fig. 5 with imageFig. 6 with image from Mawdsley et al., 2004
shha diencephalon, floor plate Fig. 6 with image from Mawdsley et al., 2004
PHENOTYPE 
Phenotype resulting from MO2-neo1a
Phenotype Figures
brain structure, abnormal text only from Mawdsley et al., 2004
brain anterior-posterior axis decreased size, abnormal Fig. 2 with image from Mawdsley et al., 2004
brainstem and spinal white matter axon decreased amount, abnormal Fig. 4 with image from Mawdsley et al., 2004
CaP motoneuron axon decreased amount, abnormal Fig. 4 with image from Mawdsley et al., 2004
cerebellum morphology, abnormal Fig. 2 with image from Mawdsley et al., 2004
diencephalon lacks all parts of type third ventricle, abnormal Fig. 7 with image from Mawdsley et al., 2004
diencephalon morphology, abnormal Fig. 2 with image from Mawdsley et al., 2004
dorsal longitudinal fasciculus decreased thickness, abnormal Fig. 4 with image from Mawdsley et al., 2004
dorso-rostral cluster neuron decreased amount, abnormal Fig. 5 with image from Mawdsley et al., 2004
head flattened, abnormal text only from Mawdsley et al., 2004
hindbrain morphology, abnormal Fig. 2 with image from Mawdsley et al., 2004
hindbrain neuron decreased amount, abnormal Fig. 5 with image from Mawdsley et al., 2004
hindbrain interneuron decreased amount, abnormal Fig. 5 with image from Mawdsley et al., 2004
medial longitudinal fasciculus decreased thickness, abnormal Fig. 4 with image from Mawdsley et al., 2004
multicellular organism development disrupted, abnormal text only from Mawdsley et al., 2004
nervous system development disrupted, abnormal Fig. 2 with imageFig. 4 with imageFig. 5 with imagetext only from Mawdsley et al., 2004
neural tube unlumenized, abnormal Fig. 7 with image from Mawdsley et al., 2004
neural tube development disrupted, abnormal Fig. 7 with image from Mawdsley et al., 2004
neuroepithelial cell decreased amount, abnormal Fig. 7 with image from Mawdsley et al., 2004
neuroepithelial cell mislocalised, abnormal Fig. 7 with image from Mawdsley et al., 2004
pericardium edematous, abnormal text only from Mawdsley et al., 2004
post-vent region increased curvature, abnormal Fig. S4 with image from Gibert et al., 2011
primary motor neuron decreased amount, abnormal Fig. 5 with image from Mawdsley et al., 2004
Rohon-Beard neuron decreased amount, abnormal Fig. 5 with image from Mawdsley et al., 2004
somite decreased thickness, abnormal Fig. 2 with imageFig. 8 with image from Mawdsley et al., 2004
somite elongated, abnormal Fig. S4 with image from Gibert et al., 2011
somite flattened, abnormal Fig. S4 with image from Gibert et al., 2011
somite increased width, abnormal Fig. 2 with imageFig. 8 with image from Mawdsley et al., 2004
somite U-shaped, abnormal Fig. 3 with imageFig. 8 with imagetext only from Mawdsley et al., 2004
somitogenesis disrupted, abnormal Fig. S4 with image from Gibert et al., 2011
Fig. 2 with imageFig. 8 with image from Mawdsley et al., 2004
tegmentum morphology, abnormal Fig. 2 with image from Mawdsley et al., 2004
trigeminal ganglion neuron decreased amount, abnormal Fig. 5 with image from Mawdsley et al., 2004
whole organism decreased length, abnormal Fig. S4 with image from Gibert et al., 2011
whole organism necrotic, abnormal text only from Mawdsley et al., 2004
whole organism viability, abnormal text only from Mawdsley et al., 2004
whole organism anterior-posterior axis decreased length, abnormal Fig. 2 with imagetext only from Mawdsley et al., 2004

Phenotype of all Fish created by or utilizing MO2-neo1a
Phenotype Fish Conditions Figures
brain anterior-posterior axis decreased size, abnormal WT + MO2-neo1a standard conditions Fig. 2 with image from Mawdsley et al., 2004
diencephalon lacks all parts of type third ventricle, abnormal WT + MO2-neo1a standard conditions Fig. 7 with image from Mawdsley et al., 2004
whole organism viability, abnormal WT + MO2-neo1a standard conditions text only from Mawdsley et al., 2004
head flattened, abnormal WT + MO2-neo1a standard conditions text only from Mawdsley et al., 2004
primary motor neuron decreased amount, abnormal WT + MO2-neo1a standard conditions Fig. 5 with image from Mawdsley et al., 2004
tegmentum morphology, abnormal WT + MO2-neo1a standard conditions Fig. 2 with image from Mawdsley et al., 2004
