header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-100105-3
Morpholino Name: MO1-her4
Targets: her4.1 (1), her4.3 (1), her4.4 (1)
Previous Name: her4MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TTGATCCAGTGATTGTAGGAGTCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: The morpholino targets three loci in the her4 gene array: her4.1, her4.3 and her4.4
TARGET LOCATIONS
View all 3 target locations
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-her4 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-her4
Expressed Gene Anatomy Figures
cga Fig. 4 from Nakahara et al., 2016
gh1 Fig. 4 from Nakahara et al., 2016
pomca Fig. 4 from Nakahara et al., 2016
pou1f1 Fig. 4 from Nakahara et al., 2016
prl Fig. 4 from Nakahara et al., 2016
tshba Fig. 4 from Nakahara et al., 2016
PHENOTYPE
Phenotype resulting from MO1-her4
No data available

Phenotype of all Fish created by or utilizing MO1-her4
OTHER MO1-her4 MORPHOLINO PAGESNo links to external sites
CITATIONS (4)