neuroepithelial cell decreased amount, abnormal WT + MO2-neo1a standard conditions Fig. 7 with image from Mawdsley et al., 2004
neuroepithelial cell mislocalised, abnormal WT + MO2-neo1a standard conditions Fig. 7 with image from Mawdsley et al., 2004
somite flattened, abnormal WT + MO2-neo1a standard conditions Fig. S4 with image from Gibert et al., 2011
hindbrain neuron decreased amount, abnormal WT + MO2-neo1a standard conditions Fig. 5 with image from Mawdsley et al., 2004
hindbrain morphology, abnormal WT + MO2-neo1a standard conditions Fig. 2 with image from Mawdsley et al., 2004
dorso-rostral cluster neuron decreased amount, abnormal WT + MO2-neo1a standard conditions Fig. 5 with image from Mawdsley et al., 2004
trigeminal ganglion neuron decreased amount, abnormal WT + MO2-neo1a standard conditions Fig. 5 with image from Mawdsley et al., 2004
post-vent region increased curvature, abnormal WT + MO2-neo1a standard conditions Fig. S4 with image from Gibert et al., 2011
somitogenesis disrupted, abnormal WT + MO2-neo1a standard conditions Fig. S4 with image from Gibert et al., 2011
Fig. 2 with imageFig. 8 with image from Mawdsley et al., 2004
whole organism necrotic, abnormal WT + MO2-neo1a standard conditions text only from Mawdsley et al., 2004
neural tube unlumenized, abnormal WT + MO2-neo1a standard conditions Fig. 7 with image from Mawdsley et al., 2004
whole organism anterior-posterior axis decreased length, abnormal WT + MO2-neo1a standard conditions Fig. 2 with imagetext only from Mawdsley et al., 2004
nervous system development disrupted, abnormal WT + MO2-neo1a standard conditions Fig. 2 with imageFig. 4 with imageFig. 5 with imagetext only from Mawdsley et al., 2004
somite U-shaped, abnormal WT + MO2-neo1a standard conditions Fig. 3 with imageFig. 8 with imagetext only from Mawdsley et al., 2004
medial longitudinal fasciculus decreased thickness, abnormal WT + MO2-neo1a standard conditions Fig. 4 with image from Mawdsley et al., 2004
brainstem and spinal white matter axon decreased amount, abnormal WT + MO2-neo1a standard conditions Fig. 4 with image from Mawdsley et al., 2004
Rohon-Beard neuron decreased amount, abnormal WT + MO2-neo1a standard conditions Fig. 5 with image from Mawdsley et al., 2004
dorsal longitudinal fasciculus decreased thickness, abnormal WT + MO2-neo1a standard conditions Fig. 4 with image from Mawdsley et al., 2004
multicellular organism development disrupted, abnormal WT + MO2-neo1a standard conditions text only from Mawdsley et al., 2004
somite elongated, abnormal WT + MO2-neo1a standard conditions Fig. S4 with image from Gibert et al., 2011
somite decreased thickness, abnormal WT + MO2-neo1a standard conditions Fig. 2 with imageFig. 8 with image from Mawdsley et al., 2004
hindbrain interneuron decreased amount, abnormal WT + MO2-neo1a standard conditions Fig. 5 with image from Mawdsley et al., 2004
somite increased width, abnormal WT + MO2-neo1a standard conditions Fig. 2 with imageFig. 8 with image from Mawdsley et al., 2004
pericardium edematous, abnormal WT + MO2-neo1a standard conditions text only from Mawdsley et al., 2004
CaP motoneuron axon decreased amount, abnormal WT + MO2-neo1a standard conditions Fig. 4 with image from Mawdsley et al., 2004
diencephalon morphology, abnormal WT + MO2-neo1a standard conditions Fig. 2 with image from Mawdsley et al., 2004
whole organism decreased length, abnormal WT + MO2-neo1a standard conditions Fig. S4 with image from Gibert et al., 2011
cerebellum morphology, abnormal WT + MO2-neo1a standard conditions Fig. 2 with image from Mawdsley et al., 2004
brain structure, abnormal WT + MO2-neo1a standard conditions text only from Mawdsley et al., 2004
neural tube development disrupted, abnormal WT + MO2-neo1a standard conditions Fig. 7 with image from Mawdsley et al., 2004
dorso-rostral cluster neuron projection mislocalised dorsally, abnormal b1204Tg + MO1-dcc + MO2-neo1a standard conditions Fig. 5 with image from Gao et al., 2012
dorso-rostral cluster axon extension process quality, abnormal b1204Tg + MO1-dcc + MO2-neo1a standard conditions Fig. 5 with image from Gao et al., 2012
OTHER MO2-neo1a MORPHOLINO PAGESNo links to external sites
CITATIONS (3)